Biocontrol bacterium bacillus velezensis and application thereof in preparation of biocontrol inoculant for preventing and treating pepper phytophthora blight

Abstract

The invention belongs to the field of biological prevention and control of plant diseases, and particularly discloses a biocontrol bacterium bacillus velezensis and application thereof in preparation of a biocontrol inoculant for preventing and controlling pepper phytophthora blight, the strain is bacillus velezensis Y426-7, is preserved in China General Microbiological Culture Collection Center (CGMCC) on September 23, 2024, and has the preservation number of CGMCC NO.32041, and the preservation number is CGMCC NO.32041. The biocontrol bacterium is bacillus velezensis Y426-7. The bacillus velezensis is preserved in No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and can be used for preparing a biocontrol inoculant for preventing and treating pepper phytophthora blight. Compared with the prior art, the bacillus velezensis Y426-7 obtained by the invention has an obvious antibacterial effect on phytophthora capsici and various crop phytophthora blight bacteria under an indoor in-vitro condition; furthermore, the 2.5 * 10 < 9 > CFU / g wettable powder prepared from the bacillus velezensis Y426-7 has a relatively good prevention and treatment effect and a certain yield increasing effect on the pepper phytophthora blight in the field.

Description

Technical Field

[0001] The invention relates to biological control of plant diseases, in particular to a biological control bacterium Bacillus Velez and application of the biological control bacterium in preparing a biological control agent for controlling pepper blight. Background Art

[0002] chili( Capsicum annuum ) is an important economic crop, caused by Capsicum frutescens ( Phytophthora capsici ) is an important disease in pepper production.

[0003] At present, the control of pepper blight is still mainly based on chemical agents, which are relatively simple to operate, quick to take effect and low in cost. However, the use of chemical fungicides can easily lead to serious consequences such as increased resistance of pathogens, pesticide residues, and environmental pollution.

[0004] With the further development of scientific research, it is found that biocontrol microorganisms have unique advantages in overcoming the resistance of plant diseases, reducing the pollution of chemical fungicides to the environment, ecological damage and the residues of chemical pesticides in agricultural and sideline products. It is reported that some bacteria can produce active substances that inhibit the growth of plant pathogenic fungi during their growth, including lipopeptides, proteins, polysaccharides, etc. The biological pesticides prepared using the secondary metabolites of biocontrol bacteria have the characteristics of no pollution, no residue, not easy to make pests resistant, high compatibility with the environment, and safety for humans and animals. Therefore, vigorously carrying out research on biological control is an important way to achieve sustainable agricultural development and has important practical significance for production. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a biocontrol bacterium Bacillus Velezii and application thereof in preparing a biocontrol agent for preventing and controlling pepper blight.

[0006] To achieve the above object, the present invention is implemented according to the following technical solutions: One of the technical solutions of the present invention is a biocontrol bacterium Bacillus Velez, which is a strain of Bacillus Velez ( Bacillus velezensis )Y426-7, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on September 23, 2024, with the deposit number CGMCC NO.32041, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] The second technical solution of the present invention is the use of a biocontrol bacterium Bacillus Velezii in the preparation of a biocontrol agent for preventing and controlling pepper blight.

[0008] The third technical solution of the present invention is a biocontrol agent for preventing and treating pepper blight, comprising the above-mentioned biocontrol bacteria Bacillus Velezii.

[0009] Furthermore, the formulation of the biocontrol agent for preventing and controlling pepper blight is a wettable powder.

[0010] Preferably, the wettable powder is composed of the following components in percentage by mass: 87% of mother powder mixed with diatomaceous earth as a carrier and fermentation liquid of biocontrol bacteria Bacillus Velez, 4.8% of a wetting agent, 7.2% of a dispersant and 1% of a UV protectant.

[0011] Preferably, the mass ratio of the diatomaceous earth as a carrier to the fermentation broth of the biocontrol bacteria Bacillus Velez is 1:2.

[0012] Preferably, the wetting agent is sodium lignin sulfonate and the dispersant is NNO.

[0013] Preferably, the UV protectant is ascorbic acid.

[0014] Compared with the prior art, the Velez Bacillus Y426-7 obtained in the present invention is effective against Phytophthora capsici ( Phytophthora capsici ) and a variety of crop blight bacteria have obvious antibacterial effects; and then using 2.5×10 9 The wettable powder prepared from CFU / g Bacillus Velezii Y426-7 has a good prevention and control effect on pepper blight and a certain yield-increasing effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The biocontrol effects of some biocontrol bacteria on pepper fruit diseases.

