A molecular marker associated with intramuscular fat content and meat color traits in pigs and application thereof

Abstract

The application discloses a molecular marker related to intramuscular fat content and meat color traits of pigs and application thereof, and belongs to the technical field of molecular markers. It is found by the application that a 2279bp insertion structural variation exists in the 9th exon region of FMO3 gene, and three types of genotypes, homozygous insertion (AA), homozygous non-insertion (WW) and heterozygosity (AW), exist in the gene locus through polymorphism detection in a Beijing black pig population. Correlation analysis of the three genotypes and meat quality traits of the Beijing black pig shows that the intramuscular fat content of the WW genotype is significantly higher than that of the AA genotype and the AW genotype, and the meat color trait of the AA genotype is significantly higher than that of the AW genotype. The application provides a new train of thought for further research on the effect of the FMO3 gene on the meat quality traits of pigs, and provides a theoretical reference for pig meat quality related breeding work.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular markers, in particular to a molecular marker related to intramuscular fat content and meat color traits of pigs and application thereof. BACKGROUND

[0002] China is not only a large country of pig breeding, but also ranks in the world in pork consumption. People's demand for pork quality is increasing with the improvement of living conditions. Among the many factors affecting meat quality traits, genetics accounts for a large part, so breeding pigs that meet people's demand for meat quality (such as meat color, intramuscular fat, flavor, etc.) while improving lean meat rate will become one of the important breeding indicators in future breeding work.

[0003] Flavin-containing monooxygenases (FMOs) are responsible for catalyzing the oxidation of substances containing nucleophilic nitrogen, sulfur, phosphorus or selenium heteroatoms. The six subtypes of FMOs have about 55% amino acid homology, of which the first five are functional and involved in the metabolic activation or detoxification of chemical substances including pesticides, drugs and diet-derived compounds. FMO3 is considered the most important member of the FMO family in the metabolism of exogenous chemicals, and is involved in the degradation of trimethylamine (TMA), which is related to human trimethylaminuria (TMAU) and the fishy odor characteristic of other species. TMA is considered to be the main endogenous substrate of FMO3, which is the product of the reduction-oxidation of trimethylamine (TMAO), choline, lecithin and betaine by intestinal bacteria. It has been reported that FMO3 is down-regulated in tissues with high fat deposition, so it can be inferred that increased fatty acid oxidation or increased lipogenesis in muscle adipocytes may be caused by the decreased expression of FMO3. FMO3 and other FMO gene families play an important role in regulating the production of pork odor. In addition, this gene is also related to fishy odor, pork pH and fat deposition. However, whether structural variations of this gene affect pork quality traits in pigs has not been reported.

[0004] Beijing black pig is a characteristic breeding variety developed by Chinese scientists through crossbreeding in Shuangqiao and Beiqiao farms. It has been identified as a maternal original variety pig by the national lean-type pig production project. In terms of meat quality traits, Beijing black pig has more meat and less bone, medium-thick back fat, high redness and low yellowness of meat color, and intramuscular fat content can reach more than 3%, and the flavor of the meat is rich. Therefore, by analyzing the structural variation of FMO3 gene in Beijing black pig, new ideas can be provided for further research on the effect of FMO3 gene on pork quality traits, and references can be provided for pork quality-related breeding work. SUMMARY

[0005] The application aims at providing a molecular marker and application related to intramuscular fat content and meat color traits of pigs to solve the problems in the prior art.

[0006] To achieve the above-mentioned purpose, the application provides the following solutions.

[0007] The application provides a molecular marker related to intramuscular fat content and meat color traits of pigs, which is an insertion fragment at the 85th and 86th bases of the sequence shown in SEQ ID NO. 5, and the nucleotide sequence of the insertion fragment is shown in SEQ ID NO. 7; the genotypes of the site where the insertion fragment is located include a homozygous genotype WW without insertion, a heterozygous genotype AW with insertion, and a homozygous genotype AA with insertion.

