Identification method and application of a Agaricus oleifera (Gan Agaricus oleifera No. 1) strain
By constructing a fingerprint map using the InDel-labeled primer combination of the tea tree mushroom "Gan Tea Tree Mushroom No. 1" strain, the accuracy and efficiency issues in tea tree mushroom strain identification were resolved, enabling rapid and accurate strain identification.
Patent Information
- Application Number
- CN202510488150.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-18
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2045-04-18
AI Technical Summary
Existing methods for identifying Agrocybe oleracea strains are inaccurate and time-consuming, especially when the phenomenon of "same species with different names, different species with the same name" is serious, which affects the rights of breeders and the risks of producers.
The InDel marker primer combination of the tea tree mushroom "Gan tea tree mushroom No. 1" strain was used for identification. Seven pairs of InDel marker primers were used to amplify the tea tree mushroom strain, and an InDel marker fingerprint was constructed. The strain identity was confirmed by comparing it with the standard banding pattern.
It achieves rapid and accurate strain identification, with detection time taking only 2-3 days, significantly improving identification accuracy and repeatability and reducing the risk of misidentification.
Smart Images

Figure CN120310948B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of Agrocybe tumefaciens, and in particular to an identification method and application of a Agrocybe tumefaciens strain "Gan Agrocybe tumefaciens No. 1". Background Art
[0002] Agrocybe tumefaciens is an edible fungus widely cultivated in my country. It is rich in various nutrients such as protein, polysaccharides, amino acids and vitamins, and has diuretic, stomach-moistening, spleen-strengthening, anti-cancer, and blood pressure-lowering effects. According to the analysis of the results of the national edible fungus statistical survey, the annual output of Agrocybe tumefaciens in my country in 2022 was 882,300 tons, ranking eighth among the major edible fungi in the country. In the actual production process of Agrocybe tumefaciens, there is a serious phenomenon of "same species with different names, different species with the same name", which not only damages the intellectual property rights of breeders, but also poses great risks to producers. In order to protect the rights and interests of breeders and reduce the risks of producers, and promote the healthy, stable and sustainable development of my country's Agrocybe tumefaciens industry, it is urgent to establish a simple, fast and reliable Agrocybe tumefaciens strain-specific identification technology.
[0003] At present, the existing methods for identifying tea tree mushroom strains mainly include conventional morphological detection, antagonism test and mushroom fruiting test, but these identification methods have their own shortcomings. Conventional morphological detection is not very reliable and has low accuracy, while antagonism test and mushroom fruiting test take a long time.
[0004] With the continuous maturation of DNA sequencing technology, DNA molecular markers can now detect the genetic specificity of Agrocybe aegerita strains at the genomic level. The completion of whole-genome sequencing of Agrocybe aegerita facilitates the development of InDel markers. InDel markers offer advantages such as widespread distribution, high density, and abundance across the genome, as well as excellent specificity, accuracy, stability, and rapidity and simplicity, making them suitable for the identification of Agrocybe aegerita strains. Summary of the Invention
[0005] The purpose of the present invention is to provide an identification method of the tea tree mushroom "Gan tea tree mushroom No. 1" strain and its application to solve the above problems.
