Molecular marker related to Chinese pepper fruit orientation, primer combination, kit and application

Abstract

The invention discloses a molecular marker related to Chinese pepper fruit orientation, a primer combination, a kit and application. In combination with comparative genomics and re-sequencing analysis, a key variation site related to the orientation of the Chinese pepper fruit is successfully positioned on the upstream of the Up gene, a molecular marker primer is designed based on the variation site, and it is verified that the variation can influence the orientation of the fruit by using a Chinese pepper population. Through development and utilization of the molecular marker, the orientation of the Chinese pepper fruits can be accurately identified in the seedling stage. Different from a traditional linkage marker, the molecular marker is located on the upstream of the gene instead of the linkage marker, so that the molecular marker has higher identification effect and accuracy.

Description

Technical Field

[0001] The invention relates to the technical field of molecular breeding, and in particular to a molecular marker, a primer combination, a kit and an application thereof related to the fruit orientation of Chinese pepper. Background Art

[0002] Pepper (Capsicum spp.) belongs to the genus Capsicum of the Solanaceae family and originates from tropical and subtropical regions of the Americas. Pepper includes five cultivated species, namely annual pepper (Capsicum annuum L.), bush pepper (Capsicum frutescens L.), Chinese pepper (Capsicum chinense Jacq.), drooping pepper (Capsicum baccatum L.) and hairy pepper (Capsicum pubescens Ruiz&Pa). As one of the most important vegetable crops in the world, pepper has important economic and industrial value. With the development of molecular marker technology, it has been widely used in the evaluation of diversity and kinship of pepper, construction of genetic maps, and marker-assisted selection (MAS) and other research and applications.

[0003] With the rapid development of high-throughput sequencing technology, more and more high-quality pepper genomes have been published, providing higher accuracy for pepper variation detection and a reliable basis for analyzing pepper diversity using structural variation (SV).

[0004] Among Solanaceae crops, fruit orientation is a unique trait of peppers. The change in the direction of the pepper fruit tip from the wild upright to the cultivated drooping is of great significance to the domestication of peppers. The fruit of wild peppers is oriented upward, which may help birds to feed and thus promote seed dispersal. During the selective domestication process, pepper varieties with downward-facing fruits appeared. This change may be related to the increase in fruit size and its better resistance to the threats of biotic and abiotic factors. Fruits facing downward can reduce bird feeding and reduce damage to the fruit caused by direct sunlight.

[0005] The genetic control of pepper fruit orientation is simple and controlled by the Up locus, which is located on chromosome 12. Related molecular markers have been reported, including A2C7469 (with a genetic distance of 1.7 cM to fruit orientation) and upCAPS (with a genetic distance of 4.3 cM to fruit orientation). When these molecular markers were used for genetic positioning studies, the pepper genome sequence had not yet been determined, and the exact physical candidate regions and genes had not been determined.

[0006] The pepper genome sequence was published in 2014, providing a basis for locating the physical location of traits. In 2016, Han et al. (2016) constructed an ultra-high density map by resequencing the recombinant inbred line population and parents, and located the QTLs of fruit orientation to chromosomes 1, 4, and 12, respectively. Cheng et al. (2016) used Zunla-1 as the reference genome and constructed a chip using resequencing data for genetic positioning, locating pepper fruit orientation in the interval of 36.54Mb to 41.06Mb on chromosome 12. According to the annotation of the Zunla-1 genome, a total of 65 protein-coding genes were predicted. Cao et al. used Zunla-1 as the reference genome, whole genome association analysis and mixed pool sequencing analysis, and located a 579bp structural variation upstream of the Up gene in annual peppers that was related to fruit orientation.

[0007] There is still a need to develop an accurate, stable and reliable molecular marker for the fruit orientation of Chinese pepper. Summary of the invention

[0008] In order to solve at least some of the technical problems in the prior art, the present invention provides a molecular marker, a primer combination, a kit and an application related to the fruit orientation of Chinese pepper. Specifically, the present invention includes the following contents.

[0009] In a first aspect of the present invention, a molecular marker related to the fruit orientation of Chinese pepper is provided. The molecular marker is a structural variation molecular marker having a sequence shown in SEQ ID NO.1.

[0010] The second aspect of the present invention provides a primer combination for amplifying the molecular marker described in the first aspect.

[0011] In certain embodiments, according to the primer combination of the present invention, the primer combination comprises a forward primer and a reverse primer.