[0008] The application also provides a primer combination for detecting the molecular marker, which includes an upstream primer L-F with the nucleotide sequence shown in SEQ ID NO. 1, a downstream primer L-R with the nucleotide sequence shown in SEQ ID NO. 2, an upstream primer S-F with the nucleotide sequence shown in SEQ ID NO. 3, and an upstream primer S-F with the nucleotide sequence shown in SEQ ID NO. 4.

[0009] The application also provides a kit for identifying intramuscular fat content and meat color traits of pigs, which includes the primer combination.

[0010] The application also provides application of the primer combination or the kit in identifying intramuscular fat content and meat color traits of pigs.

[0011] Optionally, the meat color trait is meat color b value.

[0012] Optionally, the pig is Beijing black pig.

[0013] The application also provides a method for identifying intramuscular fat content and meat color traits of pigs, which includes the following steps.

[0014] Taking pig sample DNA to be detected as a template, the primer combination is used to perform PCR amplification on the template to obtain an amplification product;

[0015] If the electrophoresis result shows only a band of 134 bp, the genotype of the pig sample to be tested is WW; if the electrophoresis result shows only bands of 2413 bp and 755 bp, the genotype of the pig sample to be tested is AA; if the electrophoresis result shows bands of 2413 bp, 755 bp and 134 bp, the genotype of the pig sample to be tested is AW;

[0016] The intramuscular fat content of the WW genotype is significantly higher than that of the AA genotype and the AW genotype.

[0017] The meat color trait of the AA genotype is significantly higher than that of the AW genotype.

[0018] The meat color trait is the meat color b value.

[0019] Optionally, the reaction system of the PCR amplification is as follows: 2x Taq PCR Master Mix 12.5 μL, 10 μmol / L of the upstream and downstream primers each 1 μL, ddH2O 9.5 μL, DNA template 1 μL.

[0020] Optionally, the reaction program of the PCR amplification is as follows: 94.0 ℃ for 5 min; 94.0 ℃ for 30 sec, 59 ℃ for 30 sec, 72.0 ℃ for 2 min 30 sec, 31 cycles; 72.0 ℃ for 5 min; 4 ℃ storage.

[0021] Optionally, the pig is a Beijing black pig.

[0022] The present application discloses the following technical effects:

[0023] The present application finds a structural variation of the 9th exon region of a FMO3 gene (Chr9:63,757,964-63,777,279 bp) located on chromosome 9 of Sus scrofa version 11.1.

[0024] The present application finds three types of genotypes, homozygous insertion (AA), homozygous no insertion (WW) and heterozygosity (AW) in the Beijing black pig population. The above three genotypes are associated with the meat quality traits of Beijing black pigs, and the results show that the intramuscular fat content of the WW genotype is significantly higher than that of the AA genotype and the AW genotype; the meat color trait of the AA genotype is significantly higher than that of the AW genotype.

[0025] The present application provides a new idea for further studying the effect of FMO3 gene on pork quality traits, and provides a theoretical reference for pork quality related breeding work. BRIEF DESCRIPTION OF DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description only relate to some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from these drawings without any creative effort.

[0027] Figure 1 The insert breakpoint in S.scrofa 11.1 and the insert sequence in Meishan pig DNA sequence; Note: the upper diagram is the structure of FMO3 gene in S.scrofa 11.1, the vertical black line is the insert breakpoint; the middle diagram is the DNA sequence of the insert fragment; the lower diagram is the structure of the corresponding gene in Meishan pig genome annotation;

[0028] Figure 2 The schematic diagram of the PCR primers inside and across the insert sequence;

[0029] Figure 3 The PCR amplification results of the structure variation of the FMO3 gene insert fragment using primers (S-F; S-R) on 19 breeds;

[0030] Figure 4 The electropherogram of Beijing black pig FMO3 insertion site typing; wherein, 318 is homozygous insertion; 331 is heterozygote; 266 is homozygous without insertion;

[0031] Figure 5 The basis for genotype determination;

[0032] Figure 6 The identification results of sanger sequencing; wherein, A: 134 bp alignment; B: 2413 bp alignment;

[0033] Figure 7 The gene frequency and genotype frequency of the insert fragment in the Beijing black pig population. DETAILED DESCRIPTION

[0034] The various illustrative embodiments of the present application will now be described in detail below, which should not be considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.

