Protein ZmCAAX for controlling carotenoid content of corn seeds as well as coding gene and application thereof

Abstract

The invention relates to a corn carotenoid biosynthesis related protein ZmCAAX, a coding gene thereof and application of the corn carotenoid biosynthesis related protein ZmCAAX in increasing the carotenoid content of plants. The invention relates to a protein which is named as ZmCAAX, is derived from Zea mays L., and is a protein shown as any one of (A1)-(A3): (A1) a protein consisting of an amino acid sequence shown as a sequence 1 in a sequence table; (A2) a protein which is obtained by substituting and / or deleting and / or adding one or more amino acid residues to the amino acid sequence as shown in the sequence 1 in the sequence table, is related to control of the carotenoid content of the corn seeds and is derived from the sequence 1; and (A3) a fusion protein obtained by connecting a tag to the N end and / or C end of the protein defined in (A1) or (A2).

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and more specifically to a corn carotenoid biosynthesis-related protein ZmCAAX and its encoding gene and application in increasing the carotenoid content of plants. Background Art

[0002] Corn is considered one of the three major food crops in the world, and its planting area ranks first in my country, making it an important food, feed and industrial raw material in my country. This makes corn play an indispensable role in my country's national economy. However, the content of nutrients such as vitamins, carotenoids and minerals contained in corn is relatively low, which are essential for maintaining good health.

[0003] As a country where grains are the staple food, people gradually tend to prefer taste in their diet choices, which makes the fine processing of grains lead to a large loss of nutrients such as minerals and vitamins, which in turn cannot meet the normal needs of the human body. Among them, vitamin A is an important component necessary for the human body. It plays an important role in maintaining vision, enhancing immune function, promoting cell growth, improving reproductive capacity, and supporting fetal development.

[0004] Carotenoids refer to a group of natural pigments, mainly including α-carotene, β-carotene, lutein and zeaxanthin, which are both precursors of vitamin A and can be converted into vitamin A in the body to play a physiological function. However, only plants and microorganisms can synthesize carotenoids, and the human body must rely on food intake to obtain them. Most food crops contain less carotenoids. For those who consume less fruits and vegetables, the carotenoid content in the diet obviously cannot meet the body's needs, which is particularly evident in developing countries.

[0005] In addition, carotenoids have the ability to remove free radicals and reactive oxygen species produced during metabolism, delay aging, enhance immunity, and have multiple functions such as anti-cancer and cancer prevention. Therefore, increasing the content of carotenoids in grains through biofortification technology has become an effective way to alleviate vitamin A deficiency. In this context, it is particularly important to conduct in-depth research on carotenoid synthesis-related genes in corn and cultivate corn varieties with high carotenoid content. Summary of the invention

[0006] In view of the above-mentioned prior art, the purpose of the present invention is to provide a protein ZmCAAX for controlling the carotenoid content of corn seeds and its encoding gene and application.

[0007] In a first aspect, the present invention provides a protein named ZmCAAX, which is derived from corn (Zeamays L.) of the genus Zea mays, and is a protein as shown in any one of the following (A1)-(A3):

[0008] (A1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing;

[0009] (A2) the amino acid sequence shown in Sequence 1 in the sequence list is substituted and / or deleted and / or added with one or more amino acid residues, and a protein derived from Sequence 1 that is related to controlling the carotenoid content of corn seeds;

[0010] (A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in (A1) or (A2).

[0011] Among them, the amino acid sequence shown in sequence 1 in (A1) includes 375 amino acid residues. In this protein sequence, hydrophobic amino acids account for 218 and hydrophilic amino acids account for 122; basic amino acids account for 40 and acidic amino acids account for 34; the molecular weight of the protein is 40.573KD, the isoelectric point is 9.04; the aliphatic index is 91.2; and the overall average hydrophilicity (GRAVY) is 0.123.