[0006] According to a first aspect of the present invention, a method for identifying a tea tree mushroom "Gan Tea Tree Mushroom No. 1" strain is provided, wherein the tea tree mushroom strain is amplified using the following 7 pairs of InDel labeled primer combinations, and the resulting banding pattern is compared with the banding pattern of the tea tree mushroom "Gan Tea Tree Mushroom No. 1" strain. A strain with the same banding pattern is the tea tree mushroom "Gan Tea Tree Mushroom No. 1" strain; wherein the banding pattern numbering combination of the tea tree mushroom "Gan Tea Tree Mushroom No. 1" strain is: 2 / (1+2) / 2 / 2 / 2 / 2 / 2; wherein the number corresponding to primer CA30 is the first pair of banding pattern 2, wherein 2 corresponds to 274bp; primer CA The number corresponding to primer 32 is the second pair of banding type 1+2, where 1 corresponds to 238 bp and 2 corresponds to 296 bp; the number corresponding to primer CA75 is the third pair of banding type 2, where 2 corresponds to 317 bp; the number corresponding to primer CA77 is the fourth pair of banding type 2, where 2 corresponds to 134 bp; the number corresponding to primer CA102 is the fifth pair of banding type 2, where 2 corresponds to 192 bp; the number corresponding to primer CA106 is the sixth pair of banding type 2, where 2 corresponds to 195 bp; the number corresponding to primer CA119 is the seventh pair of banding type 2, where 2 corresponds to 209 bp;
[0007] The sequences of the 7 pairs of InDel marker primers are as follows:
[0008] CA30 forward primer: GAGGAGGTGGAGAAGGACCT;
[0009] Reverse primer: CTCGGGATTCTGCGAATGGA;
[0010] CA32 forward primer: ACCGACAGCAAGTTCGACAA;
[0011] Reverse primer: GCCATCCTGACCACTATCGG;
[0012] CA75 forward primer: TGAGTTCCACTGCTGTTCCC;
[0013] Reverse primer: ACTGGAGGTGAGGAGCTCAT;
[0014] CA77 forward primer: TTCATGAGTCCCGCAAGCAT;
[0015] Reverse primer: CCCTCCATATCGCAGCACTT;
[0016] CA102 forward primer: CAGAAGGAAAGTCGGAGCGT;
[0017] Reverse primer: TCCATGTCCTTTGCTGCCAT;
[0018] CA106 forward primer: TTATTGTCGCGCTACCTCGG;
[0019] Reverse primer: CTATATCGCGGCCCTGAGAC;
[0020] CA119 forward primer: CGCGTGCACGTTTGAGAAAT;
[0021] Reverse primer: AGAGAGGTAGATCCGGGCTC.
[0022] In some embodiments, the tea tree mushroom "Gan tea tree mushroom No. 1" strain has been deposited in the General Microbiology Center of the China Culture Collection Administration Committee on August 12, 2024, referred to as CGMCC, with the address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. Its biological preservation number is: CGMCC NO.41432, and its classification name is tea tree mushroom Cyclocybecylindracea.
[0023] According to a second aspect of the present invention, a method for identifying a tea tree mushroom strain "Gan Tea Tree Mushroom No. 1" is provided, and its application in identifying the tea tree mushroom strain "Gan Tea Tree Mushroom No. 1".
[0024] According to a third aspect of the present invention, there is provided an InDel marker primer combination for identifying the Agrocybe tumefaciens strain "Gan Agrocybe tumefaciens No. 1", the InDel marker primer combination consisting of the following 7 pairs of InDel marker primers:
[0025] CA30 forward primer: GAGGAGGTGGAGAAGGACCT;
[0026] Reverse primer: CTCGGGATTCTGCGAATGGA;
[0027] CA32 forward primer: ACCGACAGCAAGTTCGACAA;
[0028] Reverse primer: GCCATCCTGACCACTATCGG;
[0029] CA75 forward primer: TGAGTTCCACTGCTGTTCCC;
[0030] Reverse primer: ACTGGAGGTGAGGAGCTCAT;
[0031] CA77 forward primer: TTCATGAGTCCCGCAAGCAT;
[0032] Reverse primer: CCCTCCATATCGCAGCACTT;
[0033] CA102 forward primer: CAGAAGGAAAGTCGGAGCGT;
[0034] Reverse primer: TCCATGTCCTTTGCTGCCAT;
[0035] CA106 forward primer: TTATTGTCGCGCTACCTCGG;
[0036] Reverse primer: CTATATCGCGGCCCTGAGAC;
[0037] CA119 forward primer: CGCGTGCACGTTTGAGAAAT;
[0038] Reverse primer: AGAGAGGTAGATCCGGGCTC;
[0039] The tea tree mushroom "Gan tea tree mushroom No. 1" strain has been deposited in the General Microbiology Center of the China Culture Collection Administration on August 12, 2024, referred to as CGMCC, with the address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and its biological preservation number is: CGMCC NO.41432.
[0040] According to a fourth aspect of the present invention, there is provided an application of an InDel labeled primer combination for identifying the Agrocybe ganus root "Agrocybe ganus root 1" strain in identifying the Agrocybe ganus root "Agrocybe ganus root 1" strain.
[0041] According to the fifth aspect of the present invention, there is provided an application of an InDel marker primer combination for identifying the Agrocybe glabra “Gan Agrocybe glabra No. 1” strain in the construction of an InDel marker fingerprint of the Agrocybe glabra “Gan Agrocybe glabra No. 1” strain.
