Traditional Chinese medicine composition for improving drug-induced liver injury and application thereof

Abstract

The invention discloses a traditional Chinese medicine composition for improving drug-induced liver injury, and belongs to the technical field of biological medicines. The traditional Chinese medicine composition is prepared from, by weight, 5-15 parts of radix bupleuri, 5-15 parts of rhizoma atractylodis macrocephalae, 5-15 parts of radix paeoniae alba, 5-15 parts of radix angelicae sinensis, 1-9 parts of honey-fried licorice roots, 5-15 parts of poria cocos, 2-11 parts of mint and 2-11 parts of fresh ginger. The composition provided by the invention can reduce the activity of alanine transaminase and glutamic oxalacetic transaminase in serum, improve drug-induced liver injury and improve the abundance of intestinal total bacteria. And the abundance of the lactobacillus acidophilus in the intestinal tract is improved by more than 7 times by a model group. The composition can reduce infiltration of intestinal inflammatory cells, increase the number of goblet cells and expression of intestinal tight junction protein ZO-1, and improve related symptoms caused by decrease of the intestinal barrier function.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine. Background Art

[0002] Drug-induced liver injury is caused by drugs or their metabolites, among which acetaminophen (APAP) is a common causative drug. People often unconsciously overdose on acetaminophen to relieve fever and pain, which leads to drug-induced liver injury. In traditional Chinese medicine theory, drug-induced liver injury is classified as "drug poisoning", and it is believed that its cause is the invasion of drug toxins and the pathogenesis is that drugs damage the liver and spleen. At present, Western medicine is the main means of treating drug-induced liver injury, but the treatment process is often accompanied by adverse reactions. As a representative of traditional medicine, Chinese medicine has fewer adverse reactions than Western medicine, so it is receiving more and more attention.

[0003] However, the current research on drug-induced liver injury in traditional Chinese medicine is still relatively weak. Recent studies have found that in addition to causing liver damage, excessive use of acetaminophen can also lead to an imbalance of intestinal flora and intestinal barrier damage. Specifically, it manifests as intestinal barrier damage, a decrease in the abundance of beneficial bacteria, and a decrease in the abundance of overall flora. This change has an important impact on human health because the intestinal flora plays a vital role in maintaining normal body function. When the abundance of total intestinal bacteria decreases, it will affect intestinal peristalsis, resulting in slower digestion and absorption of food and insufficient absorption of nutrients; and when the intestinal barrier is damaged and the abundance of beneficial bacteria is reduced, it will aggravate intestinal inflammation and increase the risk of disease. Therefore, improving the abundance of total intestinal bacteria, increasing the abundance of beneficial bacteria, and repairing the intestinal barrier is a new way to promote health and improve drug-induced liver injury. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a Chinese medicine composition for improving drug-induced liver injury and its application. The composition of the present invention can reduce the activity of alanine aminotransferase (ALT) and spartate aminotransferase (AST) in serum, improve drug-induced liver injury, increase the abundance of Lactobacillus acidophilus model group by more than 7 times, reduce the infiltration of intestinal inflammatory cells, increase the number of goblet cells and the expression of intestinal tight junction protein ZO-1.

[0005] In order to solve the above technical problems, the technical solution adopted by the present invention is: A traditional Chinese medicine composition for improving drug-induced liver injury, the raw materials of which are composed of the following substances by weight: 5-15 parts of bupleurum, 5-15 parts of atractylodes, 5-15 parts of white peony root, 5-15 parts of angelica, 1-9 parts of roasted licorice, 5-15 parts of poria, 2-11 parts of mint, and 2-11 parts of ginger.

[0006] The preferred raw materials are composed of the following substances by weight: 7-11 parts of bupleurum, 7-11 parts of atractylodes, 7-11 parts of white peony root, 7-11 parts of angelica, 2-7 parts of licorice, 7-11 parts of Poria, 4-8 parts of mint, and 4-8 parts of ginger.

[0007] Further preferably, the raw materials are composed of the following substances by weight: 9 parts of bupleurum, 9 parts of atractylodes, 9 parts of white peony root, 9 parts of angelica, 4.5 parts of roasted licorice, 9 parts of Poria, 6 parts of mint, and 6 parts of ginger.

[0008] The present invention also provides the use of the above-mentioned traditional Chinese medicine composition in a product for improving the abundance of Lactobacillus acidophilus in the intestinal tract.