[0012] The protein in (A2) can be synthesized artificially, or its coding gene can be synthesized first and then expressed biologically. The coding gene of the protein in (A2) can be obtained by deleting one or several codons for amino acid residues in the coding region (positions 329-1128) of the cDNA sequence shown in Sequence 6 in the sequence table, and / or performing missense mutations of one or several base pairs.

[0013] In order to facilitate the purification of the protein in (A1) or (A2), a tag may be attached to the amino terminus or carboxyl terminus of the protein in (A1) or (A2). The tag may be Poly-Arg (usually 6 RRRRR), Poly-His (usually 6 HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK) or c-myc (EQKLISEEDL).

[0014] In a second aspect, the present invention provides a nucleic acid molecule encoding the protein ZmCAAX.

[0015] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA, hnRNA or tRNA.

[0016] Preferably, the nucleic acid molecule is a DNA molecule as shown in any one of the following (1)-(9):

[0017] (1) the DNA molecule shown in Sequence 2 in the sequence listing;

[0018] (2) the DNA molecule shown in Sequence 3 in the sequence listing;

[0019] (3) the DNA molecule shown in Sequence 4 in the sequence listing;

[0020] (4) Sequence 5 or the coding region of the sequence listing includes the DNA molecule shown in positions 329-1456 of Sequence 5;

[0021] (5) Sequence 6 or the coding region of the sequence listing includes the DNA molecule shown in positions 329-698 of Sequence 6;

[0022] (6) Sequence 7 or the coding region of the sequence listing includes the DNA molecule shown in positions 329-1369 of Sequence 7;

[0023] (7) A DNA molecule encoding a protein represented by sequence 1 other than (1) or (4);

[0024] (8) a DNA molecule that hybridizes with any of the DNA molecules defined in (1) to (7) under stringent conditions and encodes a protein derived from sequence 1 that is associated with controlling the carotenoid content of corn;

[0025] (9) A DNA molecule having 80% or more identity with the DNA sequence defined in any one of (1) to (8) and encoding a protein derived from sequence 1 that controls the carotenoid content in corn.

[0026] Among them, sequence 2 is the sequence of the ZmCAAX gene in the wild-type corn RP125 genome; sequence 3 is the sequence of the ZmCAAX gene in the mutant Zmcaax-1 corn genome; sequence 4 is the sequence of the ZmCAAX gene in the mutant Zmcaax-2 corn genome; sequence 5 is the cDNA sequence of the ZmCAAX gene in the wild-type corn (wherein positions 329-1456 are the coding region sequence); sequence 6 is the cDNA sequence of the ZmCAAX gene in the mutant Zmcaax-1 (wherein positions 329-698 are the coding region sequence); sequence 7 is the cDNA sequence of the ZmCAAX gene in the mutant Zmcaax-2 (wherein positions 329-1369 are the coding region sequence).

[0027] The "stringent conditions" described here are hybridization and washing twice at 68°C in a 2×SSC, 0.1% SDS solution, for 5 min each time, and hybridization and washing twice at 68°C in a 0.5×SSC, 0.1% SDS solution, for 15 min each time; or hybridization and washing at 65°C in a 0.1×SSPE (or 0.1×SSC), 0.1% SDS solution.

[0028] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 80% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein encoding ZmCAAX of the present invention. Identity can be evaluated using computer software, such as the BLAST algorithm (Altschul et al. 1990. Journal of Molecular Biology 215: 403-410; Karlin and Altschul. 1993. Proceedings of the National Academy of Sciences 90: 5873-5877).

[0029] In a third aspect, the present invention provides a recombinant vector, an expression cassette, a transgenic cell line or a recombinant microorganism of the nucleic acid molecule.

[0030] The recombinant vector may be a recombinant expression vector or a recombinant cloning vector.

