Use of a polypeptide or its related biological material in the manufacture of and / or as a product for regulating the oral microecological balance

By using polypeptides with specific amino acid sequences or their related biological materials, the growth of harmful oral bacteria is selectively inhibited and probiotics are protected, which solves the problem of excessive killing of probiotics by oral products in the prior art, and achieves the balanced regulation of oral microecology and the protection of oral health.

CN119607174BActive Publication Date: 2025-06-17HAOYIKANG BIOMATERIALS (GUANGZHOU) CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510163162.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-14
Publication Date
2025-06-17
Estimated Expiration
2045-02-14

AI Technical Summary

Technical Problem

While existing oral products kill harmful bacteria, they often kill probiotics excessively, break the balance of oral microecology and lead to the occurrence of oral diseases.

Method used

Polypeptides with specific amino acid sequences or their related biological materials are used to selectively inhibit the growth of harmful bacteria in the oral cavity while ensuring the normal activity of probiotics, thereby regulating the balance of oral microecology.

Benefits of technology

Effectively inhibit the growth of harmful bacteria in the oral cavity, promote the physiological activities of probiotics, restore the balance of oral microecology, and ensure oral health.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119607174B_ABST
    Figure CN119607174B_ABST
Patent Text Reader

Abstract

The present invention provides the use of a polypeptide or its related biological material in the manufacture of and / or as a product for regulating the oral microecological balance. The polypeptide or its related biological material with the amino acid sequence shown in SEQ ID NO:1 of the present invention can selectively inhibit harmful oral bacteria (such as Streptococcus mutans, etc.) while ensuring the normal physiological activities of oral probiotics (such as Streptococcus sanguinis, Streptococcus salivarius, Streptococcus gordonii, etc.), thereby achieving the regulation of the oral microecological balance and ensuring the oral health of the body.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of polypeptides. More specifically, it relates to the application of polypeptides or their related biological materials in the manufacture of and / or as products for regulating the oral microecological balance. Background Art

[0002] Billions of microorganisms inhabit the oral cavity. Various microorganisms coexist, compete, and antagonize at different sites, maintaining a dynamic balance and self-stabilizing state in terms of population quantity and function, thus constructing the complex oral microecological "micro-world" of humans. Among them, the oral flora, as the second largest flora in the human body, consists of more than 700 species of bacteria. Most of these bacteria are beneficial, capable of resisting diseases, aiding digestion, and regulating the body's functions, playing an important role in oral health, and are thus called oral probiotics.

[0003] Oral probiotics are a class of active microorganisms beneficial to the host. They mainly exert their beneficial effects through processes such as secreting antibacterial substances, competitively colonizing with harmful oral bacteria, regulating the host immune response, and adjusting the pH value of the biofilm. For example, Streptococcus salivarius ( Streptococcussalivarius ), Streptococcus gordonii ( Streptococcus gordonii ) and others have been proven to prevent the growth of harmful microorganisms.

[0004] Under normal physiological conditions, there is a dynamic balance among oral microorganisms and between microorganisms and the host, which jointly participate in the body's metabolism, immunity, nutrition, and maintenance of oral health. However, currently, many oral products, while killing harmful oral bacteria, also kill too many oral probiotics, leading to the disruption of the oral microecological balance, and further causing the occurrence of oral diseases. Moreover, oral diseases will further exacerbate the imbalance of the oral microecology, making oral problems enter a vicious cycle. Therefore, it is very necessary to find a product that can effectively regulate the oral microecological balance for oral health. Summary of the Invention

[0005] Aiming at the deficiencies of the prior art, the present invention aims to provide the application of polypeptides or their related biological materials in the manufacture of and / or as products for regulating the oral microecological balance. While selectively inhibiting harmful oral bacteria, this polypeptide or its related biological material can also ensure the normal physiological activities of oral probiotics, achieve the regulation of the oral microecological balance, and ensure the oral health of the body.

[0006] The first object of the present invention is to provide the application of polypeptides or their related biological materials in the manufacture of and / or as products for regulating the oral microecological balance.

[0007] The second object of the present invention is to provide the application of bioactive peptides or their related biological materials in the manufacture of and / or as products for regulating the oral microecological balance.