[0035] It should be understood that the terms described in the present application are only for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value in the stated range, and any other stated value or intermediate value in the stated range, is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.

[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as those of ordinary skill in the art to which the application relates. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, preferred methods and materials are described. All publications mentioned in the specification are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. In case of conflict, the content of the specification will control.

[0037] Various modifications and changes can be made to the specific embodiments described herein without departing from the scope or spirit of the application. Other embodiments will be apparent to those of ordinary skill in the art from the description and examples provided herein. The description and examples are illustrative only.

[0038] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0039] Examples

[0040] 1. Experimental samples and grouping

[0041] 336 Beijing Black pig purebred sows were from Beijing Black Six Livestock Technology Co., Ltd. Beijing Black Pig Breeding Core Group, and their longissimus dorsi muscles were used as samples, including 171 boars and 165 sows. The muscle samples were cut into 3 cm long and 1 cm wide along the muscle fiber direction with a scalpel and placed in 2 mL cryogenic tubes. The samples were stored in liquid nitrogen for later use. The European pig breed samples were ear tissue samples, and the local pig breed samples were DNA samples stored at -36°C. All samples were stored in the laboratory of Liu Jianfeng, College of Animal Science and Technology, China Agricultural University, National Engineering Laboratory for Livestock and Poultry Genetics and Breeding. The specific information is shown in Table 1.

[0042] Table 1. Sample information table

[0043]

[0044]

[0045] 2. Extraction, concentration determination, and quality detection of pig genomic DNA

[0046] The blood / cell / tissue genomic DNA extraction kit (DP304) was used to extract the DNA of muscle tissue and ear tissue, and the steps were as follows:

[0047] (1) According to the instructions, a certain amount of anhydrous ethanol was added to GD and PW.

[0048] (2) Processing material: Cut 30 mg ear / muscle tissue into 1.5 mL centrifuge tube, cut and grind as much as possible.

[0049] (3) Add 200 μL buffer GA and shake until completely suspended.

[0050] (4) Add 20 μL proteinase K, mix and then place in molecular hybridization oven for overnight digestion at 56°C.

[0051] (5) Add 200 μL buffer GB to the digested tissue solution, mix well and then place in water bath at 70°C for about 10 min, wait until the tissue solution is clear and then centrifuge for 10 s.

[0052] (6) Add 200 μL anhydrous ethanol, shake for 15 s and then centrifuge for 10 s.

[0053] (7) Add the liquid and precipitate from step (6) to the adsorption column a-collecting tube A, centrifuge (12000 rpm, 30 s) and discard the waste liquid.

[0054] (8) Add 500 μL buffer GD to the adsorption column a-collecting tube A (12000 rpm, 30 s), discard the waste liquid.

[0055] (9) Add 600 μL PW to the adsorption column a-collecting tube A, centrifuge (12000 rpm, 30 s) and discard the waste liquid.

[0056] (10) Repeat the above step to rinse again, centrifuge (12000 rpm, 30 s), and let the alcohol-containing rinse solution dry after centrifugation.

[0057] (11) Assemble the adsorption column a-collecting tube B, use a certain amount of TE solution to elute the DNA on the adsorption column membrane, let stand for 5 min and then centrifuge (12000 rpm, 30 s).