[0031] The recombinant expression vector can be constructed with existing plant expression vectors. The plant expression vector includes a binary agrobacterium vector and a vector that can be used for plant microprojectile bombardment, pCAMBIA3301, pCAMBIA1300, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN or other derived plant expression vectors. The plant expression vector can also include the 3' end non-translated region of the foreign gene, i.e., include polyadenylic acid signal and any other DNA fragments that participate in mRNA processing or gene expression. The polyadenylic acid signal can guide polyadenylic acid to join the 3' end of the mRNA precursor. When the gene is used to construct a recombinant expression vector, any enhanced, constitutive, tissue-specific or inducible promoter can be added before the transcription start nucleotide, such as the cauliflower mosaic virus (CaMV) 35S promoter, the ubiquitin gene Ubiquitin promoter (pUbi), the stress-induced promoter rd29A, etc., which can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a recombinant expression vector, an enhancer can also be used, including a translation enhancer or a transcription enhancer. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive, and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the recombinant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes, antibiotic markers with resistance, or chemical reagent resistance marker genes, etc. It is also possible to directly screen transformed plants by stress without adding any selective marker genes.

[0032] The expression cassette consists of a promoter capable of initiating the expression of the gene, the gene, and a transcription termination sequence.

[0033] The transgenic cell line is a non-reproductive material into which the gene has been transferred.

[0034] In a fourth aspect, the present invention provides the use of the protein or the nucleic acid molecule in plant breeding and / or seed production or in regulating the content of carotenoids in plants.

[0035] In the above application, the plant can be either a monocot or a dicot, wherein the monocot can be a grass plant, such as corn.

[0036] Preferably, the carotenoids include lutein, zeaxanthin, α-carotene and β-carotene.

[0037] In a fifth aspect, the present invention provides a method for breeding transgenic plants, comprising the following steps: introducing the expression of the gene into a recipient plant to obtain a transgenic plant with increased carotenoid content; the recipient plant may be a monocot or a dicot; more preferably, the recipient plant is corn.

[0038] In the above method, CRISPR / Cas9 nuclease can be used to specifically shear the genomic DNA sequence of the encoding gene in the recipient plant, so that the recipient plant increases the ability to express the functional protein.

[0039] Among them, the 35S promoter specifically overexpresses the cDNA sequence encoding the ZmCAAX protein in the recipient plant. More specifically, primers are designed according to the maize ZmCAAX gene sequence, and the PCR reaction uses EVO high-fidelity enzyme for PCR cloning. And it is connected to the monocotyledon binary expression vector pCAMBIA3301 (preserved in this laboratory) expression vector through homologous recombinase. After the reaction product is transformed into Escherichia coli, it is plated, positive clones are screened, plasmids are extracted, and then experiments such as Agrobacterium transformation are carried out.

[0040] In a fifth aspect, the present invention provides a method for increasing the carotenoid content in corn seeds, comprising the steps of: increasing the activity and / or expression level of the protein in the target plant to obtain a transgenic plant with increased carotenoid content.

[0041] In the above method, in order to achieve overexpression of protein ZmCAAX in the recipient plant, 35S and / or Ubiquitin and / or the encoding gene's own promoter can be used to highly express the protein of the encoding gene in the recipient plant, so that the receptor plant has the ability to highly express the functional protein. The encoding gene can be introduced into the recipient plant through the recombinant expression vector pCAMBIA1300-ZmCAAX or pCAMBIA3301-ZmCAAX.

[0042] In the above method, the recipient plant can be either a monocot or a dicot, wherein the monocot can be a grass plant, such as corn.

[0043] In a seventh aspect, the present invention provides the use of the protein, or the nucleic acid molecule, or the method in plant breeding.