[0009] The present invention also provides application of the above-mentioned Chinese medicine composition in a product for reducing inflammatory infiltration in the intestinal tract.

[0010] The present invention also provides application of the above-mentioned traditional Chinese medicine composition in increasing intestinal goblet cell products.

[0011] The present invention also provides the use of the above-mentioned traditional Chinese medicine composition in a product for increasing the expression of intestinal tight junction protein ZO-1.

[0012] The present invention also provides application of the Chinese medicine composition in a product for reducing ALT in serum.

[0013] The present invention also provides application of the above-mentioned traditional Chinese medicine composition in a product for reducing AST in serum.

[0014] The present invention also provides the use of the above-mentioned traditional Chinese medicine composition in a product for repairing the intestinal barrier and improving drug-induced liver damage.

[0015] Xiaoyaosan was first seen in Taiping Huimin Hejijufang, which is composed of 8 herbs. The effects of each herb are as follows: Bupleurum is recorded in Diannan Materia Medica as having the effect of promoting liver meridian and relieving qi stagnation; Angelica is described in Compendium of Materia Medica as having the effect of harmonizing and nourishing blood; Atractylodes macrocephala has the effect of removing dampness and benefiting dryness, harmonizing the middle and benefiting qi, warming the middle and removing dampness from the spleen and stomach in Medical Origin; White peony root is mentioned in Diannan Materia Medica as being able to regulate the blood of the heart, liver, spleen and meridians; Poria in Medical Origin is recorded as being able to remove dampness, harmonize the middle and benefit qi; Ginger is recorded in Riyong Materia Medica as being able to treat typhoid fever and remove coldness in the abdomen; Mint is considered to be good at relieving depression in the Liver and Gallbladder Meridians in New Compendium of Materia Medica; Licorice has the function of removing the poison of hundreds of drugs in Bielu.

[0016] According to the theory of Huangdi Neijing, the treatment of liver disease is not only about soothing the liver, but also about easing and softening. Bupleurum and mint in Xiaoyaosan can soothe the liver and relieve depression, while licorice can relieve urgency and harmonize the various medicines. White peony root has the effect of softening the liver and restraining yin. The liver has the characteristics of using yang in the body and yin in the body. Therefore, angelica and white peony root can nourish the liver's yin blood together.

[0017] At the same time, the Golden Chamber points out the treatment principle of "seeing liver disease, knowing that the liver transmits to the spleen". Therefore, when treating liver disease, it is necessary to take into account the treatment of the spleen. The Poria cocos and Atractylodes macrocephala in Xiaoyao Powder have the effects of tonifying the spleen, draining dampness, and strengthening the spleen, while ginger can harmonize the middle. These medicines work together to harmonize the liver and spleen, thereby achieving the purpose of treating liver disease.

[0018] After experimental research, the inventors found that the Chinese medicine composition of the present invention can be used to reduce the activity of ALT and AST in serum, improve drug-induced liver injury, increase the abundance of Lactobacillus acidophilus to more than 7 times that of the model group, reduce the infiltration of intestinal inflammatory cells, increase the number of goblet cells and the expression of intestinal tight junction protein ZO-1.

[0019] The present invention uses Xiaoyao Powder as the basic formula. The main drug of Xiaoyao Powder, Bupleurum, has the effect of soothing the liver and relieving depression, regulating liver qi; the ministerial drug Angelica can nourish blood and blood, white peony root can nourish blood, restrain yin, and soften the liver; the adjuvants Atractylodes macrocephala and Poria have the effect of strengthening the spleen and eliminating dampness, and the licorice root can nourish the spleen and replenish qi, soften the liver and relieve urgency; mint soothes the liver and relieves depression, and penetrates liver heat; ginger has the effect of lowering adverse and harmonizing the middle, and is pungent and dispersing depression. Bupleurum, as the guiding drug of the liver meridian, has the effect of making the drug. The whole prescription exerts a comprehensive therapeutic effect by harmonizing the liver and spleen and unblocking qi and blood. The present invention has found that Xiaoyao Powder can not only improve the abundance of total intestinal bacteria, but also significantly improve the proliferation ability of Lactobacillus acidophilus, which can be increased by more than 10 times at most. In addition, it can also improve the intestinal barrier and improve drug-induced liver injury.

