Method for detecting and typing multi-branch subtype nucleic acid of monkey pox virus

Abstract

The invention discloses a monkey pox virus multi-branch subtype nucleic acid detection and typing method, which comprises the following steps: step 1, comparing monkey pox virus subtypes I a, I b, I I a, I I b and other orthopox virus whole genome sequences to find sites meeting specific conditions, including gene position and single nucleotide polymorphism (SNP) site distribution; 2, fluorescent molecular probes are designed at the sites meeting the conditions, the fluorescent molecular probes comprise a molecular beacon probe, a TaqMan probe and other double-labeled fluorescent molecular probes with a fluorescent marker (Reporter) and a quenching marker (Quencher), the prepared kit uses a multi-probe combination of different fluorescent markers, the detection sensitivity is high, and the detection sensitivity is high. The kit can be used for in-vitro qualitative detection of at least four subtypes of the monkey pox virus in a human swab sample, including detection typing of Ia, Ib, IIa and IIb, is applicable to various sample types including skin lesion samples, swabs containing rash surfaces and exudates and throat swabs, can meet different clinical detection requirements, and provides wider choices for detection of the monkey pox virus.

Description

Technical Field

[0006] The present invention relates to the technical field of single nucleotide polymorphism, and in particular to a method for detecting and typing multi-branched subtype nucleic acids of monkeypox virus. Background Art

[0007] Monkeypox is a viral zoonosis caused by the monkeypox virus (MPXV). Prior to 2022, monkeypox was endemic in West and Central Africa, causing outbreaks. MPXV is an enveloped, double-stranded DNA virus that belongs to the Poxviridae family, which also includes smallpox, vaccinia, and cowpox viruses. In humans, MPXV infection causes fever, lymphadenopathy, and a vesicular rash. There are two distinct genetic clades of MPXV: MPXV clade I is primarily distributed in Central Africa, especially the Democratic Republic of the Congo (DRC), with more severe clinical symptoms and a high mortality rate (4-11%); MPXV clade II was primarily confined to West Africa before the global epidemic in 2022, with milder clinical symptoms and a mortality rate of <4%. Historically, prior to 2022, clade I MPXV accounted for 95% of reported cases.

[0008] In 2017, a large outbreak of MPXV clade IIb strains occurred in Nigeria, showing sustained human-to-human transmission, including through sexual contact. In May 2022, a subtype B.1 of MPXV evolutionary clade IIb triggered a global monkeypox virus epidemic. Genomic analysis of B.1 showed that the genetic mutation pattern of B.1 is a non-classical evolution driven by apolipoprotein B mRNA editing enzyme, showing catalytic subunit 3 (APOBEC3) cytosine deamination, a characteristic of MPXV that has been continuously transmitted in the human population, and the evolution rate has accelerated. From 2023, a large number of monkeypox cases were reported in the Democratic Republic of the Congo, especially in the densely populated mining areas in the east, South Kivu Province, and a new MPXV clade I subtype Ib began to spread in large numbers and spread to surrounding previously unaffected areas and countries. The whole genome sequence of subtype Ib also showed the role of APOBEC3, involving human-to-human transmission.

[0009] The MPXV genome sequences are highly similar, with the similarity between branches I and II exceeding 99%, and the genome sequence similarity between subtypes Ia, Ib and between IIa, IIb reaching 99.9%. At the same time, the sequence similarity between MPXV and other orthopoxviruses is basically above 90%. This high similarity in genome sequences makes it difficult to detect monkeypox virus, especially the specific detection and typing of MPXV subtypes Ia, Ib, IIa, and IIb by fluorescent PCR. As a member of the genus Orthopoxvirus, the middle region of the MPXV genome mainly encodes genes related to viral replication and expression, and the sequence is relatively conservative, with few sequence insertions and losses of Indel; while the coding genes at both ends of the genome often involve the interaction between the virus and the host, and are more likely to produce recombination and loss of variant sequences. In the monkeypox virus IIb subtype samples from the global monkeypox epidemic in 2022, approximately 5% of the genome ends had recombination or loss; in the newly emerging monkeypox virus Ib subtype samples in 2024, the commonly used monkeypox virus branch I type fluorescent PCR detection sites were also lost, directly affecting the detection and typing of the monkeypox virus. Summary of the invention

[0010] The purpose of the present invention is to solve at least one of the technical problems existing in the prior art, and to provide a method for detecting and typing the multi-branch subtype nucleic acid of monkeypox virus, using the specific combination of conserved gene sites in the whole genome of monkeypox virus and the single nucleotide polymorphism SNP sites contained in the sites, and using a fluorescently labeled molecular beacon probe method to detect and type the monkeypox virus and its subtypes. By detecting stable SNP sites in the conserved genes of the MPXV genome, using molecular beacon fluorescent probes, and through the two steps of real-time fluorescent PCR specific amplification and melting curve analysis, the four evolutionary branches of MPXV Ia, Ib, IIa, and IIb are detected and typed in a single-tube fluorescent PCR manner.