[0044] In summary, the present invention has the following beneficial effects:

[0045] 1. The corn ZmCAAX gene of the present invention is isolated from corn. As an endogenous gene of corn, it is very beneficial to the genetic engineering of corn. The protein encoded by the ZmCAAX gene can increase the accumulation of total carotenoids in plants. Overexpression of the ZmCAAX gene can promote the accumulation of total carotenoids in plants. By measuring the carotenoid content in transgenic plants, the results showed that the lutein, zeaxanthin, α-carotene and β-carotene of transgenic corn plants were significantly increased compared with wild-type plants; the zeaxanthin content in the seeds of three independently transformed transgenic plants OE-15, OE-18 and OE-42 was increased by an average of 1.55 times compared with the receptor material B104, the lutein was increased by an average of 3.04 times, the α-carotene was increased by an average of 3.01 times, and the β-carotene was increased by an average of 3.3 times.

[0046] 2. The corn ZmCAAX gene of the present invention is involved in regulating the carotenoid content of corn, and overexpression of the gene can increase the carotenoid level in corn. The ZmCAAX gene has good application prospects in plant breeding and germplasm resource improvement. Compared with the prior art, the beneficial effect of the present invention is that the results show that the ZmCAAX gene and the protein encoded by it play an important role in increasing the carotenoid content of plants. The ZmCAAX protein and the encoding gene provided by the present invention have important application value in the research of increasing the carotenoid content and stress resistance of plants. The present invention has broad application space and market prospects in the field of agriculture.

[0047] It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not intended to limit the scope of protection of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 It is a phenotypic comparison diagram of the wild-type material and the mutant Zmcaax-1 material of the present invention. Among them, AH: phenotypic comparison of the whole plant, stem, leaf, female ear, filament, male ear, aerial root, and leaf ear of the wild-type RP125 and the mutant material Zmcaax-1; I: phenotypic comparison of the ear of the wild-type material RP125 and the mutant material Zmcaax-1; J: comparison of the carotenoid content of the wild-type material RP125 and the mutant material Zmcaax-1;

[0049] Figure 2 It is the map-based cloning and allelic verification diagram of the ZmCAAX gene of the present invention. Among them, A: map-based cloning of the ZmCAAX gene; B: schematic diagram of the gene structure of the ZmCAAX gene and comparison of the mutation sites of the mutant Zmcaax-1 and the allelic mutant Zmcaax-2; C: comparison of the hybrid offspring plants of the wild-type RP125, the mutant Zmcaax-1 and the allelic mutant Zmcaax-2 materials;

[0050] Figure 3 The diagram is a comparative relationship between the expression level of the ZmCAAX gene in the transgenic receptor (B104) and the overexpression material (OE-15, OE-18, OE-42) of the present invention and the content of carotenoids in the seeds. A: The difference in the expression level of the ZmCAAX gene in the transgenic receptor (B104) and the overexpression material (OE-15, OE-18, OE-42); B: The difference in the expression level of the ZmCAAX protein in the transgenic receptor (B104) and the overexpression material (OE-15, OE-18, OE-42); C: The zeaxanthin in the seeds of the transgenic receptor (B104) and the overexpression material (OE-15, OE-18, OE-42) Comparison of content; D: Comparison of lutein content in seeds of transgenic receptor (B104) and overexpression materials (OE-15, OE-18, OE-42); E: Comparison of α-carotene content in seeds of transgenic receptor (B104) and overexpression materials (OE-15, OE-18, OE-42); F: Comparison of β-carotene content in seeds of transgenic receptor (B104) and overexpression materials (OE-15, OE-18, OE-42). DETAILED DESCRIPTION

[0051] The present invention is further described in detail below in conjunction with the examples. It is particularly noted that if no specific conditions are specified in the following examples, the reactions are carried out according to conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, the raw materials used in the following examples can be obtained from common commercial sources.