[0042] According to a sixth aspect of the present invention, a kit for identifying the Agrocybe ganensis strain "Agrocybe ganensis No. 1" is provided, comprising the above-mentioned InDel-labeled primer combination.
[0043] According to a seventh aspect of the present invention, a kit for identifying the Agrocybe glabra “Gan Agrocybe glabra No. 1” strain is provided, and its use in identifying the Agrocybe glabra “Gan Agrocybe glabra No. 1” strain is provided.
[0044] Beneficial effects of the present invention:
[0045] The present invention uses the InDel-labeled fingerprint of the "Ganchashu Agrocybe 1" strain of Agrocybe tumefaciens to identify the "Ganchashu Agrocybe 1" strain. Compared with conventional morphological testing, antagonism tests, and fruiting tests, this method has the advantages of shortened detection time, high accuracy, and good repeatability. This method only requires 2-3 days, while conventional antagonism tests require at least a week and fruiting tests require at least 4 months. This method is specific for the "Ganchashu Agrocybe 1" strain of Agrocybe tumefaciens among 48 collected strains in my country, and has promising application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] Figure 1 This is the InDel fingerprint of the Agrocybe tumefaciens strain "Gan Agrocybe tumefaciens No. 1", where M is a D2000 bp DNA ladder, numbers CA30, C32, CA75, CA77, CA102, CA106, and CA119 represent the seven pairs of InDel-labeled primers used, and the bands corresponding to the numbers represent the specific InDel allele fragments of the Agrocybe tumefaciens strain "Gan Agrocybe tumefaciens No. 1" amplified by these primers;
[0047] Figure 2 The amplification pattern of primer CA30 in 48 selected Agrocybe oleracea strains;
[0048] Figure 3 The amplification pattern of primer CA32 in 48 selected Agrocybe oleracea strains;
[0049] Figure 4 The amplification pattern of primer CA75 in 48 selected Agrocybe aegerita strains;
[0050] Figure 5 The amplification pattern of primer CA77 in 48 selected Agrocybe oleracea strains;
[0051] Figure 6 The amplification pattern of primer CA102 in 48 selected Agrocybe oleracea strains;
[0052] Figure 7 The amplification pattern of primer CA106 in the selected 48 Agrocybe oleracea strains;
[0053] Figure 8 This is the amplification pattern of primer CA119 in 48 selected Agrocybe aegerita strains. DETAILED DESCRIPTION
[0054] The present invention will be further described in detail below with reference to the embodiments.
[0055] The tea tree mushroom strain "Gan Tea Tree Mushroom No. 1" of the present invention is preserved in the Institute of Agricultural Applied Microbiology of Jiangxi Academy of Agricultural Sciences. The preservation date is August 12, 2024. It is preserved in the General Microbiology Center of China Culture Collection of Microorganisms, abbreviated as CGMCC, and its address is: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. Its biological preservation number is: CGMCCNO.41432.
[0056] Marker and Taq PCR Master Mix premix were purchased from Sangon Biotechnology Co., Ltd., and the remaining materials and reagents were common commercial products.
[0057] Test strains: 48 Agrocybe tumefaciens strains (detailed information on the strains is shown in Table 1)
[0058] Table 1 Agrocybe aegerita strains and their sources
[0059]
[0060]
[0061]
[0062] Example 1
[0063] The present invention provides an InDel marker fingerprint of the Agrocybe tumefaciens strain "Gan Agrocybe tumefaciens No. 1". The fingerprint consists of seven pairs of InDel markers. These InDel marker primers are developed based on insertion / deletion fragments in the Agrocybe tumefaciens genome. The amplification band pattern is good and highly reproducible. The sequences (5′-3′) of the seven pairs of InDel marker primers are as follows (for detailed primer information, see Table 2):
[0064] CA30 forward primer: GAGGAGGTGGAGAAGGACCT
[0065] Reverse primer: CTCGGGATTCTGCGAATGGA
[0066] CA32 forward primer: ACCGACAGCAAGTTCGACAA
[0067] Reverse primer: GCCATCCTGACCACTATCGG
[0068] CA75 forward primer: TGAGTTCCACTGCTGTTCCC
[0069] Reverse primer: ACTGGAGGTGAGGAGCTCAT
[0070] CA77 forward primer: TTCATGAGTCCCGCAAGCAT
[0071] Reverse primer: CCCTCCATATCGCAGCACTT
[0072] CA102 forward primer: CAGAAGGAAAGTCGGAGCGT
[0073] Reverse primer: TCCATGTCCTTTGCTGCCAT
[0074] CA106 forward primer: TTATTGTCGCGCTACCTCGG
[0075] Reverse primer: CTATATCGCGGCCCTGAGAC
[0076] CA119 forward primer: CGCGTGCACGTTTTGAGAAAT
[0077] Reverse primer: AGAGAGGTAGATCCGGGCTC.