[0011] The present invention also provides a method for multi-branch subtyping of the above-mentioned monkeypox virus, comprising the following steps:

[0012] Step 1: By comparing the whole genome sequences of monkeypox virus and other orthopoxviruses, find the genome sequence sites that meet specific conditions, including gene position and single nucleotide polymorphism (SNP) site distribution;

[0013] Step 2: Design fluorescent molecular probes at sites that meet the requirements, including molecular beacon probes, TaqMan probes and other dual-labeled fluorescent molecular probes with fluorescent markers (Reporter) and quencher markers (Quencher). The probe sequence length is generally between 12 nucleotides and 40 nucleotides, and the corresponding conservative upstream and downstream primers are determined;

[0014] The sites and related primer and probe sequences that meet the requirements are as follows:

[0015] F17R locus

[0016] Type: Ia, Ib

[0017] Probe sequence Ib: CGGAGTATGCGCAGATACAAATG

[0018] Probe sequence Ia: CGGAGTATGTGCAGATACAAAATG

[0019] Upstream primer: ACCAGATATCTTCCTTCTTTGGTATTGA

[0020] Downstream primer: CTATGCTATAAATGAATTCTCATTTTG

[0021] D4R locus

[0022] Classification: IIa, IIb

[0023] Probe sequence IIb: CGTCGCGTAGCAACCAACTG

[0024] Probe sequence IIa: CGTCTCGTAGCAACCAACTG

[0025] Upstream primer: AGAACTTATCAGGAATAGGCGACGTC

[0026] Downstream primer: TGGTAGAGTTTTATAACGAAGTAG

[0027] A26L locus

[0028] Classification: IIa, IIb

[0029] Probe sequence IIb: TCTTGATAATGTCCTATATCAGTTGCA

[0030] Probe sequence IIa: TCTTGATAATGTCCTGTATCAGTTGCA

[0031] Upstream primer: ATCATCATCTTCGATATTTATTTTGCT

[0032] Downstream primer: CTAATATTCAGTCGAGTGCTGA

[0033] G8R site

[0034] Classification: IIb.B.1, IIb, IIa

[0035] Probe sequence IIb.B.1: TGTAGACTTGACGGATGAATTAATGT

[0036] Probe sequence other typeII:TGTAGACTCGACGGATGAATTAATGT

[0037] Upstream primer: CAGAGTTCAGCGAAGAAGTGTC

[0038] Downstream primer: GTTTACAGATCCGCCCAA

[0039] F4L locus

[0040] Type: Ib, Ia

[0041] Probe sequence Ib: CGGTTTCTTCACTTGGTGGATGTAATAA

[0042] Probe sequence 1a: CGGTTTCTTCACTCGGTGGATGTAATAA

[0043] Upstream primer: TCTGCACTGCGATTTCGCATG

[0044] Downstream primer: CAATGGATACCGCATTTGTTATAA

[0045] A10L locus

[0046] Type: Ib, Ia

[0047] Probe sequence Ib: AGTATGAAGTACAATGTTATTATTTACTGGT

[0048] Probe sequence Ia: AGTATGAAGTACAATGTTATTGTTTACTGGT

[0049] Upstream primer: GCCACGGTTACATTCACTGCA

[0050] Downstream primer: GTAGATTTCTTTCCAGATATACCA

[0051] According to a method for multi-branch subtyping of monkeypox virus provided by the present invention, there is a single single nucleotide polymorphism SNP difference between monkeypox virus subtypes Ia and Ib at the F17R and F4L sites, and there are two or more nucleotide polymorphism SNP differences between monkeypox virus subtypes Ib and subtype II and other orthopoxviruses.

[0052] According to a method for multi-branch subtyping of monkeypox virus provided by the present invention, there is a single single nucleotide polymorphism SNP difference between monkeypox virus subtypes IIa and IIb at the D4R, A10L, and A26L sites, and there are two or more nucleotide polymorphism SNP differences between monkeypox virus subtypes IIb and subtype I and other orthopoxviruses.

