Alginate lyase mutant and application thereof

Abstract

The invention relates to the technical field of genetic engineering and protein engineering modification, in particular to an alginate lyase mutant and application thereof. Compared with a wild type, after the A17S single-point mutant provided by the invention is treated at 45 DEG C for 20 minutes, the enzyme activity residual rate is increased by 55.3%, the effect is remarkable, the A17S single-point mutant can be widely applied to the field of seaweed processing, the enzymolysis efficiency of sargassum, ascophyllum nodosum and other seaweeds is effectively improved, and the market prospect is wide.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and protein engineering transformation, and specifically relates to an alginate lyase mutant and application thereof. Background Art

[0002] Brown algae is mainly composed of alginate, laminarin, mannitol and fucoidan sulfate. Among them, alginate is an anionic polysaccharide derived from the cell wall of brown algae. It is the main structural component of brown algae and is also called sodium alginate or sodium alginate. The first thing to do when using brown algae is to solve the problem of using alginate.

[0003] The main degradation methods of alginate are: (1) Chemical degradation. Acid, hydrothermal or alkaline pretreatment has been used for the hydrolysis of alginate. Acid hydrolysis is more commonly used in chemical degradation, but alginate is relatively acid-resistant and it is difficult to control the production of uronic acid. In addition, high concentrations of acid are required to obtain high yields of uronic acid. (2) Water preheating. Hydrothermal treatment (180°C-240°C) of alginate can produce alginate monomers (mannuronate and guluronate), as well as substances such as lactic acid and glycolic acid. (3) Enzymatic degradation. Enzymatic degradation of alginate has mild conditions, controllable processes, high yields, is green and safe, environmentally friendly, has a clear mechanism of action, and has determined products. Enzyme preparations with different substrate specificities can be selected alone or in combination according to the specific requirements of the target product. Endo-type alginate lyases produce alginate oligosaccharides with different DPs, while exo-type enzymes degrade alginate or alginate oligosaccharides to produce monosaccharides.

[0004] The production of alginate lyase mostly relies on alginate decomposing bacteria. Although wild-type alginate decomposing bacteria can effectively obtain quantitative enzyme protein, the yield is very low and the cost is high, which is difficult to meet the requirements of practical application. Therefore, heterologous expression of alginate lyase gene by genetic engineering is the most effective way to increase the yield of alginate lyase. The research mainly focuses on the cloning of alginate lyase genes of alginate decomposing bacteria and overexpression in Bacillus subtilis. At present, alginate lyase genes of more than 20 alginate decomposing bacteria have been cloned, and most of them have been successfully heterologously expressed. The expression level of recombinant alginate lyase is higher than that of wild strains. According to the classification of CAZY database, alginate lyase belongs to polysaccharide degrading enzyme (PL), and is specifically divided into seven families: PL5, PL6, PL7, PL14, PL15, PL17, and PL18.

[0005] In recent years, with the widespread application of protein engineering technology in the field of enzyme preparations, the development of new alginate lyases with high enzyme activity and excellent properties has become a research hotspot in this field, which is of great significance for reducing the production cost of alginate lyase and promoting the industrialization of alginate lyase. Summary of the invention

[0006] The purpose of the present invention is to provide a mutant of alginate lyase and its application. The stability of the mutant is significantly improved compared with the wild type, which is conducive to its wide application in industrial fields such as seaweed processing.

[0007] One aspect of the present invention relates to an alginate lyase mutant, wherein the 17th amino acid of the alginate lyase with the amino acid sequence of SEQ ID NO: 1 is changed from Ala to Ser.

[0008] The present invention also relates to a DNA molecule encoding the alginate lyase mutant.

[0009] The present invention also relates to a recombinant expression plasmid comprising the above DNA molecule.

[0010] The present invention also relates to a host cell comprising the above recombinant expression plasmid.

[0011] When the above plasmid is transferred into host cells, the stability of the recombinantly expressed alginate lyase mutant is significantly improved.

[0012] In some embodiments of the present invention, the host cell is Bacillus subtilis ( Bacillus subtilis ).

[0013] Compared with the wild-type alginate lyase AH1, the A17S single-point mutant provided by the present invention has an enzyme activity residual rate of 55.3% and as high as 82.5% after being treated at 45°C for 20 minutes, achieving an unexpected technical effect. The mutant can be widely used in the field of seaweed processing, effectively improving the enzymatic hydrolysis efficiency of seaweeds such as Sargassum and Ascophyllum nodosum, and has broad market prospects. DETAILED DESCRIPTION

[0014] The method of the present invention is further described below with reference to examples. The experimental methods for which specific conditions are not indicated in the embodiments can usually be operated under conventional conditions, such as the conditions described in the Molecular Cloning Experiment Guide compiled by J. Sambrook et al., or under the conditions recommended by the manufacturer. Those skilled in the art can better understand and grasp the present invention with the help of the embodiments. However, the method for implementing the present invention should not be limited to the specific method steps recorded in the embodiments of the present invention.