[0020] Western medicine treatment measures have certain limitations, while the composition of the present invention has mild medicinal properties, low price, and has a positive regulatory effect on intestinal beneficial bacteria and intestinal barrier repair. Therefore, whether from the perspective of improving intestinal health or treating liver damage, the composition of the present invention has great potential.

[0021] The beneficial effects of adopting the above technical solution are: (1) The Chinese medicine composition of the present invention can be used to prepare products for increasing the abundance of Lactobacillus acidophilus, repairing the intestinal barrier and improving drug-induced liver injury.

[0022] (2) The Chinese medicine composition of the present invention can reduce the activity of AST and ALT in serum, reduce liver cell necrosis and inflammatory infiltration, improve drug-induced liver injury, increase the number of Lactobacillus acidophilus in the intestine to more than 7 times of the model group, reduce the infiltration of intestinal inflammatory cells, increase the number of goblet cells and the expression of intestinal tight junction protein ZO-1.

[0023] (3) The main ingredients of the Chinese medicine composition provided by the present invention are bupleurum, atractylodes, white peony root, angelica, liquorice, tuckahoe, mint and ginger. Most of them are medicinal materials that can be used as both medicine and food. The medicinal materials used in the formula are cheap and easy to obtain, and are convenient to purchase. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1Flow chart for constructing a mouse model of acute drug-induced liver injury for 300 mg / kg APAP; Figure 2 is the activity of alanine aminotransferase in serum* P ≤0.05; Figure 3 is the activity of aspartate aminotransferase in serum* P ≤0.05; Figure 4 Hematoxylin-eosin staining of the liver (a: vacuolar necrosis, b: inflammatory infiltration).

[0025] Figure 5 is the total bacterial abundance of mice in each group.

[0026] Figure 6 is the abundance of Lactobacillus acidophilus in each group of mice.

[0027] Figure 7 Flowchart for the creation of an intestinal pseudo-germ-free mouse model.

[0028] Figure 8 is the activity of aspartate aminotransferase in the serum of pseudo-germ-free mice in each group* P ≤0.05.

[0029] Fig. 9 is the alanine aminotransferase activity in the serum of pseudo-sterile mice in each group* P ≤0.05.

[0030] Fig.10 Hematoxylin-eosin staining of the livers of pseudo-sterile mice in each group.

[0031] Fig.11 Hematoxylin-eosin staining of the colon of pseudo-germ-free mice in each group.

[0032] Fig.12 PAS staining of the colon of each group of pseudo-germ-free mice.

[0033] Fig.13 The expression of ZO-1 in the colon of each group of pseudo-germ-free mice was detected by immunohistochemistry. DETAILED DESCRIPTION Example 1

[0034] According to the adult dosage of 9g Bupleurum, 9g Atractylodes, 9g White Peony, 9g Angelica, 9g Poria, 6g Mint, 6g Ginger, and 4.5g Licorice, it is converted to the mouse dosage according to the body surface area algorithm, that is, 1.17g / kg Bupleurum, 1.17g / kg Atractylodes, 1.17g / kg White Peony, 1.17g / kg Angelica, 1.17g / kg Poria, 0.78g / kg Mint, 0.78g / kg Ginger, and 0.59g / kg Licorice. The dosage converted from the adult dosage is the medium dose group, half of the adult dosage is the low dose, and twice is the high dose. The method for boiling the Chinese medicine liquid is to boil Bupleurum, Atractylodes, White Peony, Angelica, Poria, Mint, Ginger, and Licorice according to the above weight ratio, and concentrate it to a gavage dose of 0.1ml per mouse.

[0035] 1. Experimental drugs Film-forming drugs: acetaminophen (APAP, Beijing Solaibao Biotechnology Co., Ltd.); intervention drugs: bupleurum, atractylodes, white peony root, angelica, licorice, tuckahoe, mint, ginger (all purchased from Beijing Tongrentang); antibiotic water: streptomycin, vancomycin, penicillin (all purchased from McLean).