[0008] The above object of the present invention is achieved by the following technical solutions:

[0009] The polypeptide of the present invention with the amino acid sequence shown in SEQ ID NO: 1 or its related biological material can selectively inhibit harmful oral bacteria (such as Streptococcus mutans, etc.) while ensuring the normal physiological activities of oral probiotics (such as Streptococcus sanguinis, Streptococcus salivarius, Streptococcus gordonii, etc.), and thus effectively regulate the oral microecological balance. Therefore, the present invention provides the application of the polypeptide or its related biological material in the preparation of a product for regulating the oral microecological balance, wherein the amino acid sequence of the polypeptide is shown in SEQ ID NO: 1.

[0010] Preferably, the related biological material is a nucleic acid molecule capable of expressing the polypeptide, or an expression cassette, recombinant plasmid, recombinant bacterium or recombinant cell containing the nucleic acid molecule.

[0011] In addition, the present invention also provides the application of the active peptide or its related biological material in the preparation of a product for regulating the oral microecological balance, wherein the active peptide has a homology of more than 85% with the polypeptide with the amino acid sequence shown in SEQ ID NO: 1.

[0012] Preferably, the related biological material is a nucleic acid molecule capable of expressing the active peptide, or an expression cassette, recombinant plasmid, recombinant bacterium or recombinant cell containing the nucleic acid molecule.

[0013] Preferably, regulating the oral microecological balance is to inhibit the growth of harmful oral bacteria and promote and / or not inhibit the growth of oral probiotics.

[0014] More preferably, inhibiting the growth of harmful oral bacteria is to inhibit the growth of Streptococcus mutans.

[0015] Even more preferably, inhibiting the growth of Streptococcus mutans is to inhibit the formation of Streptococcus mutans biofilm.

[0016] More preferably, the oral probiotics are one or more of Streptococcus sanguinis, Streptococcus salivarius, and Streptococcus gordonii.

[0017] Preferably, the product is one or more of oral care solutions, oral lozenges, mouthwashes, toothpastes or mouthwash effervescent tablets.

[0018] Preferably, the product also contains excipients.

[0019] The present invention has the following beneficial effects:

[0020] The polypeptide with the amino acid sequence shown in SEQ ID NO:1 according to the present invention or its related biological materials can selectively inhibit harmful oral bacteria (such as Streptococcus mutans, etc.) while ensuring the normal physiological activities of oral probiotics (such as Streptococcus sanguinis, Streptococcus salivarius, Streptococcus gordonii, etc.), and thus effectively regulate the oral microecological balance. Therefore, the present invention provides the application of the polypeptide with the amino acid sequence shown in SEQ ID NO:1 or its related biological materials in the manufacture of and / or as a product for regulating the oral microecological balance. Description of the Drawings

[0021] Figure 1 Results of the crystal violet staining experiment of the biofilm of Streptococcus mutans.

[0022] Figure 2 Results of the crystal violet staining experiment of the biofilm of Streptococcus salivarius.

[0023] Figure 3 Results of the crystal violet staining experiment of the biofilm of Streptococcus sanguinis.

[0024] Figure 4 Statistical results of the number of each strain in the biofilm experiment of Streptococcus sanguinis - Streptococcus mutans dual - species biofilm.

[0025] Figure 5 Statistical results of the percentage of the number of each strain in the biofilm experiment of Streptococcus sanguinis - Streptococcus mutans dual - species biofilm.

[0026] Figure 6 Statistical results of the number of each strain in the biofilm experiment of Streptococcus sanguinis - Streptococcus salivarius - Streptococcus mutans triple - species biofilm.

[0027] Figure 7 Statistical results of the percentage of the number of each strain in the biofilm experiment of Streptococcus sanguinis - Streptococcus salivarius - Streptococcus mutans triple - species biofilm.

[0028] Figure 8 Statistical results of the number of each strain in the biofilm experiment of Streptococcus sanguinis - Streptococcus gordonii - Streptococcus mutans triple - species biofilm.