[0058] Use the nucleic acid quality detector, use the eluent Buffer TE (the reagent for dissolving the DNA after genomic extraction) as a blank control, and start detecting the sample when the concentration is ±0.2 ng / μL. Take 2 μL of the DNA sample for measurement each time, and clean with TE buffer solution and wipe the optical surface with lens paper after each measurement. The software will automatically calculate the concentration, purity and spectral image of the DNA for evaluation. According to the OD values at A 260 and A 280 , if the measured A 260 / A 280 is between 1.8 and 2.2, it meets the purity requirements of DNA.

[0059] 3. Amplification of target sequence

[0060] Primer design and synthesis: The present application found that there is an insertion sequence of 2279 bp in the FMO3 gene, which is located at 229 bp downstream of the FMO3 gene on chromosome 9 of Sus scrofa 11.1 version genome (Chr9:63,757,964-63,777,279 bp), which is the 9th exon region of the FMO3 gene, see Figure 1 . A pair of primers was designed inside and across the insertion sequence using Premier3 software, see Figure 2 for design principles and Table 2 for primer sequences.

[0061] Table 2: Common PCR primer sequences

[0062]

[0063] The above two pairs of primers (L-F and L-R, S-F and S-R) were used to perform PCR amplification on the extracted genomic DNA, and the amplification system used in the PCR was 25 μL, which was: 2 × Taq PCR Master Mix 12.5 μL, 10 μmol / L of upstream primer (L-F / S-F) and downstream primer (L-R / F-R) each 1 μL, ddH2O 9.5 μL, genomic DNA 1 μL.

[0064] The reaction conditions used for PCR were as follows: ① pre-denaturation: 94.0℃ for 5 min; ② denaturation: 94.0℃ for 30 sec; ③ annealing: 59℃ for 30 sec; ④ extension: 72.0℃ for 2 min 30 sec; ⑤ steps ②-④ for 31 cycles; ⑥ 72.0℃ for 5 min; ⑦ 4℃ storage.

[0065] Target sequence without insertion fragment (SEQ ID NO. 5):

[0066] TGCCTCCATAGCTTTTCCCAATGTCAGGGAGTGCCTTAGATTTTCTGCATATCTGTGA CGTCTCAGACTCAACACAGAGCTGAAACAACAATCCCAAGATCCTGCAGGTCAGCTTCA TACCTAGTCAGCATAGC.

[0067] Target sequence with insertion fragment (SEQ ID NO. 6):

[0068]

[0069] Insert (SEQ ID NO. 7):

[0070]

[0071] 4. PCR product agarose gel electrophoresis detection and genotype determination

[0072] (1) Take a clean conical flask, measure 100 mL of 1xTBE solution in a clean conical flask, add 1.3 g of agarose, mix well and place in a microwave oven, heat to a boil until the agarose is completely melted. After the conical flask is not hot, add 5 μL of GelStain dye and mix well.

[0073] (2) Pour the solution into the tray with the inserted "comb".

[0074] (3) After the gel cools completely, gently pull out the "comb" and place the gel in the electrophoresis tank with the sample hole facing the negative electrode. Remove the bubbles and load 4 μL of sample on each hole. Load Trans2K Plus II DNA Marker in a blank hole as a control.

[0075] (4) Turn on the electrophoresis instrument switch, set the voltage to 111 V, the current to 260 mA, and electrophorese for 50 min. Turn off the switch. Observe whether there is a target band in the gel imaging system instrument. If the PCR product with insert structure variation matches the expected size and position, it is considered to have been successfully verified.

[0076] (5) According to the bands with insert structure variation, 2413 bp and 755 bp bands are amplified, and the individual without insert structure variation only amplifies 134 bp band. The insert of FMO3 gene is genotyped. The insert homozygous genotype only contains 2413 bp band and 755 bp band, the insert heterozygous genotype contains 2413 bp band, 134 bp band and 755 bp band, and the non-insert genotype only contains 134 bp band.