[0053] According to a method for multi-branch subtyping of monkeypox virus provided by the present invention, at the G8R site, there is a single single nucleotide polymorphism SNP difference between monkeypox virus subtype IIb.B.1 and other subtype II, and there are two or more nucleotide polymorphism SNP differences between monkeypox virus subtype IIb.B.1 and subtype I and other orthopoxviruses.

[0054] According to a method for detecting multiple branched subtype nucleic acids of monkeypox virus provided by the present invention, the sample processing, qPCR reaction solution preparation, sample addition processing and detection are characterized in that the sample processing is to put the throat swab into a test tube containing 200ul TBS, take 50ul and mix it with the reagent lysate in a ratio of 1:2, incubate at 95°C and 1500 metal bath shaking for 2min, and then perform the next step of the experiment after instant centrifugation. If the next step cannot be performed immediately, it can be stored at -20°C. TBS samples can be stored at -80°C;

[0055] For the preparation of the qPCR reaction solution, 2×Multipurpose SNP Genotyping Qpcrmix, F(mix), R(mix), P(mix), and ddH2O were taken out from the kit, thawed at room temperature, and then oscillated and mixed, and used after instantaneous centrifugation for a few seconds. For the preparation of the qPCR reaction solution, the required number of reaction wells was calculated according to the number of blank control NTC, positive quality control PC, negative quality control NC, and test samples to be tested, where the number of reaction wells n=(1 blank control NTC+2 mixed positive quality control PCs+1 negative quality control NC+N test samples to be tested)×3+2 well loss amount.

[0056] According to a method for detecting multi-branched subtype nucleic acid of monkeypox virus provided by the present invention, the sample addition treatment is to gently shake and mix the qPCR reaction plate, and 4 μL of sample solution is added. This step of operation needs to be performed in a biosafety cabinet dedicated to the PCR room. New gloves and sleeves must be replaced before starting, and a new gun tip must be replaced when adding samples to each well. The 8-row or 96-well qPCR plate is placed on the PCRcooler and transferred to the PCR positive room through the transfer window to prepare for machine detection; for the detection, the reaction tube is placed in the instrument sample slot, and it is detected by the detection instrument. After the components are fully mixed, a short centrifugation is performed to centrifuge all the liquid on the tube wall to the bottom of the tube, and then 21 μL of the amplification system is dispensed into the PCR tube.

[0057] According to a method for detecting multi-branched subtype nucleic acid of monkeypox virus provided by the present invention, the equipment models used for the detection are: Q5 instrument, 7500 instrument, Slan-96P (Hongshi) instrument.

[0058] When using the Q5 instrument, the following steps are required: First, open QuantStudio TM In Design & Analysis Software, select Create New Experiment and select Properties; in experiment type, select custom, set the Method according to the temperature program in the table below, collect fluorescence at 0.05℃ / s for the melting curve, and set the resolution to 0.02℃ / s. Note that in Action-Optical filter settings, select the melting curve optical filter selection to be consistent with the PCR stage, set Plate to Passive Reference: NONE, set Targets to IC-VIC, MPV1–CY5, MPV2-ROX, set the negative control NTC, positive control, and unknown sample Unknown in the corresponding order of the samples, and set the sample name in the Sample Name column.

[0059] When using the 7500 instrument setting steps: first open the 7500 Software and enter Create New Experiment, select Experiment properties type, select Quantitation-Relative standard curve, select other for reagents, set Targets to IC-VIC, MPV1-CY5, MPV2-ROX in Plate settings, set negative quality control NTC, positive quality control and unknown sample Unknown in the corresponding order of samples, and set the sample name in the Sample Name column, Passive Reference: NONE, Run Method according to the temperature program in the table below, melt curve 2% fluorescence collection, resolution set to 1%.

[0060] When using the Slan-96P (Hongshi) instrument, the setup steps are as follows: first open the SLAN fully automatic medical PCR analysis system, enter the project creation through the project menu, then set the project name, select "standard melting curve" as the project type, the reaction system is "25μl", and finally check the channels: IC-HEX (VIC), MPV1–CY5, MPV2-ROX.

[0061] Compared with the prior art, the method of detecting and typing the multi-branch subtype nucleic acid of the monkeypox virus of the present invention utilizes the specific combination of the conserved gene sites in the whole genome of the monkeypox virus and the single nucleotide polymorphism SNP sites contained in the sites, and uses the fluorescently labeled molecular beacon probe method to detect and type the monkeypox virus and its subtypes. By detecting the stable SNP sites in the conserved genes of the MPXV genome, using molecular beacon fluorescent probes, through the two steps of real-time fluorescent PCR specific amplification and melting curve analysis, the four evolutionary branches of MPXV Ia, Ib, IIa, and IIb are detected and typed in a single-tube fluorescent PCR manner.