[0029] Figure 9 Statistical results of the percentage of the number of each strain in the biofilm experiment of Streptococcus sanguinis - Streptococcus gordonii - Streptococcus mutans triple - species biofilm. Detailed Embodiments

[0030] The present invention will be further described below in conjunction with the drawings in the specification and specific embodiments, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field.

[0031] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0032] Streptococcus mutans: numbered ATCC 700610, purchased from the American Type Culture Collection (ATCC).

[0033] Streptococcus sanguinis: numbered ATCC 10556, purchased from the American Type Culture Collection (ATCC).

[0034] Streptococcus salivarius: numbered ATCC 27975, purchased from the American Type Culture Collection (ATCC).

[0035] Streptococcus gordonii: numbered ATCC 35105, purchased from the American Type Culture Collection (ATCC).

[0036] Example 1 Synthesis of Polypeptide

[0037] Entrusted Sangon Biotech Co., Ltd. to synthesize the polypeptide (amino acid sequence shown in SEQ ID NO:1: GLDWWQL).

[0038] Example 2 Effect of Polypeptide on Common Oral Bacteria in a Single Bacterial System

[0039] I. Effect of Polypeptide on the Biofilm of Streptococcus mutans

[0040] In this example, through the biofilm crystal violet staining experiment, the effect of the polypeptide obtained in Example 1 on the biofilm of Streptococcus mutans at different concentrations (6.25, 12.5, 25 μM) was tested.

[0041] The specific steps of the biofilm crystal violet staining experiment are as follows:

[0042] (1) Culture the biofilm: Use BHI medium to resuscitate and culture Streptococcus mutans. Collect Streptococcus mutans in the logarithmic phase, wash it with PBS, and resuspend it with CDM medium containing 1 wt% sucrose. In a 96-well plate, inoculate Streptococcus mutans at an initial concentration of 1×10 7 CFU / mL into 200 μL of CDM medium containing 1 wt% sucrose. Subsequently, add the polypeptide to the medium so that the final concentrations of the polypeptide are 6.25, 12.5, 25 μM (using the experiment without adding the polypeptide as the blank control group). Anaerobically culture at 37 °C and 5% CO2 for 24 h to form the biofilm of Streptococcus mutans.

[0043] (2) Fix the samples: After the culture, remove the supernatant, wash three times with PBS to remove planktonic bacteria, and fix with methanol for 15 min.

[0044] (3) Staining: After staining with 0.1 mL of 0.1% (w / v) crystal violet staining solution for 5 min, wash thoroughly with sterile normal saline to remove the excess crystal violet dye, then add 200 μL of 95% (v / v) ethanol, and then shake the 96-well plate for 30 min.

[0045] (4) Quantitative analysis: Measure the absorbance (OD value) at 595 nm through a spectrophotometer, and indirectly reflect the biomass of the biofilm.

[0046] The results are as Figure 1 shown. It can be seen from Figure 1 that under the action of the polypeptide at a concentration of 6.25 - 25 μM, the biomass of Streptococcus mutans biofilm is significantly reduced, indicating that the polypeptide of the present invention can significantly inhibit the formation of Streptococcus mutans biofilm, and further significantly inhibit the growth of Streptococcus mutans.

[0047] II. Effect of the polypeptide on Streptococcus salivarius biofilm

[0048] Using the same method as described above for "Effect of the polypeptide on Streptococcus mutans biofilm", test the effect of the polypeptide on Streptococcus salivarius biofilm at different concentrations (6.25, 12.5, 25 μM), and use the experiment without adding the polypeptide as the blank control group.

[0049] The results are as Figure 2 shown. It can be seen from Figure 2 that within the concentration range of 6.25 - 25 μM, the polypeptide has no inhibitory effect on the formation of Streptococcus salivarius biofilm, indicating that it will not inhibit the growth of Streptococcus salivarius.

[0050] III. Effect of the polypeptide on Streptococcus sanguinis biofilm

[0051] Using the same method as described above for "Effect of the polypeptide on Streptococcus mutans biofilm", test the effect of the polypeptide on Streptococcus sanguinis biofilm at different concentrations (6.25, 12.5, 25 μM), and use the experiment without adding the polypeptide as the blank control group.