[0052] The present invention adopts a map-based cloning strategy, uses a corn yellowing mutant Zmcaax-1 and a corn inbred line B73 to mate F1 and F2 populations, and uses the reference genome sequence of the corn inbred line B73 as a reference to locate the gene controlling the mutant trait on corn chromosome 10, with a physical distance of about 0.056Mb, including a total of 2 genes. Among them, the sequence with the gene number Zm00001d025860 is different between the mutant and the wild type, and the mutant has a base substitution from G to A. The mutation site occurs in the first base of the first intron, resulting in the retention of the first intron and the premature termination of translation. In the mutant Zmcaax-2, the base is mutated from G to A on the 9th exon with the gene number Zm00001d025860, and the amino acid in the protein sequence encoded by the gene is mutated from tryptophan (Trp) to a stop codon. Genetic analysis showed that the mutants Zmcaax-1 and Zmcaax-2 were allelic mutants, and the allelic materials and hybrid offspring all had a yellowing phenotype. Therefore, the Zm00001d025860 gene is the target gene that causes the reduction of maize carotenoid content and yellowing of leaves. Because it contains a CAAX domain (where C is cysteine, A is an aliphatic amino acid, and X is methionine or serine), it is named ZmCAAX.

[0053] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0054] The test materials used in the examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. The experimental methods without detailed conditions are carried out in accordance with conventional test methods or in accordance with the operating instructions recommended by the supplier. Among them: the wild-type maize inbred line RP125, mutants Zmcaax-1, Zmcaax-2, conventional inbred line B73, and maize transgenic receptor B104 are collected and preserved by this laboratory, and the public can obtain them from Shandong Agricultural University, and transgenic materials OE15, OE18 and OE42 to repeat this implementation method.

[0055] Example

[0056] Example 1

[0057] Map-based cloning of the gene Zmcaax controlling carotenoid content in maize

[0058] I. Phenotype of the maize mutant Zmcaax-1

[0059] Compared with normal plants (RP125), the leaves, stems, leaf sheaths, and roots of the maize mutant Zmcaax-1 began to turn yellow at the 5-6 leaf stage, and all organs including tassels, ears, bracts, filaments, and cobs turned yellow in the late growth stage ( Figure 1 AH), the mutant ears became smaller (Table 1, Figure 1 I), the contents of chlorophyll and carotenoids were significantly reduced (Table 2, Figure 1 Meanwhile, the zeaxanthin content in the grains decreased by an average of 3.1 times, the lutein content decreased by an average of 2.2 times, the α-carotene content decreased by 1.82 times, and the β-carotene content decreased by an average of 2.7 times (Table 3, Figure 1 Therefore, it is believed that the yellowing of leaves, stems, female ears and other parts of the mutant is caused by the extremely significant reduction of chlorophyll and carotenoid content in seeds.

[0060] Table 1 Yield trait investigation data

[0061]

[0062] Table 2 Results of photosynthetic pigment determination at the two-leaf stage

[0063] Material Chlorophyll a Chlorophyll b Carotenoids RP125 2.62±0.02 1.17±0.22 1.11±0.16 Zmcaax-1 1.39±0.05 0.31±0.02 0.50±0.01

[0064] Table 3 Determination results of carotenoid content in wild type and mutant seeds

[0065] Material α-Carotene (μg / g) β-Carotene (μg / g) Zeaxanthin (μg / g) Lutein (μg / g) RP125 0.240±0.01 0.31±0.02 1.230±0.12 2.27±0.19 Zmcaax-1 0.132±0.01 0.12±0.01 0.49±0.07 1.05±0.12

[0066] 2. Construction of genetic mapping population

[0067] The mutant Zmcaax-1 was crossed with the maize inbred line B73 to form F1. The F1 plants were normal, and the F2 plants showed segregation between normal and yellow plants. The seeds on one ear were randomly phenotyped. The chi-square test showed that the segregation ratio of normal green and mutant yellow plants was in accordance with Mendel's law of segregation of 3:1 (Table 4), indicating that the yellow phenotype of Zmcaax-1 was controlled by a single recessive gene. We expanded the F2 population and used it as a genetic mapping population for positional cloning of the target gene.