[0062] Compared with the prior art, the method for detecting and typing multi-branched subtype nucleic acid of monkeypox virus of the present invention adopts molecular beacon probes and can use a single probe to quickly detect and type multiple subtypes of monkeypox virus. The entire detection process can be completed in about 60 minutes, which greatly shortens the detection time and improves the detection efficiency, which is helpful to timely discover and prevent and control the monkeypox epidemic.

[0063] Compared with the prior art, the method for detecting and typing multi-branched subtype nucleic acid of monkeypox virus of the present invention, the prepared kit uses a multiple probe combination of different fluorescent markers, and can be used for in vitro qualitative detection of at least four subtypes of monkeypox virus in human swab samples. The scope of application includes skin lesion samples, including rash surface and exudate swabs, and throat swabs. It can meet different clinical testing needs and provide a wider range of options for the detection of monkeypox virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] The present invention is further described below in conjunction with the accompanying drawings and embodiments;

[0065] Figure 1 A schematic diagram of the F17 site of a method for detecting and typing multiple branched subtype nucleic acids of monkeypox virus according to the present invention;

[0066] Figure 2 A schematic diagram of the D4R site of a method for detecting and typing multiple branched subtype nucleic acids of monkeypox virus according to the present invention;

[0067] Figure 3 A schematic diagram of the detection and typing of MPXV in a method for detecting and typing multiple subtype nucleic acids of monkeypox virus of the present invention;

[0068] Figure 4 A schematic diagram of the Results interface of the Q5 instrument of a method for detecting and typing multiple branched subtype nucleic acids of monkeypox virus according to the present invention;

[0069] Figure 5 A melting curve diagram of a method for detecting and typing multi-branched subtype nucleic acids of monkeypox virus according to the present invention;

[0070] Figure 6 It is an amplification curve diagram of a method for detecting and typing multi-branched subtype nucleic acids of monkeypox virus according to the present invention;

[0071] Figure 7 A schematic diagram of amplification curve results of a positive control of a method for detecting and typing multiple subtype nucleic acids of monkeypox virus according to the present invention;

[0072] Figure 8 The present invention is a schematic diagram of the melting curve results of the positive control of the method for detecting and typing the multi-branched subtype nucleic acid of monkeypox virus.

[0073] Legend:

[0074] 1. Orange curve; 2. Red curve; 3. Green curve. DETAILED DESCRIPTION

[0075] This section will describe in detail the specific embodiments of the present invention. The preferred embodiments of the present invention are shown in the accompanying drawings. The purpose of the accompanying drawings is to supplement the description of the text part of the specification with graphics, so that people can intuitively and vividly understand each technical feature and the overall technical solution of the present invention, but it cannot be understood as a limitation on the scope of protection of the present invention.

[0076] The embodiment of the present invention provides a method for multi-branch subtyping of monkeypox virus, comprising:

[0077] Step 1: By comparing the whole genome sequences of monkeypox virus subtypes Ia, Ib, IIa, IIb and other orthopoxviruses, sites that meet specific conditions are found, including gene location and single nucleotide polymorphism (SNP) site distribution;

[0078] Step 2: Design fluorescent molecular probes at eligible sites, including molecular beacon probes, TaqMan probes and other dual-labeled fluorescent molecular probes with fluorescent markers (Reporter) and quencher markers (Quencher). The probe sequence length is generally between 12 nucleotides and 40 nucleotides, and the corresponding conservative upstream and downstream primers are determined. Use a single probe to quickly detect and type the corresponding subtype of monkeypox virus at SNP sites that meet specific conditions. The entire detection process can be completed in about 60 minutes, greatly shortening the detection time.

[0079] Reference Figure 1 There is a single SNP difference between monkeypox virus subtypes Ia and Ib, which is explained as follows:

[0080] F17R locus

[0081] Type: Ia, Ib

[0082] Probe sequence Ib: CGGAGTATGCGCAGATACAAATG

[0083] Probe sequence Ia: CGGAGTATGTGCAGATACAAAATG

[0084] Upstream primer: ACCAGATATCTTCCTTCTTTGGTATTGA

[0085] Downstream primer: CTATGCTATAAATGAATTCTCATTTTG

[0086] D4R locus

[0087] Classification: IIa, IIb

[0088] Probe sequence IIb: CGTCGCGTAGCAACCAACTG

[0089] Probe sequence IIa: CGTCTCGTAGCAACCAACTG

[0090] Upstream primer: AGAACTTATCAGGAATAGGCGACGTC

[0091] Downstream primer: TGGTAGAGTTTTATAACGAAGTAG

[0092] There are two SNP differences between monkeypox virus subtypes II and Ib, and the distance between the two SNP sites is less than 40 nucleotides.