[0052] The results are as Figure 3 shown. It can be seen from Figure 3 that within the concentration range of 6.25 - 25 μM, the polypeptide has no inhibitory effect on the formation of Streptococcus sanguinis biofilm, indicating that it will not inhibit the growth of Streptococcus sanguinis.

[0053] In summary, the polypeptide of the present invention can selectively inhibit oral harmful bacteria (such as Streptococcus mutans) while ensuring the normal physiological activities of oral probiotics (such as Streptococcus salivarius, Streptococcus sanguinis, etc.), indicating that the polypeptide of the present invention can effectively regulate the oral microecological balance and ensure the oral health of the body.

[0054] Example 3 Effect of Polypeptide on Common Oral Bacteria in a Mixed Bacterial System

[0055] I. Streptococcus sanguinis - Streptococcus mutans Dual - Strain Biofilm Experiment

[0056] Use BHI medium to resuscitate and culture Streptococcus sanguinis and Streptococcus mutans respectively. Collect Streptococcus sanguinis and Streptococcus mutans in the logarithmic phase. After washing with PBS, resuspend them in CDM medium containing 1 wt% sucrose. In a 24 - well plate, inoculate both Streptococcus sanguinis and Streptococcus mutans into CDM medium containing 1 wt% sucrose at an initial concentration of 1×10 7 CFU / mL. Subsequently, add the polypeptide to the medium so that the final concentrations of the polypeptide are 1.56, 3.13, 6.25, 12.5, 25 μM respectively (the experiment without adding polypeptide is used as the blank control group). Anaerobically culture for 24 h at 37 °C and 5% CO2 to form a Streptococcus sanguinis - Streptococcus mutans dual - strain biofilm. After the culture is completed, remove the supernatant, wash three times with PBS, collect the Streptococcus sanguinis - Streptococcus mutans dual - strain biofilm, and extract genomic DNA. Use 16S rRNA specific primers (for Streptococcus sanguinis: forward primer SEQ ID NO:2: CAAAATTGTTGCAAATCCAAAGG, reverse primer SEQ ID NO:3: GCTATCGCTCCCTGTCTTTGA; for Streptococcus mutans: forward primer SEQ ID NO:4: GCCTACAGCTCAGAGATGCTATTCT, reverse primer SEQ ID NO:5: GCCATACACCACTCATGAATTGA) to amplify the DNA of Streptococcus sanguinis and Streptococcus mutans respectively, record the Ct values of each strain, and then calculate the specific quantity and percentage of each strain in the mixed bacterial population according to the Ct - CFU standard curve of each strain.

[0057] The statistical results of the quantity of each strain in the mixed bacterial population are as Figure 4 shown. It can be seen that in the Streptococcus sanguinis - Streptococcus mutans dual - strain culture system, under the action of the polypeptide at each concentration, the quantity of Streptococcus sanguinis remains basically unchanged, while the quantity of Streptococcus mutans decreases significantly. It shows that the polypeptide of the present invention can target and inhibit oral harmful bacteria (Streptococcus mutans) without interfering with oral probiotics (Streptococcus sanguinis), and thus effectively regulate the oral micro - ecological balance.

[0058] The statistical results of the percentage of each strain in the mixed bacterial population are as Figure 5 shown. It can be seen that in the Streptococcus sanguinis - Streptococcus mutans dual - strain culture system, under the action of the polypeptide at each concentration, the proportion of Streptococcus sanguinis increases, while the proportion of Streptococcus mutans decreases significantly. It shows that the polypeptide of the present invention can target and inhibit oral harmful bacteria (Streptococcus mutans) without interfering with oral probiotics (Streptococcus sanguinis), and thus effectively regulate the oral micro - ecological balance.