[0016] Figure 2 The antibacterial effect of some biocontrol bacteria on different crop pathogens.

[0017] Figure 3 Morphological identification of Bacillus Velez Y426-7: A is the colony morphology; B is Gram staining; C is the bacterial morphology.

[0018] Figure 4 Molecular sequencing analysis of Bacillus velez Y426-7: A is the phylogenetic tree of strain Y426-7 constructed based on 16S rDNA sequence; B is the phylogenetic tree of strain Y426-7 constructed based on yrA Phylogenetic tree of strain Y426-7 constructed based on gene sequence; C is based on gvB Phylogenetic tree of strain Y426-7 constructed by gene sequencing.

[0019] Figure 5 This is a test of the extracellular enzyme production ability of Bacillus Velez Y426-7: A is amylase; B is chitinase; C is carboxymethyl cellulase; D is extracellular protease.

[0020] Figure 6This is a test of the growth-promoting ability of Bacillus Velez Y426-7: A is the phosphate solubilizing ability; B is the potassium solubilizing ability; C is the nitrogen fixation ability; D is the biofilm formation; E is the IAA production ability.

[0021] Figure 7 This is a stability test of antibacterial active substances in the fermentation broth of Bacillus velez Y426-7; A is different pH conditions; B is different temperature conditions; C is different illumination time; D is different ultraviolet irradiation time; E is different passage times.

[0022] Figure 8 The fermentation liquid of Bacillus velez Y426-7 against Phytophthora capsici ( Phytophthora capsici ) Effect of mycelial morphology: A is the control; B is the Y426-7 treatment.

[0023] Fig. 9 The fermentation liquid of Bacillus velez Y426-7 against Phytophthora capsici ( Phytophthora capsici ) Effect of sporangium formation. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0025] Example 1. Screening and identification of biocontrol bacteria Bacillus Velezii Y426-7 1. Capsicum frutescens ( Phytophthora capsici ) was used as the target bacteria, and a total of 230 biocontrol bacteria isolated from the soil and stored in the laboratory were screened for antibacterial activity using the plate stand method. The initial screening obtained 20 bacteria with an inhibition rate of more than 65% against pepper phytophthora, as shown in Table 1. Based on the initial screening test, a secondary screening was performed through in vitro inoculation of pepper, determination of antibacterial activity against various crop phytophthora, and determination of the antibacterial spectrum. Finally, a biocontrol bacterium Y426-7 with obvious biocontrol effect against pepper phytophthora was obtained, as shown in Tables 2 to 4. Figure 1 , 2 .

[0026] Table 1 Inhibitory effects of 20 biocontrol bacteria on pepper phytophthora

[0027] Table 2 Biocontrol effects of 20 strains of biocontrol bacteria on pepper fruit blight

[0028] Table 3 Inhibitory effects of 20 biocontrol bacteria on Phytophthora in different crops

[0029] Table 4 Determination of the antibacterial spectrum of biocontrol bacteria Y426-7 2. Strain Y426-7 was identified by combining morphological characteristics and cultural traits observation, physiological and biochemical index determination and multi-gene molecular sequencing analysis.

[0030] After strain Y426-7 was inoculated on NA solid medium and cultured at 28 °C for 24 h, the colonies were irregularly round in shape, milky white in color, opaque, rough and wrinkled, with oval spores. Under electron microscope, the bacteria were rod-shaped and Gram-staining was positive, such as Figure 3 .

[0031] The physiological and biochemical characteristics of strain Y426-7 are as follows: methyl red, malonate utilization, oxidase physiological and biochemical tests are negative; catalase reaction and arginine dihydrolase reaction are positive; nitrate reduction reaction is positive; it can grow in medium containing 2%, 5%, 7%, and 10% NaCl; it produces indoleacetic acid; it is positive for starch hydrolysis; it is positive for gelatin liquefaction test; it cannot utilize citrate; it is positive for VP reaction; it does not produce fluorescent pigments, etc. As shown in Table 5.