[0012] In certain embodiments, according to the primer combination of the present invention, the primer combination comprises:

[0013] A forward primer for amplifying the first fragment as shown in SEQ ID NO.2, and a reverse primer for amplifying the first fragment as shown in SEQ ID NO.3;

[0014] A forward primer for amplifying the second fragment as shown in SEQ ID NO.4, and a reverse primer for amplifying the second fragment as shown in SEQ ID NO.5;

[0015] A forward primer for amplifying the third fragment as shown in SEQ ID NO.6, and a reverse primer for amplifying the third fragment as shown in SEQ ID NO.7;

[0016] A forward primer for amplifying the fourth fragment as shown in SEQ ID NO.8, and a reverse primer for amplifying the fourth fragment as shown in SEQ ID NO.9; and

[0017] The forward primer shown in SEQ ID NO.10 is used to amplify the fifth fragment, and the reverse primer shown in SEQ ID NO.11 is used to amplify the fifth fragment.

[0018] The third aspect of the present invention provides a kit for identifying the orientation of Chinese pepper fruits, comprising the primer combination of the present invention.

[0019] The fourth aspect of the present invention provides the use of the molecular marker, primer combination or kit according to the present invention in genetic analysis of Chinese pepper.

[0020] In certain embodiments, according to the use of the present invention, the genetic analysis includes genetic diversity analysis, germplasm identification or assisted breeding.

[0021] A fifth aspect of the present invention provides a method for identifying the orientation of Chinese pepper fruits, comprising the step of detecting whether a molecular marker having a sequence shown in SEQ ID NO. 1 exists in the DNA of the Chinese pepper to be identified.

[0022] In certain embodiments, the method for identifying the orientation of Chinese pepper fruits according to the present invention comprises the following steps:

[0023] (1) Extracting sample DNA;

[0024] (2) amplifying the nucleic acid containing the molecular marker from the sample DNA by PCR using the primer combination of the present invention; and

[0025] (3) The fruit orientation of Chinese pepper was identified by detecting the length of the PCR product of the sample by electrophoresis.

[0026] In certain embodiments, according to the method for identifying the orientation of Chinese pepper fruits of the present invention, when the molecular marker is present, the orientation of the Chinese pepper fruits is downward, and when the molecular marker is absent, the orientation of the Chinese pepper fruits is upward.

[0027] The present invention combines comparative genomics and resequencing analysis to successfully locate a key variation site related to the fruit orientation of Chinese peppers upstream of the Up gene, designs molecular marker primers based on the variation site, and uses a Chinese pepper population to verify that the variation can affect the fruit orientation. The development and use of this molecular marker enables the accurate identification of the fruit orientation of Chinese peppers at the seedling stage. Unlike traditional linked markers, the molecular markers of the present invention are located upstream of the gene, rather than linked markers, and therefore have higher identification effects and accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Examples of fruit orientation phenotypes: a: fruit facing upwards, b: fruit facing downwards.

[0029] Figure 2 Figure a: Up gene upstream sequence, Figure b: PCR amplification agarose electrophoresis results. DETAILED DESCRIPTION

[0030] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0031] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that the upper and lower limits of the scope and each intermediate value therebetween are specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0032] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the invention belongs. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0033] Molecular markers

[0034] The first aspect of the present invention provides a specific molecular marker having a characteristic sequence for distinguishing the fruit orientation of Chinese pepper materials, the molecular marker being a structural variation with a length of 8104 bp, which is located 717 bp upstream of the Up gene. In a specific embodiment, the sequence has the nucleotide sequence shown in SEQ ID NO.1.

[0035] Primer combinations

[0036] The second aspect of the present invention provides a specific primer combination for amplifying the molecular marker of the present invention, comprising a forward primer and a reverse primer. In a specific embodiment, the primer combination comprises:

[0037] A forward primer for amplifying the first fragment as shown in SEQ ID NO.2, and a reverse primer for amplifying the first fragment as shown in SEQ ID NO.3;

[0038] A forward primer for amplifying the second fragment as shown in SEQ ID NO.4, and a reverse primer for amplifying the second fragment as shown in SEQ ID NO.5;

[0039] A forward primer for amplifying the third fragment as shown in SEQ ID NO.6, and a reverse primer for amplifying the third fragment as shown in SEQ ID NO.7;

[0040] A forward primer for amplifying the fourth fragment as shown in SEQ ID NO.8, and a reverse primer for amplifying the fourth fragment as shown in SEQ ID NO.9; and

[0041] The forward primer shown in SEQ ID NO.10 is used to amplify the fifth fragment, and the reverse primer shown in SEQ ID NO.11 is used to amplify the fifth fragment.