[0093] There are two SNP differences between monkeypox virus subtypes I and IIb, and the distance between the two SNP sites is less than 40 nucleotides.

[0094] Within this 40-nucleotide region, other orthopoxviruses differ from MPXV subtypes Ib and IIb by two or more SNPs.

[0095] Referring to the G8R site below, a molecular beacon probe is designed at a site that meets the conditions. The probe sequence is consistent with the site of monkeypox virus subtype Ib, IIb, or a monkeypox virus subtype that meets the conditions described above. The probe sequence length is generally around 20 nucleotides and within 40 nucleotides.

[0096] The corresponding upstream and downstream primers of the target sites that meet the conditions should be conserved in all monkeypox virus subtypes, and the combined upstream and downstream primers can be used to achieve the sequence conservation requirements. The following are some sites that meet the above conditions and the sequences of the designed upstream and downstream primers and their molecular beacon probes, which are explained as follows:

[0097] A26L locus

[0098] Classification: IIa, IIb

[0099] Probe sequence IIb: TCTTGATAATGTCCTATATCAGTTGCA

[0100] Probe sequence IIa: TCTTGATAATGTCCTGTATCAGTTGCA

[0101] Upstream primer: ATCATCATCTTCGATATTTATTTTGCT

[0102] Downstream primer: CTAATATTCAGTCGAGTGCTGA

[0103] G8R site

[0104] Classification: IIb.B.1, IIb, IIa

[0105] Probe sequence IIb.B.1: TGTAGACTTGACGGATGAATTAATGT

[0106] Probe sequence other typeII:TGTAGACTCGACGGATGAATTAATGT

[0107] Upstream primer: CAGAGTTCAGCGAAGAAGTGTC

[0108] Downstream primer: GTTTACAGATCCGCCCAA

[0109] F4L locus

[0110] Type: Ib, Ia

[0111] Probe sequence Ib: CGGTTTCTTCACTTGGTGGATGTAATAA

[0112] Probe sequence 1a: CGGTTTCTTCACTCGGTGGATGTAATAA

[0113] Upstream primer: TCTGCACTGCGATTTCGCATG

[0114] Downstream primer: CAATGGATACCGCATTTGTTATAA

[0115] A10L locus

[0116] Type: Ib, Ia

[0117] Probe sequence Ib: AGTATGAAGTACAATGTTATTATTTACTGGT

[0118] Probe sequence Ia: AGTATGAAGTACAATGTTATTGTTTACTGGT

[0119] Upstream primer: GCCACGGTTACATTCACTGCA

[0120] Downstream primer: GTAGATTTCTTTCCAGATATACCA

[0121] The embodiment of the present invention provides a method for detecting multi-branched subtype nucleic acid of monkeypox virus, which includes: sample processing, qPCR reaction solution preparation, sample addition processing and detection, characterized in that the sample processing is to put the throat swab into a test tube containing 200ul TBS, take 50ul and mix it with the reagent lysate in a ratio of 1:2, incubate it in a metal bath at 95°C and 1500°C for 2min, and perform the next step of the experiment after instantaneous centrifugation. If the next step cannot be performed immediately, it can be stored at -20°C, and the TBS sample can be stored at -80°C;

[0122] For the preparation of qPCR reaction solution, take out 2×Multipurpose SNP Genotyping QPCR mix, F(mix), R(mix), P(mix), and ddH2O from the kit, thaw at room temperature, shake and mix, and centrifuge for a few seconds before use.

[0123] Add samples, gently shake the qPCR reaction plate to mix, add 4μL sample solution, this step needs to be performed in the biosafety cabinet dedicated to the PCR room, change new gloves and sleeves before starting, be sure to change new gun tips when adding samples to each well, place the 8-row or 96-well qPCR plate on the PCR cooler, transfer it to the PCR positive room through the transfer window, prepare for machine testing, place the reaction tube in the instrument sample slot during testing, and test it through the detection instrument.

[0124] Calculate the required number of reaction wells according to the blank control NTC, positive quality control PC, negative quality control NC and the number of test samples to be tested. Generally, 3 replicate wells are made.

[0125] The number of reaction wells n = (1 blank control NTC + 2 mixed positive quality controls PC + 1 negative quality control NC + N test samples to be tested) × 3 + 2 well loss amount.

[0126] After all components are fully mixed, they are centrifuged briefly to allow all the liquid on the tube wall to be centrifuged to the bottom of the tube, and then 21 μL of the amplification system is dispensed into PCR tubes.