[0077] Gel recovery sequencing: Gel electrophoresis can only roughly determine the position of the band. In order to confirm that the amplified band is the target band, after gel electrophoresis of the amplified product, place it under the ultraviolet transmission gel cutting table, and cut the target band (2413 bp and 134 bp) to be detected with a clean scalpel. Put it in a 1.5 mL centrifuge tube. Sequencing was performed by Beijing Shengong Bioengineering Co., Ltd. The results were viewed and analyzed by DNAMAN.

[0078] The results are shown in Figure 3 and Figure 4 The PCR amplification product band of 755 bp was detected in 18 varieties except Duroc, which was consistent with the size of the designed primer fragment and had no band, indicating that the 18 varieties had the insert, and Duroc did not have the insert Figure 3), which is consistent with the results of detecting structural variations in Chinese local pig breeds using whole-genome sequencing data. There are three different genotypes of this locus in the Beijing Black pig population, homozygous insertion (AA), homozygous no insertion (WW), and heterozygous (AW) Figure 4 , and the expected band size and number of each genotype according to the design of primers are shown in Figure 5 .

[0079] The target fragments of the primers designed across the insertion sequence (L-F; L-R) were aligned using DNAMAN software. The target band (134 bp) was aligned after sequencing and splicing of the target band obtained by electrophoresis of Duroc 1115 (homozygous no insertion), and the target band (2413 bp) was aligned after sequencing and splicing of the target band obtained by electrophoresis of Beijing Black pig 416 (homozygous insertion), and the results are shown in Figure 6 . According to the alignment results, the alignment consistency of 134 bp is 99.24%, and the alignment consistency of 2413 bp is 97.22%. Excluding the influence of the sequencing technology itself, which may have a lower alignment rate for the first ten or so bp, it is shown that the amplified fragments are the target fragments.

[0080] 5. Genotype and allele frequency of the insertion sequence

[0081] In order to study the polymorphism of the insertion fragment in the pig population, the genotypic frequency and genotypic frequency of the new sequence insertion fragment of the Beijing Black pig sample group consisting of a total of 336 individuals (171 boars and 165 sows) were detected using the population genotyping method by using Excel 2010.

[0082] Among them, there are 8 pigs (4 boars and 4 sows) with WW genotype, 156 pigs (83 boars and 73 sows) with AW genotype, and 172 pigs (84 boars and 88 sows) with AA genotype. In this population of 336 individuals, the proportion of AA genotype and AW genotype individuals is about 1:1 (156 and 172 individuals), and the individuals with WW genotype account for a very small number (8 individuals). The results show that this insertion tends to be preserved during evolution and selection. On the contrary, individuals who completely lose the sequence are rare.

[0083] χ 2 The results of the fitness test show that none of the sites reaches the Hardy-Weinberg equilibrium level (P<0.05), and the deviation from the Hardy-Weinberg equilibrium law is shown in Table 3. The results of independence test show that the genotype frequency distribution in different gender pig groups is not significantly different (P=0.73>0.05). The genotype frequency and gene frequency after the insertion of the gene fragment are shown in Figure 7 .

[0084] Table 3 Genotype frequency and gene frequency of inserted fragment genes

[0085]

[0086] 6. Correlation analysis of three genotypes of inserted sequences with meat quality traits of Beijing Black pigs

[0087] The results of meat quality trait indexes of Beijing Black pigs are shown in Table 4. The meat is glossy, not sticky, elastic and red, and the pH is between 5.7 and 6.3, which is good. According to the measured L*, a* and b* values, the L value and a value are normal, the b value is excellent, and the overall meat color is excellent.

[0088] Table 4 Phenotype statistics of meat quality traits

[0089]

[0090] The meat quality trait records of three genotypes of Beijing Black pigs were sorted. First, the quartile method was used to remove abnormal data outside the LQ±1.5IQR range, and then descriptive statistics were performed on the meat quality traits. The following fixed model was used to perform correlation analysis of gene effects and meat quality traits by GLM in SPSS statistical software:

[0091] Yi = μ + ai + eij

[0092] where Y is the observed value of meat quality traits, μ is the population mean of meat quality traits, a is the genotype effect, e is the random residual effect, and the results are shown in Table 5. i i ij

[0093] Table 5 Correlation analysis of gene effects and meat quality traits

[0094]

[0095] After testing, the data was found to be normally distributed and homoscedastic. The results in Table 5 show that the genotype has a significant effect on intramuscular fat and meat color b value (P<0.05), but has no significant effect on other meat quality indexes.