[0036] 2. Experimental grouping and membrane formation 5-week-old healthy male BALB / c mice weighing about 19-23g were fasted for 5 hours and then intraperitoneally injected with 300mg / kg APAP to induce drug-induced liver injury and decreased intestinal barrier function in mice, except for the normal group (Normal group, 10 mice). The membrane-forming mice were then divided into the model group (Model group, 10 mice), the low-dose Chinese medicine group (L-XYP group, 10 mice), the medium-dose Chinese medicine group (M-XYP, 10 mice), the high-dose Chinese medicine group (H-XYP, 10 mice), the polyene phosphatidylcholine group (PPC, 10 mice), the antibiotic group (ATB, 10 mice), the antibiotic + medium-dose Chinese medicine group (ATB+XYP, 10 mice), the antibiotic + Lactobacillus acidophilus group (ATB+LA, 10 mice), and the antibiotic + medium-dose Chinese medicine + Lactobacillus acidophilus group (ATB+XYP+LA group, 10 mice).

[0037] 3. Drug intervention The mice were intervened for a total of five days. The Normal group and the model group were gavaged with 0.1 ml of sterile water every day, the L-XYP group was gavaged with 3.99 g / kg of the suspension after boiling and concentrating the Chinese medicine composition of this embodiment every day, the M-XYP group was gavaged with 7.99 g / kg of the above suspension every day, the H-XYP group was gavaged with 15.99 g / kg of the above suspension every day, the PPC group was gavaged with 0.18 g / kg of polyene phosphatidylcholine every day, the ATB group was gavaged with 0.1 ml of sterile water every day and the drinking water was replaced with antibiotic water, the ATB+XYP group was gavaged with 7.99 g / kg of the above suspension every day and the drinking water was replaced with antibiotic water, and the ATB+LA group was gavaged with 1×10 8 CFU of Lactobacillus acidophilus and replaced drinking water with antibiotic water. The ATB+XYP+LA group was gavaged with 7.99 g / kg of the above suspension and 1×10 8 CFU and replace the drinking water with antibiotic water.

[0038] 4. Observation indicators The health status of mice in each group was observed and the weight changes of mice were recorded.

[0039] 5. Animals are killed for materials Before sampling, mouse feces were collected, and the abundance of Lactobacillus acidophilus in the mouse intestine was detected by real-time quantitative fluorescence PCR. Part of the colon was fixed in paraformaldehyde solution, and the paraffin blocks were made into H&E staining to observe the pathological morphological changes of the mouse colon, PAS staining to observe the number of goblet cells, and IHC to detect the expression of intestinal tight junction protein ZO-1. The mouse liver was fixed and paraffin-embedded and H&E stained to observe the pathological changes of the liver. After the mouse blood was collected and placed at room temperature for 2 hours, the supernatant was centrifuged at 2500rpm for 15 minutes, and the ALT and AST levels in the mouse serum were detected by ELISA.

[0040] 6. Detection methods of various indicators a. Detection of ALT and AST activity in serum The test was performed according to the instructions of the kit (Nanjing Jiancheng, catalog number: C010-2-1 and C009-2-1). The serum of the standard sample, blank sample and test sample was added to a 96-well plate, the OD value at 510 nm was read with an enzyme reader, and then the ALT and AST activities in the serum were calculated according to the formula obtained from the standard sample.

[0041] b. Hematoxylin and eosin (H&E) staining Mouse livers were dehydrated and then embedded in paraffin. The liver and intestines were stained with H&E staining solution (Beijing Regen Biotechnology, Cat. No.: DH0020) for histopathological examination and photographed under a microscope.

[0042] c. Real-time quantitative fluorescence PCR DNA was isolated from mouse feces using a kit (Solarbio, Cat. No.: D2700), and the DNA concentration was measured using a photometer. Subsequently, DNA, ddH2O, forward primer, reverse primer, and SuperReal PreMix Plus were combined in 8 consecutive wells and analyzed using real-time fluorescence quantitative PCR (Bio-Rad, USA). (Total bacteria: forward, 5- ACTCCTACGGGAGGCAGCAGT -3 and reverse 5- ATTACCGCGGCTGCTGGC -3; Lactobacillus acidophilus: positive, 5- AGCAGTAGGGAATCTTCCA -3 and reverse 5'- CACCGCTACACATGGAG -3 then use 2 -ΔΔCT Methods The total bacterial primer sequences were analyzed.

[0043] d. H&E staining of colon After fixation with paraformaldehyde for 48 h, the colon was removed, dehydrated with alcohol gradient, embedded in paraffin, sliced, stained with H&E, and observed and photographed under an optical microscope.

[0044] e. Colon PAS staining The colon wax blocks were sliced ​​and stained according to the instructions of the PAS kit, and the morphology was observed and photographed under an optical microscope.