[0015] The method for determining the enzymatic activity of alginate lyase in the embodiment of the present invention is as follows: Principle of enzyme activity assay: Alginate lyase can cut the glycosidic bond in the alginate molecule through β-elimination reaction, producing an unsaturated double bond at the non-reducing end. The double bond is located between C4 and C5 at the non-reducing end of the product and produces maximum ultraviolet absorption at 235nm.

[0016] (1) Definition of enzyme activity unit: At 40°C, pH 7.0, and in the reaction system specified in this method, the substrate sodium alginate is degraded to produce unsaturated double bonds per minute, and each increase of 0.1 in absorbance at 235 nm is 1 enzyme activity unit U.

[0017] (2) Determination method Dilute with buffer to an appropriate multiple and control the absorbance value OD 235 = between 0.22-0.35, and the enzyme activity is about 0.5 U / mL.

[0018] Enzyme reaction: Take three 15mm*150mm test tubes, add 1.8mL substrate, preheat in a 40℃ water bath for 5min, add 0.2mL diluted enzyme solution, accurately time, vortex, keep warm at 40℃ for 10min, take the test tubes out of the water bath and immediately add 2mL phosphoric acid stop solution, vortex, and place the test tubes on a test tube rack outside the water bath.

[0019] Blank: Take a 15mm*150mm test tube, add 1.8mL of substrate, preheat in a 40℃ water bath for 5min, add 0.2ml of buffer, accurately time, vortex and shake, keep warm at 40℃ for 10min, take the test tube out of the water bath and immediately add 2mL of phosphoric acid stop solution, vortex and shake, and place the test tube on a test tube rack outside the water bath.

[0020] The present invention is described in detail below in conjunction with specific implementation modes.

[0021] Example 1 Screening of alginate lyase mutants The amino acid sequence of the wild-type alginate lyase AH1 is SEQ ID NO: 1, and the encoding nucleotide sequence is SEQ ID NO: 2.

[0022] In order to further improve the stability of alginate lyase AH1, the applicant analyzed its protein structure. The protein is a PL7 family alginate lyase, and its structure is a β-jelly roll structure. The protein surface and the active center of the protein are exposed to the external environment, so it is believed that changes in the external environment can directly affect the stability of the active center of the enzyme. The applicant further mutated the gene without destroying the secondary structure and active center of the protein.

[0023] Primer AH1-ss-F: CGG GGTACC ATGGATCCGAATCTGGAGATTT (SEQ ID NO:3); Primer AH1-ss-R:CG ACGCGT TTAATCATGTGTATGTTCCAGGC (SEQ ID NO: 4).

[0024] AH1 gene was used as template, and PCR amplification was performed using the above primers and GeneMorph II random mutation PCR kit (Bomais). The PCR product was recovered by gel, and double digested with KpnI and MluI, and connected with the expression plasmid pSZX101 after the same digestion, and transformed into Escherichia coli DH5α, coated with LB+Amp plate, and inverted cultured at 37°C. After the transformants appeared, the plasmid was extracted and transformed into Bacillus subtilis. After the transformants grew out, they were picked one by one with a toothpick to a 48-well plate, 20ug / ml kanamycin was added to each well, and cultured at 37°C and 500rpm for about 48h, and the supernatant was centrifuged for high-throughput determination, and incubated at 45°C for 20 minutes, and the alginate lyase activity was determined respectively, and the residual activity rate of different mutants was calculated.

[0025] The experimental results show that different mutants maintain different stabilities. Some mutations still have high enzyme activity under the same temperature treatment conditions, and some mutations even make it more tolerant; in addition, some mutations have significant changes in enzymatic properties after mutation, which do not meet the requirements. In the end, the applicant screened and obtained mutation sites that can significantly improve the stability of alginate lyase without significantly affecting its original enzymatic properties, namely: A17S.

[0026] Based on the alginate lyase truncated form AH1, the present invention provides a mutant comprising a single mutation site A17S. Referring to the amino acid sequence of the mutant, the encoding nucleotide sequence of the alginate lyase mutant is obtained respectively.

[0027] Example 2 Expression of alginate lyase mutants in Bacillus subtilis According to the codon preference of Bacillus, the gene sequences of alginate lyase AH1 and its mutants were optimized and synthesized, and two restriction sites, KpnI and MluI, were added to the 5' and 3' ends of the synthetic sequence, respectively.

[0028] 2.1 Vector construction The synthesized alginate lyase gene fragment was obtained by PCR, and the obtained gene fragment and the expression plasmid pSZX101 were double-digested with KpnI and MluI respectively, and the target fragment was recovered by gel recovery and ligated with T4 ligase overnight. The ligation product was transformed into Escherichia coli DH5α competent cells, spread on LB+Amp plates, and single colonies grew after culturing at 37°C overnight. The transformants with correct ligation were verified by colony PCR, and the plasmids were extracted and sent to Beijing BGI Research Center for sequencing analysis.