[0068] Table 4 Chi-square test of F2 segregating population

[0069]

[0070]

[0071] 3. Map-based cloning of the ZmCAAX gene

[0072] First, the genomic DNA of the two parents of the genetic mapping population, mutants Zmcaax-1 and B73, was used as a template, and primers with polymorphism between mutants Zmcaax-1 and B73 were screened using maize whole genome primers. Then, 20 yellowing plants with extreme phenotypes and 20 normal plants were selected from the F2 population to verify whether the polymorphic primers were linked to the yellowing trait. The screened linkage primers were used to determine the genotypes of 93 plants in the population, and the positioning interval was determined according to the decreasing trend based on the number of exchange plants screened by different primers, thereby locating the ZmCAAX gene between primer markers indels4 and bnlg1074 on chromosome 10 of maize.

[0073] Polymorphic molecular markers were further developed between indels4 and bnlg1074 and used to detect all plants in the F2 population (768 plants). The ZmCAAX gene was eventually located in a 56Kb segment between markers indels3 and indels7. With reference to the published genome sequencing results of the maize inbred line B73, the physical distance was approximately 0.056Mb ( Figure 2 The sequences of the molecular marker primers used for gene localization are shown in Table 5.

[0074] Table 5 Molecular marker primers used for gene localization and ZmCAAX gene amplification primer sequences

[0075] Primer name Upstream primer (5'-3') Downstream primer (5'-3') umc1506 AAAAGAAACATGTTCAGTCGAGCG ATAAAGGTTGGCAAAACGTAGCCT bnlg1074 CATGCTAATAGCCTACCGGG TTTCCCCCTGATTCGTTATG indels1 CAGTCCTACCTCTGTTCTGGC CAAGGTACATGCACAGATGACA indels2 TAAATCAAGTGCATCACCCTCGA TGCAGATCCAGAACATCTTGTGA indels3 ATCTGGTGTTAACGCCTACTGAG ACTCTACTTTTCCACAGCAGGAG indels4 AACAAGAGGCGACACAAGTTGTT AAAGTAGCTCATCCCAGTCACTC indels5 AAAGTGCACCTCCCAACCAT CTAACCAAGAAGCGCCGTTG indels6 GGAGACGATGGTCACTCACTC CACAACATCATCATGTCCCACG indels7 CACTCTGCATTATTGCGCCG TCTGCTCATATCGTTGATGATGG qRT-ZmCAAX GCTCCACCAATCATGGCTCT ATATCGGCCAATGCTCCCTG qRT-18S CTGAGAAACGGCTACCACA CCCAAGGTCCAACTACGAG primer_ZmCAAX AACTTTTGCATGTGGCCTGC AAGTGTGGGAGAGGGACGAG

[0076] 4. Cloning of ZmCAAX gene

[0077] According to the sequencing information of the maize B73 genome, there are two genes in the 0.056Mb range of the positioning interval, namely Zm00001d025859 and Zm00001d025860. The genomic DNA of the wild type and the mutant was used as a template to amplify the two genes and compare their sequence differences. The results showed that only the sequence with the gene number Zm00001d025860 was different between the mutant and the wild type. The mutant had a base substitution from G to A. The mutation happened at the exon-intron boundary, affecting the selective splicing of the intron, resulting in the retention of the first intron and leading to premature termination of translation. Therefore, it is speculated that the Zm00001d025860 gene may be the candidate gene of Zmcaax-1.

[0078] Figure 2 Figure B shows the gene structure of Zm00001d025860, which contains 9 exons (yellow boxes) and 8 introns (black segments).