[0078] The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.
[0079] Table 2 InDel marker primer information list
[0080]
[0081]
[0082] Example 2
[0083] The present invention also provides a method for constructing an InDel-labeled fingerprint of the Agrocybe tumefaciens strain "Gan Agrocybe tumefaciens No. 1", the method comprising the following steps:
[0084] (1) Mycelial culture: The mycelia of Agrocybe tumefaciens were transferred to potato dextrose medium (PDA) and cultured at 23-25°C in the dark. The mycelia were collected after 7 days.
[0085] (2) Genomic DNA extraction: The genomic DNA of the hyphae was extracted using the CTAB method. The total genomic DNA concentration and purity were detected by UV spectrophotometry. The concentration of the sample DNA was adjusted to 20-30 ng / uL.
[0086] The CTAB method for extracting genomic DNA from mycelium includes:
[0087] ① Take about 0.5g of fresh Agrocybe edulis mycelium into a 2mL centrifuge tube and put 2-3 steel balls. Place it in liquid nitrogen for rapid freeze-drying, then place it in a tissue grinder, set the frequency to 30Hz, and grind it for 30s until it becomes a uniform powder;
[0088] ② Add 2×CTAB extract preheated at 65℃ for 1 hour, keep at 65℃ for 60 minutes, and shake gently every 20 minutes to mix;
[0089] ③ Centrifuge at 12000 rpm and 4°C for 20 min, and aliquot the supernatant into two tubes, 800 μL each.
[0090] ④ Add a mixture of phenol, chloroform, and isoamyl alcohol in a volume ratio of 25:24:1 to the above supernatant, mix gently for 10 minutes, centrifuge at 12000 rpm and 4°C for 10 minutes, and transfer the supernatant to a new centrifuge tube;
[0091] ⑤ Add a mixture of chloroform and isoamyl alcohol in a volume ratio of 24:1 to the above centrifuge tube, mix gently for 10 minutes, centrifuge at 12000 rpm and 4°C for 10 minutes, and transfer the supernatant (record the volume) to another centrifuge tube;
[0092] ⑥ Add 2 / 3 of the volume of -20°C pre-cooled isopropanol relative to the supernatant in step ⑤ to the above centrifuge tube, mix well, let it settle at -20°C for 1 hour, then centrifuge at 8000 rpm and 4°C for 10 minutes, and discard the supernatant;
[0093] ⑦ Wash the precipitate once with 1 mL of 70% ethanol and centrifuge at 8000 rpm for 5 minutes at room temperature;
[0094] ⑧Discard the ethanol and blow dry in a clean bench; add 100 μL of 10× TE buffer and gently tap to dissolve the precipitate; add 1 μL of 10 mg / mL RNase A and incubate in a 37°C water bath for 1 hour to remove RNA;
[0095] ⑨ Store the obtained DNA extract in a -20℃ refrigerator for future use.
[0096] (3) Detection of InDel molecular markers: The extracted DNA was subjected to PCR amplification of the whole genome InDel markers; the PCR amplification system was as follows: a total volume of 25 μL, including: 12.5 μL of 2× Taq PCR Master Mix premix, 1 μL of DNA template at a concentration of 20-30 ng / μL, 1 μL of InDel marker forward primer and reverse primer, and 9.5 μL of ddH2O; the reaction procedure was as follows: 94°C for 4 min; 94°C for 30 s; 55°C for 30 s, 72°C for 1 min, 35 cycles, 72°C for 7 min, and storage at 4°C.
[0097] (4) Electrophoresis: 8 μL of the product obtained by PCR amplification was spotted on an agarose gel containing a nucleic acid dye and subjected to electrophoresis. The volume percentage concentration of the agarose gel was 3%, the running buffer was 1×TAE, the voltage was 95 V, the current was 400 mA, and the electrophoresis was performed for 1 h. The results were photographed and analyzed.