[0042] Reagent test kit

[0043] The present invention also provides a kit for identifying the orientation of Chinese pepper fruit, which comprises the primer combination of the present invention and an optional reagent for polymerase chain reaction. The reagent for polymerase chain reaction includes any reagent used in conventional PCR, such as polymerase, buffer, etc.

[0044] In addition to the above components, the kit of the present invention may also include precautions related to regulating the manufacture, use or sale of diagnostic kits. In addition, the kit of the present invention may also be provided with detailed instructions for use, storage and troubleshooting. The kit may also be optionally arranged in a suitable robotically operated device preferably for high throughput settings.

[0045] In certain embodiments, the components of the kit of the present invention can be provided as dry powders. When reagents and / or components are provided as dry powders, the powder can be restored to its original state by adding a suitable solvent. It is expected that the solvent can also be arranged in another container. The container will usually include at least one vial, test tube, flask, bottle, syringe and / or other container means, wherein the solvent is optionally placed in equal parts. The kit can also include a means for a second container containing a sterile, pharmaceutically acceptable buffer and / or other solvent.

[0046] In certain embodiments, the components of the kit of the present invention may be provided in the form of a solution, such as an aqueous solution. In the case of being present in an aqueous solution state, the concentration or content of these components can be easily determined by those skilled in the art according to different needs. For example, for storage purposes, the concentration of the components may be present in a higher form, and when in working state or use, the concentration may be reduced to the working concentration by, for example, diluting the above-mentioned higher concentration solution.

[0047] In the case where there is more than one component in the kit, the kit will also typically include a second, third or other additional container in which the additional components can be placed separately. In addition, combinations of various components can be included in the container. Any combination or reagent described herein can be a component in the kit.

[0048] application

[0049] The present invention further provides the use of molecular markers, primer combinations or kits in genetic analysis of Chinese pepper, wherein the genetic analysis includes but is not limited to genetic diversity analysis, germplasm identification, assisted breeding, etc.

[0050] Method for identifying the orientation of Chinese pepper fruits

[0051] The present invention provides a method for identifying the orientation of Chinese pepper fruit, which includes the step of detecting whether a molecular marker of the sequence shown in SEQ ID NO. 1 exists in the DNA of the Chinese pepper to be identified. The molecular marker has been described and will not be repeated here.

[0052] In the present invention, the method for detecting the presence of the molecular marker of the sequence shown in SEQ ID NO.1 can adopt any method known in the art, examples of which include methods of amplifying nucleic acids containing characteristic sequences and methods of directly sequencing plant genomes.

[0053] In certain embodiments, the method for identifying the fruit orientation of Chinese pepper of the present invention comprises the step of amplifying a gene sequence containing a characteristic sequence from the DNA of the Chinese pepper sample to be identified by PCR using forward and reverse primers.

[0054] In an exemplary embodiment, a method for identifying the orientation of Chinese pepper fruit comprises the following steps:

[0055] (1) Extracting sample DNA;

[0056] (2) a step of amplifying the nucleic acid containing the molecular marker from the sample DNA by PCR using a forward primer and a reverse primer;

[0057] (3) The fruit orientation of Chinese pepper was identified by detecting the length of the PCR product of the sample by electrophoresis.

[0058] In step (1), the "sample" refers to the whole plant or a part of the plant, such as plant roots, leaves or plant stems.

[0059] In step (2), the ratio of forward primer to reverse primer is 1:1. PCR reaction program: 85-98°C 1-5min; 85-98°C, 10-30s, 40-70°C, 10-30s, 50-80°C, 30-90s, a total of 10-40 cycles; 50-80°C, 1-10min. Also preferably, the PCR reaction program: 90-96°C 2-5min; 90-96°C, 12-20s, 50-65°C, 15-20s, 70-75°C, 40-80s, a total of 20-35 cycles; 65-75°C, 1-5min.

[0060] In step (3), in the step of detecting the length of the sample PCR product by electrophoresis, when the amplified fragments of the first to fifth fragments are present, the molecular marker (8104bp) is present, and the Chinese pepper fruit is oriented downward; when only the amplified fragment of the fifth fragment is present or the molecular marker is missing, the Chinese pepper fruit is oriented upward.

[0061] Example

[0062] This example uses high-quality genomes of 11 different pepper species, including 5 wild species and 6 cultivated species. These 6 cultivated species cover all 5 pepper cultivars. On this basis, a systematic comparative genomics analysis was carried out, as follows.