[0045] 7. Experimental results a. The Chinese medicine composition of this embodiment can reduce serum transaminase and improve APAP-induced acute drug-induced liver injury.

[0046] As attached Figure 1-Figure 4 As shown, in order to study the effect of the Chinese medicine composition of the present invention on improving DILI (drug-induced liver injury), we established an acute drug-induced liver injury mouse model with 300 mg / kg APAP ( Figure 1 ). The ALT activity in the model group (26.49 ± 2.57 U / L) was 1.90 times higher than that in the normal group (13.56 ± 2.73 U / L) (P<0.05). The AST activity in the model group (37.92 ± 15.21 U / L) was twice that in the normal control group (18.46 ± 4.16 U / L) (P<0.05). Similarly, compared with the normal group, the liver in the model group showed inflammatory infiltration, ballooning, and congestion ( Figure 4 ). This suggests that 300 mg / kg APAP can cause liver damage. The ALT activity in the low-dose group was 23.00 ± 1.79 U / L, and the AST activity was 32.27 ± 8.23 ​​U / L, which was not significantly different from the model group ( P>0.05). The results showed that L-XYP did not reduce the activities of ALT and AST in serum ( Figure 2 , Figure 3 The activities of ALT (18.00 ± 1.68 U / L) and AST (26.14 ± 6.05 U / L) in the medium-dose group were 1.40 times lower than those in the model group ( Figure 2 , Figure 3 )(P<0.05). There was no statistically significant difference in the activities of alanine aminotransferase (10.87 ± 3.73 U / L) and aspartate aminotransferase (19.42 ± 0.90 U / L) between the polyenylphosphocholine group and the polyenylphosphocholine group (P>0.05). PPC is a widely used drug for liver protection ( Figure 2 , Figure 3 ). The results showed that medium-dose XYP can improve DILI, and its effect is similar to that of PPC. Compared with the model group, the ALT activity (7.44 ± 1.57 U / L) in the high-dose XYP group was reduced by 3.56 times, and the AST activity (21.00 ± 2.39 U / L) was reduced by 1.80 times. The H&E results of the liver also showed that compared with the model group, the H-XYP group had no ballooning, no inflammatory infiltration, and no congestion ( Figure 4 ). This suggests that H-XYP can improve APAP-induced liver injury. There was no difference in ALT and AST activities between the H-XYP and PPC groups ( Figure 2 , Figure 3 ), indicating that the effects of high-dose XYP were also similar to those of PPC in DILI mice.

[0047] b. The Chinese medicinal compound of the present invention increases the abundance of total bacteria and Lactobacillus acidophilus.

[0048] As attached Figure 5 , Figure 6 As shown, the total bacterial abundance was detected by real-time quantitative fluorescence PCR. Compared with the normal group and the model group, the total bacterial abundance in the model group was reduced, indicating that excessive APAP would cause a decrease in the total bacterial abundance in the intestine. In the treatment group, we found that the total bacterial abundance increased at medium and high doses, and the total bacterial abundance in the medium dose group was similar to that in the normal group ( P ≥0.05). This indicates that the medium and high doses restored the reduction in total abundance caused by APAP. The medium dose can even restore it to normal levels. The abundance of Lactobacillus acidophilus increased in all treatment groups, and the high dose group even reached more than 10 times that of the normal group, indicating that the composition of this example increases the abundance of Lactobacillus acidophilus in the intestine.

[0049] c. The Chinese medicine compound of the present invention reduces intestinal inflammation, improves intestinal barrier, and relies on Lactobacillus acidophilus to improve drug-induced liver injury (modeling flow chart as attached Figure 7as shown).

[0050] To determine whether XYP is mediated by intestinal bacteria, we used ATB to eliminate intestinal microbiota and then combined it with XYP to treat APAP-induced liver injury in mice. There was no significant difference in ALT and AST activities between the ATB + XYP group and the ATB group (P>0.05). However, the ALT activity of the ATB group (32.60 ± 5.49 U / L) increased by 1.70 times compared with the XYP group (18.20± 3.13 U / L), while the AST activity of the ATB group (78.95 ± 6.86 U / L) increased by 1.60 times compared with the XYP group (48.49± 3.11 U / L). Figure 8 , Fig. 9 )(P<0.05). In addition, the inflammatory infiltration and vesicular necrosis were obvious in the ATB group and the ATB + XYP group, while the ballooning of inflammatory infiltration was significantly reduced in the XYP group ( Fig.10 ). These results suggest that XYP can improve liver damage via intestinal flora.