[0079] Using the genomic DNA of the wild-type maize inbred line material RP125 as a template, PCR amplification was performed using the primer primer_ZmCAAX (Table 5) of the Zm00001d025860 gene. The sequence of the resulting PCR product was sequence 2 in the sequence table, and sequence 2 was the sequence of the ZmCAAX gene in the wild-type maize inbred line RP125 genome; using the genomic DNA of the mutant Zmcaax-1 material as a template, PCR amplification was also performed using the primer primer_ZmCAAX, and the sequence of the resulting PCR product was sequence 3 in the sequence table, and sequence 3 was the sequence of the ZmCAAX gene in the mutant Zmcaax-1 genome, specifically: compared with sequence 2, its 748th base mutated from G to A, and this mutation caused the first base of the first intron of the gene number Zm00001d025860 to mutate from G to A. It is speculated that this mutation may lead to selective splicing of the gene, resulting in premature termination of the encoded protein and change of its function. Total RNA of wild-type inbred line material was extracted, reverse transcribed into cDNA, and PCR amplification was performed using primer primer_ZmCAAX. The sequence of the obtained PCR product was sequence 5 in the sequence list, which was the cDNA sequence of the ZmCAAX gene in the wild-type corn inbred line RP125, wherein positions 329-1456 were the coding region sequence; total RNA of mutant Zmcaax-1 material was extracted, reverse transcribed into cDNA, and PCR amplification was performed using primer primer_ZmCAAX. The sequence of the obtained PCR product was Sequence 6 in the sequence table is the cDNA sequence of the ZmCAAX gene in the mutant Zmcaax-1, wherein the 649th base G is mutated to A, wherein the 648th to 722nd bases are the intron retention sequence, and the retained sequence is located on the first intron of the gene number Zm00001d025860. Compared with the wild-type corn inbred line RP125, the ZmCAAX protein encoded by Zmcaax-1 is terminated prematurely, and the amino acids of the encoded protein are changed from 375 to 121, resulting in the loss or / and weakening of the protein function. Sequence 2 and sequence 5 both encode the ZmCAAX protein shown in sequence 1 in the sequence table.

[0080] 5. Allelic verification of ZmCAAX gene

[0081] In the constructed mutant library, another mutant material with a similar phenotype to Zmcaax-1 was found, and its phenotype was also whole-plant yellowing, named Zmcaax-2 ( Figure 2C), constructed genetic materials of Zmcaax-1×Zmcaax-2 hybridization, and the hybrid contemporary and self-pollinated offspring plants all had yellowing phenotypes, indicating that the two materials were allelic variation materials of the same gene, extracted the genomic DNA of Zmcaax-2, and amplified the gene of ZmCAAX, and analyzed the data after sequencing. It was found that: using the genomic DNA of the mutant Zmcaax-2 material as a template, PCR amplification was also performed using primer primer_ZmCAAX, and the sequence of the obtained PCR product was sequence 4 in the sequence table, which was the sequence of the ZmCAAX gene in the mutant Zmcaax-2 genome, specifically: compared with sequence 2, the 2448th base was mutated from G to A, and the mutation caused the 347th amino acid of the gene number Zm00001d025860 to mutate from tryptophan (UGG) to a stop codon (UGA).

[0082] Total RNA was extracted from the mutant Zmcaax-2 material and reverse transcribed into cDNA. PCR amplification was also performed using primer primer_ZmCAAX. The sequence of the resulting PCR product was sequence 7 in the sequence list, and sequence 7 was the cDNA sequence of the ZmCAAX gene in the mutant Zmcaax-2. Compared with the cDNA sequence of the wild-type corn inbred line RP125, the mutation occurred in the 9th exon of the Zm00001d025860 gene, specifically, the base G at position 1369 mutated to A, and the triplet codon at position 347 mutated from UGG (encoding tryptophan, abbreviated as W) to UGA (stop codon), and the encoded ZmCAAX protein was terminated prematurely, resulting in the amino acids encoding the ZmCAAX protein changing from 375 to 346, with a total deletion of 29 amino acids, resulting in loss or / and weakening of the protein function.