[0098] Seven pairs of InDel-labeled primers were used to perform PCR amplification of Agrocybe tumefaciens strains. The number and relative molecular weight of the allele fragments amplified by each InDel-labeled primer were determined by using a DNA molecular weight control D2000 bp DNA ladder. Figure 1 As shown, by finding the strain that meets the number combination of 2 / (1+2) / 2 / 2 / 2 / 2 / 2, it can be determined that the strain is the Agrocybe aegerita "Gan Agrocybe 1" strain. Figure 2-8 The number 1 in the figure is the strain "Gancha Tree Agrocybe No. 1", and its band is the same as Figure 1 of consistency.
[0099] Example 3
[0100] The present invention also provides a method for identifying a tea tree mushroom strain "Gan Tea Tree Mushroom No. 1", which adopts the above-mentioned InDel marker fingerprint for identification, utilizes 7 pairs of InDel marker primer combinations to amplify the tea tree mushroom strain, and compares the obtained banding pattern with the banding pattern of the tea tree mushroom strain "Gan Tea Tree Mushroom No. 1". If the banding pattern is consistent with the banding pattern, it is the tea tree mushroom strain "Gan Tea Tree Mushroom No. 1".
[0101] Among them, the banding number combination of the tea tree mushroom strain "Gan Tea Tree Mushroom No. 1" is: 2 / (1+2) / 2 / 2 / 2 / 2 / 2.
[0102] By amplifying the InDel marker primer banding patterns of 48 collected Agrocybe chaye strains, the present invention determined the number of allelic fragments amplified by 7 pairs of InDel marker primers in 48 Agrocybe chaye strains and numbered them (see Table 3). The number combination of different InDel allele sites can effectively identify the Agrocybe chaye "Gan Agrocybe chaye No. 1" strain ( Figure 2-8 The relative molecular weights of the alleles amplified by each InDel-tagged primer can be determined using a DNA molecular weight control D2000 bp DNA ladder. Strains containing the specific InDel allele combination of the Agrocybe tumefaciens strain "Gan Agrocybe tumefaciens No. 1" are the Agrocybe tumefaciens strain "Gan Agrocybe tumefaciens No. 1," and the numbering combination of this strain is: 2 / (1+2) / 2 / 2 / 2 / 2 / 2.
[0103] Among them, the number corresponding to primer CA30 is the first pair of band type 2, where 2 corresponds to 274bp; the number corresponding to primer CA32 is the second pair of band type 1+2, where 1 corresponds to 238bp and 2 corresponds to 296bp; the number corresponding to primer CA75 is the third pair of band type 2, where 2 corresponds to 317bp; the number corresponding to primer CA77 is the fourth pair of band type 2, where 2 corresponds to 134bp; the number corresponding to primer CA102 is the fifth pair of band type 2, where 2 corresponds to 192bp; the number corresponding to primer CA106 is the sixth pair of band type 2, where 2 corresponds to 195bp; the number corresponding to primer CA119 is the seventh pair of band type 2, where 2 corresponds to 209bp.
[0104] Figure 2-8 The number 1 in the figure is the strain "Gancha Tree Agrocybe No. 1", and its band is the same as Figure 1 of consistency.
[0105] Table 3 Summary of allelic fragment information amplified by InDel primers
[0106]
[0107] The above are only some embodiments of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the creative concept of the present invention, which all fall within the scope of protection of the present invention.