[0127]

[0128] When using the Q5 instrument, the following steps are required: First, open QuantStudio TM In Design&AnalysisSoftware, select Create New Experiment and select Properties; in experiment type, select custom, set the Method according to the temperature program in the table below, collect fluorescence at 0.05℃ / s for the melting curve, and set the resolution to 0.02℃ / s. Note that in Action-Optical filter settings, select the melting curve optical filter selection to be consistent with the PCR stage, set Plate to Passive Reference: NONE, set Targets to IC-VIC, MPV1–CY5, MPV2-ROX, set the negative control NTC, positive control, and unknown sample Unknown in the corresponding order of the samples, and set the sample name in the Sample Name column.

[0129]

[0130] Q5 instrument result analysis:

[0131] like Figure 4 The interface automatically saves the results after the reaction is completed. Open the Results interface, select Amplification Plot to analyze the amplification curve, select Rn vs Cycle for Plot type, and select Linear for Graph tape to analyze the amplification of the reaction wells. Amplification curve analysis can be performed in a single channel using CY5 for MPXV branch I, ROX for MPXV branch II, and VIC for internal reference IC. The baseline can be automatically interpreted by the instrument or adjusted according to actual conditions.

[0132] Melting curve analysis: Select Melt Curve Plot to analyze the melting curve peak. Select the corresponding fluorescence channel during analysis. MPXV branch I is CY5, MPXV branch II is ROX, and IC has no melting curve.

[0133] During the test, when using the 7500 instrument setting steps: first open the 7500 Software and enter Create New Experiment, select Experiment properties type, select Quantitation-Relative standard curve, select other for reagents, set Targets to IC-VIC, MPV1-CY5, MPV2-ROX in Plate settings, set negative quality control NTC, positive quality control and unknown sample Unknown in the corresponding order of samples, and set the sample name in the Sample Name column, Passive Reference: NONE, Run Method according to the temperature program in the table below, set the melting curve to 2% to collect fluorescence, and set the resolution to 1%.

[0134]

[0135] 7500 instrument result analysis:

[0136] The results are automatically saved after the reaction is completed. Open the Analysis interface and select Amplification Plot to analyze the amplification curve. The amplification curve analysis can be performed in a single channel. MPXV branch I uses CY5, MPXV branch II uses ROX, and IC uses VIC; the baseline can be automatically interpreted by the instrument or adjusted according to the actual situation. Select Melt Curve for melting curve analysis. When analyzing, select the corresponding fluorescence channel. MPXV branch I uses CY5, MPXV branch II uses ROX, and IC has no melting curve.

[0137] When testing, when using the Slan-96P instrument setting steps: first open the SLAN fully automatic medical PCR analysis system, enter the project creation through the project menu, then set the project name, select "standard melting curve" as the project type, and the reaction system is "25μl". Finally, check the channels: IC-HEX (VIC), MPV1-CY5, MPV2-ROX.

[0138] According to the settings in the table below, collect fluorescence at 60℃ and melting curve stage respectively. Experimental parameters: minimum temperature: 40℃; maximum temperature 70℃. Operation process: click Save, close the experiment, in basic settings, set the experiment name and save path, select standard melting curve according to the experiment type, well plate editing: check the reaction wells in step 1, check the items saved in the previous step in step 2, sample information settings, experiment run, start.

[0139]

[0140] Slan-96P Hongshi instrument result analysis:

[0141] The results are automatically saved after the reaction is completed. Open the experimental analysis, in the experimental analysis options, click parameter settings, and set the baseline and threshold lines in the basic parameters. Click Analysis, check the sample in the well selector, and view the CT value and Tm value of the sample to be tested in the reaction well information table. The melting curve peak graph is viewed in the "Melting Peak Curve"; the amplification curve graph is viewed in the "Amplification Curve". Hover the mouse over the corresponding "Target" in the reaction well information table to view the corresponding melting curve or amplification curve graph. Among them, MPXV branch I uses CY5, MPXV branch II uses ROX, and IC has no melting curve.

[0142] Embodiment 1:

[0143] Multiplex fluorescence PCR reactions were established using a combination of monkeypox virus targets F17 and D4R, as well as targets for varicella-zostervirus, VZV, and the internal standard gene IC-globulin. The probes for the monkeypox virus targets F17 and D4R were designed as molecular beacons, generating amplification curve data and melting curve data. The probes for the VZV and IC targets were designed as TaqMan probes, generating only amplification curve data.