[0032] Multi-gene molecular sequencing analysis, based on 16S rDNA, yrA and ikB The phylogenetic tree of strain Y426-7 was constructed, as Figure 4 The sequencing results of the PCR amplification products of 16S rDNA of strain Y426-7 are as follows:

[0033] Strain Y426-7 yrAThe sequencing results of the PCR amplification product of the gene are as follows: CGGCATGGCATGGAGCGTTATCGTATCCCGGGCGCTTCCGGATGTGCGTGACGGTCTGAAGCCGGTTCACAGACGGATTTTGTACGCAATGAATGATTTAGGCATGACCAGTGACAAACCATATAAAAAATCTGCCCGTATCGTCGGTGAAGTTATCGGTAAGTACCACCCGCACGGTGACTCAGCGGTTTACGAATCAATGGTCAGAATGGCGCAGGATTTTAACTACCGCTACATGCTTGTTGACGGACACGGCAACTTCGGTTCGGTTGACGGCGACTCAGCGGCCGCGATGCGTTACACAGAAGCGAGAATGTCAAAAATCGCAATGGAAATTCTGCGTGACATTACGAAAGACACGATTGACTATCAAGATAACTATGACGGTTCAGAAAGAGAACCTGCCGTCATGCCTTCGAGATTTCCGAATCTGCTCGTAAACGGAGCTGCCGGTATTGCGGTCGGAATGGCGACAAATATTCCTCCGCATCAGCTTGGGGAAGTCATTGAAGGCGTGCTTGCCGTAAGTGAGAATCCTGAGATTACAAACCAGGAGCTGATGGAATACATCCCGGGCCCGGATTTTCCGACTGCAGGTCAGATTTTGGGCCGGAGCGGCATCCGCAAGGCATATGAATCCGGACGGGGATCAATCACAATCCGGGCTAAGGCTGAAATCGAAGAGACATCATCGGGAAAAGAAAGAATTATTGTCACAGAACTTCCTTATCAGGTGAACAAAGCGAGATTAATTGAAAAAATCGCAGATCTTGTCCGGGACAAAAAAATCGAAGGAATTACCGATCTGCGTGACGAATCCGACCGTAACGGAATGAGAATCGTCATTGAGATCCGCCGTGACGCCAATGCTCACGTCATTTTGAATAACCTTTACAAACAAACGGCCCTGCAGACGTCTTTCGGAATCAACCTGCTGGCGCTCGTGACGGACAGCCGAAAC。

[0034] Strain Y426-7 ikB

[0035] In summary, combined with morphological observation, physiological and biochemical index determination and molecular sequencing analysis, strain Y426-7 was finally identified as a strain of Bacillus velezinsis ( Bacillus velezensis ), deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on September 23, 2024, with the deposit number CGMCC NO.32041, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0036] Table 5 Physiological and biochemical characteristics of Y426-7 Note: “+” indicates a positive reaction or the cell can grow and be used; “-” indicates a negative reaction or the cell cannot grow and be used.

[0037] Example 2: Optimization of shake flask fermentation conditions of Y426-7 and preparation of wettable powder The shake flask fermentation conditions of Bacillus velez Y426-7 were optimized by single factor experiment combined with response surface methodology. The optimal fermentation medium formula was determined as follows: soluble starch 2.5%, tryptone 1.5%, NaCl 1%; the best shake flask culture conditions were as follows: bottling volume 125 mL / 250 mL, 5% inoculum, pH 6.5, 30℃, 180 r / min for 72 h. After optimization, the number of viable bacteria reached 3.88×10 9 CFU / mL increased by 7.92 times compared with before optimization.

[0038] The dosage form of the biocontrol agent for preventing and controlling pepper blight in this embodiment is a wettable powder. Therefore, the suspension rate, moisture content, wetting time, etc. are used as evaluation indicators to screen the carrier, wetting agent, dispersant, stabilizer, ultraviolet protective agent and their compound ratio to create a wettable powder of Bacillus Velez Y426-7. The specific configuration method adopts the conventional method in the field, which will not be repeated in this embodiment. The optimal formula of the wettable powder of Bacillus Velez Y426-7 is finally determined to be: diatomaceous earth as the carrier and the mother powder (87%) mixed with the fermentation liquid (Bacillus Velez Y426-7 fermentation liquid: diatomaceous earth 2:1), the wetting agent and dispersant are sodium lignin sulfonate and NNO respectively, the optimal ratio of the two is 4:6, the optimal dosage is 12%, the ultraviolet protective agent is ascorbic acid (1%), and the final measured number of viable bacteria is 2.5×10 9 CFU / g, suspension rate 85%, pH 7.4, wetting time 14.7 s, fineness 92%, spore survival rates after storage for 180 d at 4℃ and 25℃ were 88.45% and 80.37%, respectively. The quality test results met the national standards.