[0059] II. Experiment on the biofilm of Streptococcus sanguinis - Streptococcus salivarius - Streptococcus mutans

[0060] Use BHI medium to resuscitate and culture Streptococcus sanguinis, Streptococcus salivarius and Streptococcus mutans respectively. Collect Streptococcus sanguinis, Streptococcus salivarius and Streptococcus mutans in the logarithmic phase. After washing with PBS, resuspend them with CDM medium containing 1 wt% sucrose. In a 24-well plate, inoculate Streptococcus sanguinis, Streptococcus salivarius and Streptococcus mutans into the CDM medium containing 1 wt% sucrose at an initial concentration of 1×10 6 CFU / mL. Subsequently, add polypeptides to the medium so that the final concentrations of the polypeptides are 1.56, 3.13, 6.25, 12.5, 25 μM respectively (using the experiment without adding polypeptides as the blank control group). Anaerobically culture at 37 °C and 5% CO2 for 24 h to form the biofilm of Streptococcus sanguinis - Streptococcus salivarius - Streptococcus mutans. After the culture, remove the supernatant, wash three times with PBS, collect the biofilm of Streptococcus sanguinis - Streptococcus salivarius - Streptococcus mutans, and extract genomic DNA. Use 16S rRNA specific primers (for Streptococcus sanguinis: forward primer SEQ ID NO:2: CAAAATTGTTGCAAATCCAAAGG, reverse primer SEQ ID NO:3: GCTATCGCTCCCTGTCTTTGA; for Streptococcus salivarius: forward primer SEQ ID NO:6: CTGCTCTTGTGACAGCCCAT, reverse primer SEQ ID NO:7: ACGGGAAGCTGATCTTTCGTA; for Streptococcus mutans: forward primer SEQ ID NO:4: GCCTACAGCTCAGAGATGCTATTCT, reverse primer SEQ ID NO:5: GCCATACACCACTCATGAATTGA) to amplify the DNA of Streptococcus sanguinis, Streptococcus salivarius and Streptococcus mutans respectively, record the Ct values of each strain, and then calculate the specific quantity and percentage of each strain in the mixed flora according to the Ct-CFU standard curve of each strain.

[0061] The statistical results of the quantity of each strain in the mixed flora are as Figure 6 shown. It can be seen that in the culture system of Streptococcus sanguinis - Streptococcus salivarius - Streptococcus mutans, under the action of polypeptides at various concentrations, the bacterial amounts of Streptococcus sanguinis and Streptococcus salivarius basically remain unchanged, while the bacterial amount of Streptococcus mutans decreases significantly. It shows that the polypeptide of the present invention can target and inhibit oral harmful bacteria (Streptococcus mutans) without interfering with oral probiotics (Streptococcus sanguinis, Streptococcus salivarius), thereby effectively regulating the microecological balance of the oral cavity.

[0062] The statistical results of the percentage of the quantity of each strain in the mixed flora are as Figure 7As shown. It can be seen that in the Streptococcus sanguinis - Streptococcus salivarius - Streptococcus mutans three - strain culture system, under the action of polypeptides at various concentrations, the proportion of Streptococcus salivarius increases, the proportion of Streptococcus sanguinis remains basically unchanged, while the proportion of Streptococcus mutans decreases significantly. This indicates that the polypeptide of the present invention can target and inhibit oral harmful bacteria (Streptococcus mutans) without interfering with oral probiotics (Streptococcus sanguinis, Streptococcus salivarius), thereby effectively regulating the oral micro - ecological balance.

[0063] III. Experiment on biofilm of Streptococcus sanguinis - Streptococcus gordonii - Streptococcus mutans three - strain