[0051] H&E staining showed that the mucosal epithelial cells in the XYP group were arranged neatly and the glands were arranged regularly ( Fig.11 However, in the ATB+ XYP group, inflammatory cells infiltrated and the mucosal epithelial cells were arranged irregularly ( Fig.11 ). We also found that goblet cells increased in the XYP group by PAS staining, but not in the ATB + XYP group compared with the ATB group ( Fig.12 ). Subsequently, compared with the ATB + XYP group, the expression level of the intercellular tight junction protein ZO-1 in the XYP group was significantly increased ( Fig.13 ). These results suggest that XYP enhances intestinal barrier function via intestinal bacteria.

[0052] In addition, the ALT activity of the ATB + XYP group (28.08 ± 5.54 U / L) increased by 1.60 times compared with the ATB + XYP + LA group (16.57 ± 4.68 U / L) and ATB + LA group (16.61 ± 1.03 U / L). The AST activity of the ATB + XYP group (65.96 ± 7.99 U / L) increased by 1.70 times compared with the ATB + XYP + LA group (37.73 ± 4.87 U / L). There was no statistically significant difference in ALT activity between the ATB + XYP + LA and ATB + LA groups ( Figure 8 , Fig. 9). These results suggest that XYP improves liver damage after the addition of Lactobacillus acidophilus. Meanwhile, the inflammatory infiltration and ballooning changes were reduced in the ATB + XYP + LA group and the ATB + LA group compared with the ATB + XYP group ( Fig.10 In addition, mucosal epithelial cells were regularly arranged in the ATB + XYP + LA and ATB + LA groups ( Fig.11 ). The number of goblet cells and the expression level of ZO-1 protein increased in the ATB + XYP + LA and ATB + LA groups compared with the ATB + XYP group ( Fig.12 and Fig.13 ). This suggests that XYP can enhance the intestinal mucosal barrier function and improve liver damage by increasing the number of Lactobacillus acidophilus.

[0053] The above results indicate that the present invention improves the abundance of Lactobacillus acidophilus, repairs the intestinal barrier and improves drug-induced liver injury.

Claims

1. A Chinese medicine composition for improving drug-induced liver injury, characterized in that: The raw materials are composed of the following substances by weight: 5-15 parts of bupleurum, 5-15 parts of atractylodes, 5-15 parts of white peony root, 5-15 parts of angelica, 1-9 parts of roasted licorice, 5-15 parts of poria, 2-11 parts of mint, and 2-11 parts of ginger.

2. The Chinese medicine composition according to claim 1, characterized in that: The raw materials are composed of the following substances by weight: 7-11 parts of bupleurum, 7-11 parts of atractylodes, 7-11 parts of white peony root, 7-11 parts of angelica, 2-7 parts of roasted licorice, 7-11 parts of poria, 4-8 parts of mint, and 4-8 parts of ginger.

3. The Chinese medicine composition according to claim 2, characterized in that: The raw materials are composed of the following substances by weight: 9 parts of bupleurum, 9 parts of atractylodes, 9 parts of white peony root, 9 parts of angelica, 4.5 parts of roasted licorice, 9 parts of Poria, 6 parts of mint, and 6 parts of ginger.

4. Use of any one of the Chinese medicine compositions of claims 1 to 3 in a product for increasing the abundance of Lactobacillus acidophilus in the intestine.

5. Use of any one of the Chinese medicine compositions of claims 1 to 3 in a preparation for reducing inflammatory infiltration in the intestine.

6. Use of any one of the Chinese medicine compositions of claims 1 to 3 in increasing intestinal goblet cell products.

7. Use of the Chinese medicine composition according to any one of claims 1 to 3 in a preparation for increasing the expression of intestinal tight junction protein ZO-1.

8. Use of the Chinese medicine composition according to any one of claims 1 to 3 in a product for reducing ALT in serum.

9. Use of any one of the Chinese medicine compositions of claims 1 to 3 in a preparation for reducing AST activity in serum.

10. Use of any one of the Chinese medicine compositions of claims 1 to 3 in a product for repairing the intestinal barrier and improving drug-induced liver damage.

Images