[0083] Example 2

[0084] Maize ZmCAAX gene regulates carotenoid content

[0085] 1. Detection of carotenoid content in seeds of wild-type materials and overexpression materials

[0086] The ZmCAAX gene overexpression vector was constructed and transformed into the callus of wild-type B104. The plants OE overexpressing the ZmCAAX gene were then cultured and the relative expression level of the ZmCAAX gene in the overexpressed plants was determined using qRT-ZmCAAX primers. qRT-Zm18S was used as a housekeeping gene. The relative expression levels of the ZmCAAX gene in the OE overexpression materials were higher than those in the wild-type B104 ( Figure 3 A), the protein expression level was also higher than that of the wild type ( Figure 3 (middle B).

[0087] The carotenoid contents in seeds of wild-type B104 and overexpression materials OE-15, OE-18 and OE-42 were analyzed and determined by high performance liquid chromatography. The contents of four carotenoids, including zeaxanthin, lutein, α-carotene and β-carotene, in overexpression materials were higher than those in wild-type ( Figure 3 C, D, E and F). The zeaxanthin content in seeds of three independently transformed transgenic plants OE-15, OE-18 and OE-42 increased by an average of 1.55 times, lutein by an average of 3.04 times, α-carotene by an average of 3.01 times, and β-carotene by an average of 3.3 times compared with that of the recipient material B104 (Table 6).

[0088] Table 6 Determination of carotenoid content in mature seeds of overexpressed transgenic T1 receptor material B104

[0089]

[0090] The results of the study showed that the ZmCAAX gene in corn is an important functional gene responsible for regulating the content of carotenoids. Through a comprehensive study of map-based cloning technology and transgenic functional verification, it was found that this gene is closely related to the control of leaf color and carotenoid content. In addition, if the protein encoded by the ZmCAAX gene mutates, it will significantly reduce the level of carotenoids in corn, while its overexpression can effectively increase the content of carotenoids in corn seeds. Therefore, this study provides new gene resources for improving the quality traits of plants, especially corn.

[0091] The above is only an exemplary embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed by the present invention should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A protein, which is a protein as shown in any one of the following (A1)-(A3): (A1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing; (A2) the amino acid sequence shown in Sequence 1 in the sequence list is substituted and / or deleted and / or added with one or more amino acid residues, and a protein derived from Sequence 1 that is related to controlling the carotenoid content of corn seeds; (A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in (A1) or (A2).

2. A nucleic acid molecule encoding the protein ZmCAAX according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that The nucleic acid molecule is a DNA molecule as described in any one of (B1) to (B4): (B1) the DNA molecule shown in Sequence 2 in the sequence listing; (B2) the DNA molecule shown in Sequence 3 in the sequence listing; (B3) a DNA molecule that hybridizes with any of the DNA molecules defined in (B1) to (B2) under stringent conditions and encodes a protein derived from sequence 1 that is associated with controlling the carotenoid content of corn; (B4) The DNA sequence has more than 80% similarity with any specific sequence in (B1)-(B3), and these sequences encode proteins related to controlling the carotenoid content of corn, and these proteins are derived from sequence 1.

4. A recombinant vector, expression cassette, transgenic cell line or recombinant microorganism containing the nucleic acid molecule according to claim 2 or 3.

5. Use of the protein according to claim 1, or the nucleic acid molecule according to claim 2 or 3, in plant breeding and / or seed production or in regulating the content of carotenoids in plants.

6. The use of the nucleic acid molecule according to claim 5, characterized in that: The carotenoids include zeaxanthin, lutein, α-carotene and β-carotene.

7. A method for breeding transgenic plants, comprising the following steps: introducing the expression of the gene according to claim 2 or 3 into a recipient plant to obtain a transgenic plant with increased carotenoid content; the recipient plant may be a monocotyledonous plant or a dicotyledonous plant; more preferably, the recipient plant is corn.

8. A method for increasing the carotenoid content in corn seeds, comprising the following steps: increasing the activity and / or expression level of the protein according to claim 1 in the target plant to obtain a transgenic plant with increased carotenoid content.

9. Use of the protein according to claim 1, or the nucleic acid molecule according to claim 2 or 3, or the method according to any one of claims 6 to 8 in plant breeding.

Images