[0064] Use BHI medium to resuscitate and culture Streptococcus sanguinis, Streptococcus gordonii and Streptococcus mutans respectively. Collect Streptococcus sanguinis, Streptococcus gordonii and Streptococcus mutans in the logarithmic phase. After washing with PBS, resuspend them with CDM medium containing 1 wt% sucrose. In a 24 - well plate, inoculate Streptococcus sanguinis, Streptococcus gordonii and Streptococcus mutans into the CDM medium containing 1 wt% sucrose at an initial concentration of 1×10 7 CFU / mL. Subsequently, add polypeptides to the medium so that the final concentrations of the polypeptides are 1.56, 3.13, 6.25, 12.5, 25 μM respectively (the experiment without adding polypeptides is used as the blank control group). Anaerobically culture for 24 h at 37 °C and 5% CO2 to form a biofilm of Streptococcus sanguinis - Streptococcus gordonii - Streptococcus mutans three - strain. After the culture is completed, remove the supernatant, wash three times with PBS, collect the biofilm of Streptococcus sanguinis - Streptococcus gordonii - Streptococcus mutans three - strain, and extract genomic DNA. Use 16S rRNA specific primers (for Streptococcus sanguinis: forward primer SEQ ID NO:2: CAAAATTGTTGCAAATCCAAAGG, reverse primer SEQ ID NO:3: GCTATCGCTCCCTGTCTTTGA; for Streptococcus gordonii: forward primer SEQ ID NO:8: CGGATGATGCTAATCAAGTGCCC, reverse primer SEQ ID NO:9: GTTAGCTGTTGGATTGGTTGCC; for Streptococcus mutans: forward primer SEQ ID NO:4: GCCTACAGCTCAGAGATGCTATTCT, reverse primer SEQ ID NO:5: GCCATACACCACTCATGAATTGA) to amplify the DNA of Streptococcus sanguinis, Streptococcus gordonii and Streptococcus mutans respectively, record the Ct values of each strain, and then calculate the specific quantity and percentage of each strain in the mixed flora according to the Ct - CFU standard curve of each strain.

[0065] The statistical results of the quantity of each strain in the mixed flora are as Figure 8As shown. It can be seen that in the three-strain culture system of Streptococcus sanguinis - Streptococcus gordonii - Streptococcus mutans, under the action of the polypeptide at various concentrations, the bacterial counts of Streptococcus sanguinis and Streptococcus gordonii basically remain unchanged, while the bacterial count of Streptococcus mutans decreases significantly. This indicates that the polypeptide of the present invention can target and inhibit oral harmful bacteria (Streptococcus mutans) without interfering with oral probiotics (Streptococcus sanguinis, Streptococcus gordonii), thereby effectively regulating the oral microecological balance.

[0066] The statistical results of the percentage of the number of each strain in the mixed flora are as Figure 9 shown. It can be seen that in the three-strain culture system of Streptococcus sanguinis - Streptococcus gordonii - Streptococcus mutans, under the action of the polypeptide at various concentrations, the proportion of Streptococcus sanguinis increases, the proportion of Streptococcus gordonii basically remains unchanged, while the proportion of Streptococcus mutans decreases significantly. This indicates that the polypeptide of the present invention can target and inhibit oral harmful bacteria (Streptococcus mutans) without interfering with oral probiotics (Streptococcus sanguinis, Streptococcus gordonii), thereby effectively regulating the oral microecological balance.

[0067] In summary, it can be seen that the polypeptide of the present invention with the amino acid sequence shown in SEQ ID NO:1 or its related biological materials can selectively inhibit oral harmful bacteria (such as Streptococcus mutans, etc.) while ensuring the normal physiological activities of oral probiotics (such as Streptococcus sanguinis, Streptococcus salivarius, Streptococcus gordonii, etc.), thereby effectively regulating the oral microecological balance and ensuring the oral health of the body.

[0068] The above embodiments are the preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. Use of polypeptides or related biomaterials in the preparation of products for regulating oral microecological balance, characterized in that: The amino acid sequence of the polypeptide is shown in SEQ ID NO: 1, and the related biological material is a nucleic acid molecule expressing the polypeptide; the regulation of oral microecological balance is to inhibit the growth of oral harmful bacteria, and does not inhibit the growth of oral probiotics; the inhibition of the growth of oral harmful bacteria is to inhibit the growth of Streptococcus mutans; the oral probiotics are one or more of Streptococcus sanguinis, Streptococcus salivarius, and Streptococcus gordonii.

2. The use according to claim 1, characterized in that: The inhibition of the growth of mutans streptococci is the inhibition of the formation of mutans streptococcus biofilm.

3. The application according to claim 1, characterized in that: The product is one or more of an oral care solution, an oral lozenge, a toothpaste or a mouthwash effervescent tablet.

4. The use according to claim 1, characterized in that: The product also contains excipients.

Citation Information

Patent Citations

  • Oligopeptide used for inhibiting fungal biofilm and application of oligopeptide

    CN112321679A