[0039] Furthermore, the antibacterial mechanism of Bacillus velez Y426-7 was studied. Y426-7 strain can produce amylase, carboxymethyl cellulase and extracellular protease, but not chitinase. Figure 5 ; It has the ability to dissolve phosphorus, fix nitrogen, and produce biofilm, and the ratio (D / d) of the phosphorus dissolving circle diameter (D) to the colony diameter (d) is 1.375. It does not have the ability to dissolve potassium and produce IAA. Figure 6 . Stable to temperature, pH, light, UV and other conditions, see Figure 7 Its fermentation liquid has a good inhibitory effect on pepper phytophthora. After being treated with the fermentation liquid, the mycelial growth is significantly inhibited, as shown in Tables 6 to 8. Compared with the control mycelial, the mycelial morphology has more abnormal branching, which destroys the polar growth of mycelial. On the other hand, it will cause partial dissolution of mycelial, as shown in Tables 6 to 8. Figure 8 , and the inhibitory effect on the formation of zoosporangium of pepper Phytophthora increased gradually with the increase of fermentation liquid concentration. Fig. 9 .

[0040] Table 6 Effects of Bacillus velez Y426-7 biocontrol liquid on the mycelial growth rate of pepper phytophthora

[0041] Table 7 Effect of sterile fermentation broth of Bacillus velez Y426-7 on the mycelial growth rate of Phytophthora capsici Table 8 Effect of Bacillus Velez Y426-7 on the mycelial weight of Phytophthora capsici

[0042] Example 3: Evaluation of the field control effect of Bacillus Velez Y426-7 wettable powder on pepper blight Rated 2.5×10 9 CFU / g Velez Bacillus Y426-7 wettable powder against pepper blight. Different treatments were set up in the field, including root irrigation, foliar spray, and root irrigation + foliar spray. The samples were taken for control efficacy determination at 14 days, 21 days, and 28 days after the last application of the pesticide. The results showed that 2.5×10 9 CFU / g Low concentration root irrigation treatment, high concentration spray treatment and low concentration root irrigation and spray treatment of Bacillus Velezii Y426-7 wettable powder had good control effects on pepper blight, with a lasting period of more than 3 weeks and a significant yield-increasing effect, as shown in Tables 9 and 10.

[0043] Table 9 The control effect of Bacillus Velez Y426-7 wettable powder on pepper blight Table 10 Effect of Bacillus Velez Y426-7 wettable powder on pepper yield

[0044] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A biocontrol bacterium Bacillus Velez, characterized in that: This strain is Bacillus Velez Bacillus velezensis )Y426-7, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on September 23, 2024, with the deposit number CGMCC NO.32041, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. Use of the biocontrol bacterium Bacillus Velezii as claimed in claim 1 in the preparation of a biocontrol agent for preventing and controlling pepper blight.

3. A biocontrol agent for preventing and treating pepper blight, characterized in that: The method comprises the biocontrol bacterium Bacillus Velezii as claimed in claim 1.

4. The biocontrol agent for preventing and controlling pepper blight according to claim 3, characterized in that: Its dosage form is wettable powder.

5. The biocontrol agent for preventing and controlling pepper blight according to claim 4, characterized in that: The wettable powder is composed of the following components in percentage by mass: 87% of mother powder mixed with fermentation liquid of biocontrol bacteria Bacillus Velezii using diatomaceous earth as a carrier, 4.8% of a wetting agent, 7.2% of a dispersant and 1% of an ultraviolet protective agent.

6. The biocontrol agent for preventing and controlling pepper blight according to claim 5, characterized in that: The mass ratio of the diatomaceous earth as a carrier to the fermentation liquid of the biocontrol bacteria Bacillus Velez is 1:

2.

7. The biocontrol agent for preventing and controlling pepper blight according to claim 5, characterized in that: The wetting agent is sodium lignin sulfonate and the dispersant is NNO.

8. The biocontrol agent for preventing and controlling pepper blight according to claim 5, characterized in that: The ultraviolet protection agent is ascorbic acid.

Images