Claims
1. A method for identifying the tea tree mushroom strain "Gan tea tree mushroom No. 1", characterized in that: The following seven pairs of InDel-labeled primer combinations were used to amplify the Agrocybe tumefaciens strain. The resulting banding patterns were compared with those of the Agrocybe tumefaciens strain "Gan Agrocybe tumefaciens No. 1." The strain with the same banding pattern was the "Gan Agrocybe tumefaciens No. 1" strain. The banding pattern numbering combination for the "Gan Agrocybe tumefaciens No. 1" strain was 2 / (1+2) / 2 / 2 / 2 / 2 / 2. Primer CA30 corresponded to the first pair of banding patterns, pattern 2, with 2 corresponding to 274 bp. Primer CA32 corresponded to the second pair of banding patterns, pattern 1+2, with 1 corresponding to 238 bp and 2 corresponding to 296 bp. The number corresponding to primer CA75 is the third pair of band type 2, and 2 corresponds to 317 bp; Primer CA77 corresponds to the fourth pair of band type 2, and 2 corresponds to 134 bp; primer CA102 corresponds to the fifth pair of band type 2, and 2 corresponds to 192 bp; primer CA106 corresponds to the sixth pair of band type 2, and 2 corresponds to 195 bp; primer CA119 corresponds to the seventh pair of band type 2, and 2 corresponds to 209 bp; The sequences of the 7 pairs of InDel marker primers are as follows: CA30 forward primer: GAGGAGGTGGAGAAGGACCT; Reverse primer: CTCGGGATTCTGCGAATGGA; CA32 forward primer: ACCGACAGCAAGTTCGACAA; Reverse primer: GCCATCCTGACCACTATCGG; CA75 forward primer: TGAGTTCCACTGCTGTTCCC; Reverse primer: ACTGGAGGTGAGGAGCTCAT; CA77 forward primer: TTCATGAGTCCCGCAAGCAT; Reverse primer: CCCTCCATATCGCAGCACTT; CA102 forward primer: CAGAAGGAAAGTCGGAGCGT; Reverse primer: TCCATGTCCTTTGCTGCCAT; CA106 forward primer: TTATTGTCGCGCTACCTCGG; Reverse primer: CTATATCGCGGCCCTGAGAC; CA119 forward primer: CGCGTGCACGTTTGAGAAAT; Reverse primer: AGAGAGGTAGATCCGGGCTC.
2. The method according to claim 1, wherein The tea tree mushroom strain "Gan tea tree mushroom No. 1" has been deposited on August 12, 2024 at the General Microbiology Center of the China Culture Collection Administration, referred to as CGMCC, at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and its biological deposit number is: CGMCC NO. 41432.
3. Use of the method according to claim 1 or 2 in identifying the Agrocybe aegerita strain "Gan Agrocybe aegerita No. 1".
4. An InDel marker primer combination for identifying the tea tree mushroom "Gan tea tree mushroom No. 1" strain, characterized in that: The InDel marker primer combination consists of the following 7 pairs of InDel marker primers: CA30 forward primer: GAGGAGGTGGAGAAGGACCT; Reverse primer: CTCGGGATTCTGCGAATGGA; CA32 forward primer: ACCGACAGCAAGTTCGACAA; Reverse primer: GCCATCCTGACCACTATCGG; CA75 forward primer: TGAGTTCCACTGCTGTTCCC; Reverse primer: ACTGGAGGTGAGGAGCTCAT; CA77 forward primer: TTCATGAGTCCCGCAAGCAT; Reverse primer: CCCTCCATATCGCAGCACTT; CA102 forward primer: CAGAAGGAAAGTCGGAGCGT; Reverse primer: TCCATGTCCTTTGCTGCCAT; CA106 forward primer: TTATTGTCGCGCTACCTCGG; Reverse primer: CTATATCGCGGCCCTGAGAC; CA119 forward primer: CGCGTGCACGTTTGAGAAAT; Reverse primer: AGAGAGGTAGATCCGGGCTC; The tea tree mushroom strain "Gan Tea Tree Mushroom No. 1" has been deposited in the General Microbiology Center of the China Culture Collection Administration on August 12, 2024, referred to as CGMCC, at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and its biological preservation number is: CGMCC NO. 41432.
5. Use of the InDel-labeled primer combination as claimed in claim 4 in identifying the tea tree mushroom "Gan tea tree mushroom No. 1" strain.
6. Use of the InDel-labeled primer combination as claimed in claim 4 in the construction of an InDel-labeled fingerprint of the Agrocybe aegerita strain "Gan Agrocybe aegerita No. 1".
7. A kit for identifying the tea tree mushroom strain "Gan tea tree mushroom No. 1", characterized in that: Comprising the InDel-labeled primer combination according to claim 4.
8. Use of the kit as claimed in claim 7 in identifying the Agrocybe aegerita strain "Gan Agrocybe aegerita No. 1".
Citation Information
Patent Citations
Primer group for identifying mating type of agrocybe cylindracea Jiangxi tea AS-5 monokaryon strain, identification method and application
CN117737287A
Agrocybe cylindracea strain and breeding method
CN119344155A