[0144] Under the following fluorescence quantitative PCR program settings: 95℃ pre-denaturation for 30s, amplification for 45 cycles (95℃ denaturation for 2s, 60℃ annealing and extension to collect fluorescence for 25s or 35s), VZV was detected in the FAM channel, MPXV subtype II was detected in the ROX channel, MPXV subtype I was detected in the CY5 channel, and human Globin was detected in the VIC channel. The detection typing of MPXV is shown in the table below:

[0145]

[0146]

[0147] Embodiment 2:

[0148] Used for the detection and typing of MPXV subtypes IIb.B.1 and Ib: Use the two targets of the monkeypox virus target A10 and G8R, combined with VZV and IC. The combination of the monkeypox virus target A10 and G8 sites can amplify and detect the MPXV IIb.B.1 subtype, which is the subtype that caused the 2022 monkeypox global epidemic. Melting curve typing MPXV Ib, Ia and IIb.B.1 subtypes, other IIb subtypes and IIa.

[0149]

[0150]

[0151] Embodiment three:

[0152] A multiplex fluorescent PCR reaction was established using a combination of monkeypox virus targets F4 and A26, as well as targets for varicella-zostervirus, VZV, internal standard gene IC, and β-globulin. The combination of monkeypox virus targets F4 and A26 can amplify and detect MPXV Ib and IIb, and dissolve the curves to type MPXV Ib, Ia and IIb, IIa. Similar to the combined detection results of F17 diazepam D4. This establishment of multiple sites can increase the reliability of detection. If a reaction site mutates and loses its detection ability, it can be replaced with a different target with similar functions.

[0153] Under the following fluorescence quantitative PCR program settings: 95℃ pre-denaturation for 30s, amplification for 45 cycles (95℃ denaturation for 2s, 56℃ annealing extension and fluorescence collection for 25s or 35s), VZV was detected in the FAM channel, MPXV subtype II was detected in the ROX channel, MPXV subtype I was detected in the CY5 channel, and human β-Globin was detected in the VIC channel. The detection typing of MPXV is shown in the table below:

[0154]

[0155]

[0156] Interpretation of test results: This includes quality control of quality control materials, determination of positive results, determination of negative results, and storage conditions.

[0157] Quality control of quality control products:

[0158] MPXV negative quality control product: VIC detection channel has obvious amplification curve.

[0159] MPXV positive control: The kit contains 2 positive controls: MPXV positive control (including templates MPV1a, MPV1b, MPV2a, MPV2b), and OPV positive control (templates OPV-f17, OPV-d4).

[0160] Each experiment needs to detect MPXV positive quality control and negative quality control. The MPXV positive control has amplification curves in the ROX and CY5 channels (Ct is about 26 and 29 respectively), and the melting curve has peaks in the ROX and CY5 channels, with peaks at about 54 and 60. The internal reference has an amplification curve in the VIC channel. The test results can only be determined when the quality control results meet the quality control requirements.

[0161] Reference Figure 3 Positive result determination.

[0162] Negative result judgment: If the ROX and CY5 detection channels of the sample do not show an exponential amplification curve or the Ct value is greater than 50 and the melting curve has no obvious peak, it is judged as negative.

[0163] Storage conditions: long-term storage at -20℃. Avoid repeated freezing.

[0164] Reference Figure 5-8 , the detection results of clinical monkeypox virus sample IIb subtype: Orange amplification curve: MPV2b. The melting curve further proves that the sample is MPXV subtype II. The red (CY5) curve peaks at 48 degrees, MPXV subtype II. Orange amplification curve: MPV2b 54MPV1b.

[0165] The embodiments of the present invention are described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments. Various changes can be made within the knowledge scope of ordinary technicians in the technical field without departing from the purpose of the present invention.