[0096] ​​​The intramuscular fat content of homozygous non-insertion (WW) is 3.94%, the intramuscular fat content of homozygous insertion (AA) is 2.99%, and the intramuscular fat content of heterozygote (AW) is 2.75%. From the Bonferroni multiple comparison analysis of the number of piglets of different genotypes, the difference in intramuscular fat content between WW and AA is extremely significant (P<0.01), the difference in intramuscular fat content between WW and AW is significant (P<0.05), and the difference in intramuscular fat content between AA and AW is not significant (P>0.05). The intramuscular fat content of WW genotype individuals is significantly higher than that of AA genotype and AW genotype individuals, deviating from the ideal intramuscular fat range of 2-3%.

[0097] The meat color b value of homozygous non-insertion (WW) is missing, the meat color b value of homozygous insertion (AA) is 6.19, and the meat color b value of heterozygote (AW) is 5.56, and the difference between the two is significant (P<0.05). The meat color b value of AA genotype individuals is significantly higher than that of AW genotype individuals.

[0098] The above-described embodiments are only descriptions of the preferred modes of the present application and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. A primer combination for detecting molecular markers related to pig intramuscular fat content and meat color traits or a kit containing the primer combination in identifying pig intramuscular fat content and meat color traits, characterized in that: The molecular marker is an insertion fragment at bases 85 and 86 of the sequence shown in SEQ ID NO.5, and the nucleotide sequence of the insertion fragment is shown in SEQ ID NO.7; the genotypes at the site where the insertion fragment is located include a homozygous genotype WW without an insertion, a heterozygous genotype AW containing an insertion fragment, and a homozygous genotype AA containing an insertion fragment; The primer combination includes an upstream primer LF with a nucleotide sequence as shown in SEQ ID NO.1, a downstream primer LR with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer SF with a nucleotide sequence as shown in SEQ ID NO.3, and an upstream primer SF with a nucleotide sequence as shown in SEQ ID NO.4; The pig is Beijing black pig; the meat color trait is meat color b value.

2. A method for identifying pig intramuscular fat content and meat color traits, characterized in that: The following steps are involved: Using the pig sample DNA to be tested as a template, the primer combination described in claim 1 is used to perform PCR amplification on the template to obtain an amplified product; The amplified product is subjected to gel electrophoresis. If the electrophoresis result shows that it contains only a 134 bp band, the genotype of the pig sample to be tested is WW; If the electrophoresis results show that only bands of 2413 bp and 755 bp are present, the genotype of the pig sample to be tested is AA; If the electrophoresis results show that the bands are 2413 bp, 755 bp and 134 bp at the same time, the genotype of the pig sample to be tested is AW; The intramuscular fat content of WW genotype was significantly higher than that of AA and AW genotypes; The meat color trait of AA genotype was significantly higher than that of AW genotype; The meat color trait is the meat color b value; The pig is a Beijing black pig.

3. The method according to claim 2, characterized in that The PCR amplification reaction system was as follows: 12.5 μL of 2×Taq PCR Master Mix, 1 μL of each of the upstream and downstream primers at 10 μmol / L, 9.5 μL of ddH 2 O, and 1 μL of DNA template.

4. The method according to claim 2, characterized in that The reaction procedure of the PCR amplification was as follows: 94.0°C for 5 min; 94.0°C for 30 sec, 59°C for 30 sec, 72.0°C for 2 min 30 sec, 31 cycles; 72.0°C for 5 min; and storage at 4°C.

Images