[0063] Using wild pepper PM1533 as the reference genome, minimap2 (v2.24-r1122) was used to align other genomes with PM1533, with the following parameters: -ax asm10. SVs were detected using SyRI (v1.6) with default parameters. Only deletions or insertions larger than 50 bp were retained.

[0064] Twenty samples of Chinese pepper were resequenced on the Illumina HiSeq 2000 sequencing platform. The raw data were processed with Trimmomatic v0.39 to remove adapters, poly-N and low-quality fragments to obtain clean data. The clean data were aligned to the Chinese pepper genome data using BWA 0.75 with the parameters aln-o 1-e 10-t 4-l 32-i 15-q 10. Samtools 0.1.19 was used with the Bayesian algorithm with the parameters -q 1-C 50-SDm 2-F0.002-u. The command mpileup was run for variation detection. Finally, high-quality variations were obtained through filtering. The minimum gene allele frequency was set to be greater than 0.01 and the deletion rate was set to be less than 0.1.

[0065] The fruit orientation of Chinese pepper materials was phenotypically identified and the fruit orientation phenotype was divided into two types: upward and downward ( Figure 1 ).

[0066] Through multi-genome comparison, it was found that there is a rare deletion variant SV of 8.1kb in the genome of Chinese pepper with fruits facing upwards. The SV is located 717bp upstream of the Up gene Cchi12g000958 (Chr12: 37,916,651bp-37,918,089bp, +), and the sequence is shown in SEQ ID NO.1. This SV does not exist in other existing wild and cultivated pepper genomes. Through further analysis of the resequencing data of Chinese pepper, it was found that the sequence does not exist in the Chinese pepper material with fruits facing upwards, but exists in the Chinese pepper material with fruits facing downwards ( Figure 2 a).

[0067] To further verify the relationship between the SV and fruit orientation, DNA was extracted from Chinese peppers with fruits facing upward and downward, and SV molecular marker primers were synthesized. The primer sequences were:

[0068] Up-seg1-F: TATTAGACCGGTTCGGGTTG (SEQ ID NO.2);

[0069] Up-seg1-R:TTGAGCCGAAGGTTTATTGG(SEQ ID NO.3);

[0070] Up-seg2-F: TGAGAGCGGTCATTCAACAG (SEQ ID NO.4);

[0071] Up-seg2-R: GGTGATGAAAGCTGTGCTGA (SEQ ID NO.5);

[0072] Up-seg3-F: CAGGGATGGTGGAAGACTGT (SEQ ID NO.6);

[0073] Up-seg3-R: GGACGTAGGTGTCCGTCAGT (SEQ ID NO.7);

[0074] Up-seg4-F: CCTGAAACAATCGAGCACCT (SEQ ID NO.8);

[0075] Up-seg4-R: TCGACGAATTATTGGCCTTC (SEQ ID NO.9);

[0076] Up-seg5-F: GTTCCTCATTTGCCCTTTGA (SEQ ID NO. 10);

[0077] Up-seg5-R: TTAGCTTTGCGGCCATAGTC (SEQ ID NO. 11).

[0078] PCR amplification was performed on Chinese pepper materials with fruits facing upward and downward, and the amplified products were detected by agarose gel electrophoresis. The electrophoresis results were as follows: Figure 2 As shown in b,

[0079] Identification of Chinese pepper using molecular markers of fruit orientation Figure 2 In b, 1 and 2 are Chinese peppers with fruits facing downward, and 3 is Chinese peppers with fruits facing downward. Segmental amplification of the SV revealed that the amplified fragments of seg1-seg5 were present in the materials with fruits facing downward in 1 and 2, indicating that the 8.1 kb fragment was present in the materials with fruits facing downward, and the accuracy of identification was 100%. In 3, only the amplified fragment of seg5 was present, indicating that the 8.1 kb fragment was missing in the materials with fruits facing upward.

[0080] The specific material preparation and verification procedures are as follows:

[0081] 1. Preparation of materials

[0082] Take 2 g of tender leaves, wrap them in tin foil, pre-cool them in liquid nitrogen, and freeze them at -80°C for DNA extraction.

[0083] 2. DNA Extraction

[0084] The DNA extraction method adopts the CTAB method, the steps are as follows:

[0085] (1) Take a 2 ml centrifuge tube, write the number on it, add two magnetic beads, and then add 1-2 samples frozen at -80℃;

[0086] (2) Add 250 μl of 2% CTAB (containing 0.15% BME) extract, disrupt the tissue at a frequency of 30 / s, sample for 2 min, centrifuge at 12,000 rpm for 1 min, and finally add 500 μl of 2% CTAB extract;

[0087] (3) Place the centrifuge tube in a 65°C water bath for 40 minutes. Mix thoroughly after the water bath. The amount of sample should not be too large, otherwise the cells will not be fully lysed due to the addition of too little extraction buffer.