[0029] Plasmids were purified from E. coli clones with correct sequencing results using a plasmid midi-prep kit (Axygen).

[0030] 2.2 Preparation and transformation of competent Bacillus subtilis The transformation solution was prepared as follows: 1× minimum salt solution: K2HPO4 7g, KH2PO4 3g, (NH4)2SO4 1g, trisodium citrate Na2C6H5O7·2H2O 0.5g, MgSO4·7H2O 0.1g, add water to 500 mL.

[0031] GMⅠ solution: 95.6 mL of 1× minimum salt solution, 2.5 mL of 20% glucose, 0.4 mL of 5% hydrolyzed casein, and 1 mL of 10% yeast powder juice.

[0032] GMⅡ solution: 96.98 mL of 1× minimum salt solution, 2.5 mL of 20% glucose, 0.08 mL of 5% hydrolyzed casein, 0.04 mL of 10% yeast powder juice, 0.25 mL of 1M MgCl2, and 0.05 mL of 1M CaCl2.

[0033] Transformation operation method: Inoculate the bacteria on the LB plate and culture at 37℃ overnight. Use an inoculation loop to inoculate a loop of bacterial moss in 5mL GMⅠ solution, and culture it overnight at 30℃ slow shaker (125rpm). The next day, take 2 mL and transfer it to 18 mL GMⅠ, and culture it at 37℃ fast shaker (220rpm) for 3.5h. Take 5 mL of the culture solution in the previous step and transfer it to 45 mL GMⅡ. After 90min of culture at 37℃ slow shaker (125rpm), centrifuge at 8000g for 10min to collect the bacteria. Gently suspend the bacteria with 5 mL of the original culture supernatant. The suspended bacteria are competent cells and can be used for transformation. Storage of competent cells: Add 30% sterilized glycerol to a final concentration of 10%, mix well and dispense into centrifuge tubes, and then store them at -70℃.

[0034] Mix 1 μg of recombinant plasmid with 200 μL of the competent cells, shake (200 rpm) at 37°C for 30 minutes, then spread on the corresponding resistance medium and culture at 37°C overnight. The single colony grown overnight is the engineered strain containing alginate lyase and mutants.

[0035] Example 3 Fermentation Verification and Stability Analysis The engineered strain is inoculated into 5 mL LB (0.5% yeast extract, 1% tryptone, 1% sodium chloride) medium, cultured at 37°C and 220 rpm for about 6-8 hours, transferred to 50 mL liquid fermentation medium (0.5% yeast extract, 0.5% tryptone, 1% glucose, 1.8% K2HPO4), fermented in a shake flask at 37°C and 220 rpm for 72 hours, and then centrifuged at 5000g for 10 minutes to collect the supernatant, thereby obtaining a fermentation supernatant containing alginate lyase and its mutants.

[0036] The fermentation supernatant of the Bacillus subtilis engineered bacteria expressing the recombinant alginate lyase AH1 and its mutants constructed above was incubated at 45°C for 20 minutes, and the alginate lyase activity was detected. The initial enzyme activity was taken as 100%, and the residual enzyme activity rate was calculated. The results are shown in Table 1.

[0037] Residual enzyme activity rate: refers to the catalytic ability of the enzyme after being treated under specific conditions, usually expressed as a percentage. Generally speaking, the higher the residual enzyme activity rate, the more stable the enzyme.

[0038] Calculation formula: Residual enzyme activity (%) = enzyme activity after treatment / initial enzyme activity × 100%.

[0039] Table 1 Residual enzyme activity of alginate lyase and its mutants Alginate lyase Residual enzyme activity Wild-type AH1 27.2% A17S single point mutant 82.5% It can be seen from the data in Table 1 that compared with the wild-type alginate lyase AH1, the A17S single-point mutant provided by the present invention has an enzyme activity residual rate increased by 55.3% after being treated at 45°C for 20 minutes, and the stability is significantly improved, achieving unexpected technical effects.

[0040] In summary, the stability of the alginate lyase mutant provided by the present invention is significantly improved, and can be widely used in the field of seaweed processing, effectively improving the enzymatic hydrolysis efficiency of seaweeds such as Sargassum and Ascophyllum nodosum, and has broad market prospects.

Claims

1. An alginate lyase mutant, characterized in that: The mutant is an alginate lyase with an amino acid sequence of SEQ ID NO: 1, in which the 17th amino acid is mutated from Ala to Ser.

2. A DNA molecule encoding the alginate lyase mutant according to claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3.

5. The host cell according to claim 4, characterized in that The host cell is Bacillus subtilis ( Bacillus subtilis ).