Claims

1. A method for multi-clade subtyping of monkeypox virus, characterized in that: The following steps are involved: Step 1: By comparing the whole genome sequences of monkeypox virus and other orthopoxviruses, find the genome sequence sites that meet specific conditions, including gene position and single nucleotide polymorphism (SNP) site distribution; Step 2: Design fluorescent molecular probes at sites that meet the requirements, including molecular beacon probes, TaqMan probes and other dual-labeled fluorescent molecular probes with fluorescent markers (Reporter) and quencher markers (Quencher). The probe sequence length is generally between 12 nucleotides and 40 nucleotides, and the corresponding conservative upstream and downstream primers are determined; The sites and related primer and probe sequences that meet the requirements are as follows: F17R locus Type: Ia, Ib Probe sequence Ib: CGGAGTATGCGCAGATACAAATG Probe sequence I a: CGGAGTATGTGCAGATACAAAATG Upstream primer: ACCAGATATCTTCCTTCTTTGGTATTGA Downstream primer: CTATGCTATAAATGAATTCTCATTTTG D4R locus Classification: IIa, IIb Probe sequence I Ib: CGTCGCGTAGCAACCAACTG Probe sequence IIa: CGTCTCGTAGCAACCAACTG Upstream primer: AGAACTTATCAGGAATAGGCGACGTC Downstream primer: TGGTAGAGTTTTATAACGAAGTAG A26L locus Classification: IIa, IIb Probe sequence IIb: TCTTGATAATGTCCTATATCAGTTGCA Probe sequence IIa:TCTTGATAATGTCCTGTATCAGTTGCA Upstream primer: ATCATCATCTTCGATATTTATTTTGCT Downstream primer: CTAATATTCAGTCGAGTGCTGA G8R site Classification: IIb.B.1, IIb, IIa, Probe sequence I Ib.B.1: TGTAGACTTGACGGATGAATTAATGT Probe sequence other type I I:TGTAGACTCGACGGATGAATTAATGT Upstream primer: CAGAGTTCAGCGAAGAAGTGTC Downstream primer: GTTTACAGATCCGCCCAA F4L locus Type: Ib, Ia Probe sequence Ib: CGGTTTCTTCACTTGGTGGATGTAATAA Probe sequence 1a: CGGTTTCTTCACTCGGTGGATGTAATAA Upstream primer: TCTGCACTGCGATTTCGCATG Downstream primer: CAATGGATACCGCATTTGTTATAA A10L locus Type: Ib, Ia Probe sequence Ib: AGTATGAAGTACAATGTTATTATTTACTGGT Probe sequence Ia: AGTATGAAGTACAATGTTATTGTTTACTGGT Upstream primer: GCCACGGTTACATTCACTGCA Downstream primer: GTAGATTTCTTTCCAGATATACCA 2. A method for multi-clade subtyping of monkeypox virus according to claim 1, characterized in that: At the F17R and F4L sites, there is a single single nucleotide polymorphism (SNP) difference between monkeypox virus subtypes Ia and Ib, and there are two or more nucleotide polymorphism (SNP) differences between monkeypox virus subtypes Ib and II and other orthopoxviruses.

3. A method for multi-clade subtyping of monkeypox virus according to claim 1, characterized in that: At the D4R, A10L and A26L sites, there is a single single nucleotide polymorphism (SNP) difference between monkeypox virus subtypes IIa and IIb, and there are two or more nucleotide polymorphism (SNP) differences between monkeypox virus subtypes IIb and subtype I and other orthopoxviruses.

4. A method for multi-clade subtyping of monkeypox virus according to claim 1, characterized in that: At the G8R site, there is a single single nucleotide polymorphism SNP difference between monkeypox virus subtype IIb.B.1 and other subtype II, and there are two or more nucleotide polymorphism SNP differences between monkeypox virus subtype IIb.B.1 and subtype I and other orthopoxviruses.

5. A method for detecting multiple branched subtype nucleic acids of monkeypox virus, comprising: Sample processing, qPCR reaction solution preparation, sample addition processing and detection, characterized in that the sample processing is to put the throat swab into a test tube containing 200ul TBS, take 50ul and mix it with the reagent lysis solution in a ratio of 1:2, incubate it in a metal bath at 95℃ and 1500℃ for 2min, and then centrifuge it for the next step of the experiment. If the next step cannot be carried out immediately, it can be stored at -20℃. TBS samples can be stored at -80℃; For the preparation of the qPCR reaction solution, 2×Multipurpose SNP Genotyping QPCR mix, F(mix), R(mix), P(mix), and ddH2O were taken out from the kit, thawed at room temperature, and then vortexed and mixed, and centrifuged for a few seconds before use.

6. A method for detecting multiple branched subtype nucleic acids of monkeypox virus according to claim 5, characterized in that: The sample addition treatment is to gently shake the qPCR reaction plate to mix it, and add 4 μL of sample solution. This step needs to be performed in a biosafety cabinet dedicated to the PCR room. Before starting, change new gloves and sleeves. When adding samples to each well, be sure to change new gun tips. Place the 8-well or 96-well qPCR plate on the PCR cooler, transfer it to the PCR positive room through the transfer window, and prepare for machine detection; The detection is performed by placing the reaction tube into a sample slot of the instrument and performing detection on it through the detection instrument.

7. A method for detecting multiple branched subtype nucleic acids of monkeypox virus according to claim 5, characterized in that: The equipment models used in the detection are: Q5 instrument, 7500 instrument, Slan-96P (Hongshi) instrument.

Images