[0088] (4) After taking out, mix up and down, add 750 μl of chloroform / isoamyl alcohol (24:1), shake up and down again, and let it stand for 10 minutes;

[0089] (5) Centrifuge at 12,000 rpm for 8 min at 4 °C;

[0090] (6) Use a pipette to slowly draw 400 μl of the supernatant into a 1.5 ml centrifuge tube pre-filled with 600 μl of ice-cold anhydrous ethanol, and gently invert the tube to mix;

[0091] (7) Centrifuge at 12000 rpm for 8 min and slowly pour off all the liquid;

[0092] (8) Add 4 ml of 75% ethanol to rinse the DNA, discard the supernatant, and repeat once;

[0093] (9) Air-dry at room temperature, then add 400 μl of sterile ddH2O to dissolve the DNA;

[0094] 3. PCR reaction system

[0095] SNP marker PCR amplification system (20 μl):

[0096]

[0097]

[0098] Marker PCR amplification procedure:

[0099]

[0100] 4. Detection of labeled PCR products

[0101] Weigh 2.0g agarose into a conical flask, measure 100ml 0.5×TBE buffer, heat in a microwave oven, add 6μl nucleic acid dye EB after the agarose is completely dissolved, mix well and pour into the gel mold, wait for the agarose to solidify at room temperature for about 25min, pull out the comb, take out the gel and put it in the electrophoresis tank.

[0102] 6-7 μL of PCR product was spotted, and D2000 bp DNA Ladder was used as a standard to indicate the molecular weight. The electrophoresis buffer was 0.5×TBE and the constant voltage was 180 V for 30 min. After the electrophoresis, the gel was developed under the BIO-RAD UV gel imaging system and the polymorphic bands were photographed and counted.

[0103] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

Claims

1. A molecular marker related to the fruit orientation of Chinese pepper, characterized in that: The molecular marker is a structural variation molecular marker, which has a sequence shown in SEQ ID NO.

1.

2. A primer combination, characterized in that: It is used to amplify the molecular marker described in claim 1.

3. The primer combination according to claim 2, characterized in that: Includes forward primer and reverse primer.

4. The primer combination according to claim 2, characterized in that: The primer combination comprises: A forward primer for amplifying the first fragment as shown in SEQ ID NO.2, and a reverse primer for amplifying the first fragment as shown in SEQ ID NO.3; A forward primer for amplifying the second fragment as shown in SEQ ID NO.4, and a reverse primer for amplifying the second fragment as shown in SEQ ID NO.5; A forward primer for amplifying the third fragment as shown in SEQ ID NO.6, and a reverse primer for amplifying the third fragment as shown in SEQ ID NO.7; A forward primer for amplifying the fourth fragment as shown in SEQ ID NO.8, and a reverse primer for amplifying the fourth fragment as shown in SEQ ID NO.9; and The forward primer shown in SEQ ID NO.10 is used to amplify the fifth fragment, and the reverse primer shown in SEQ ID NO.11 is used to amplify the fifth fragment.

5. A kit for identifying the orientation of Chinese pepper fruits, characterized in that: The invention comprises the primer combination according to any one of claims 2 to 4.

6. Use of the molecular marker according to claim 1, the primer combination according to any one of claims 2 to 4, or the kit according to claim 5 in genetic analysis of Chinese pepper.

7. The use according to claim 6, characterized in that: The genetic analysis includes genetic diversity analysis, germplasm identification or assisted breeding.

8. A method for identifying the orientation of Chinese pepper fruits, characterized in that: The method comprises the step of detecting whether a molecular marker having a sequence shown in SEQ ID NO.1 exists in the DNA of the Chinese pepper to be identified.

9. The method for identifying the orientation of Chinese pepper fruits according to claim 8, characterized in that: The following steps are involved: (1) Extracting sample DNA; (2) amplifying a nucleic acid containing the molecular marker from the sample DNA by PCR using the primer combination described in any one of claims 2 to 4; and (3) The fruit orientation of Chinese pepper was identified by detecting the length of the PCR product of the sample by electrophoresis.

10. The method for identifying the orientation of Chinese pepper fruits according to claim 8, characterized in that: When the molecular marker is present, the fruit of the Chinese pepper is oriented downwards; when the molecular marker is absent, the fruit of the Chinese pepper is oriented upwards.

Images