A crRNA and application thereof in detection of molecular characteristics of gene edited pigs

By designing a fluorescence detection technology that combines crRNA genome and Cas12a protein with single-stranded DNA probes, the problem of rapid and accurate detection of AE26-CAAS gene-edited disease-resistant pigs was solved, enabling rapid identification and genotyping of pigs, which is suitable for the supervision and management of gene-edited pigs.

CN119614568BActive Publication Date: 2025-12-26INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411808469.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-10
Publication Date
2025-12-26
Estimated Expiration
2044-12-10

AI Technical Summary

Technical Problem

How to quickly and accurately detect AE26-CAAS gene-edited disease-resistant pigs to monitor and manage their resistance to porcine transmissible gastroenteritis virus.

Method used

A crRNA group, including crRNA1 and crRNA2, was designed to bind to specific target nucleotide sequences. Through a combination of Cas12a protein and single-stranded DNA probes, it is used to specifically amplify the target. Combined with fluorescence detection technology, it enables rapid identification or assisted identification of AE26-CAAS gene-edited pigs.

Benefits of technology

It enables rapid, sensitive, and specific detection of AE26-CAAS gene-edited pigs, is suitable for on-site testing, and can identify the presence of genotype and gene-edited sequence in a simple and easy manner.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a crRNA and application thereof in detection of molecular characteristics of gene edited pigs. The first aspect of the application provides a crRNA group, which comprises crRNA1; the nucleotide sequence of the crRNA1 is SEQ ID NO. 1; the crRNA group further comprises crRNA2; and the nucleotide sequence of the crRNA2 is SEQ ID NO. 2. The crRNA group provided by the application can be used for detecting AE26-CAAS gene edited pigs or nucleic acids thereof, and the detection method has high sensitivity, strong specificity, is simple and easy to operate, and is convenient for on-site rapid detection.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and relates to a crRNA and application of the crRNA in detection of molecular characteristics of gene edited pigs. BACKGROUND

[0002] The APN protein of a pig is a key receptor for entry of a transmissible gastroenteritis virus (TGEV) into a cell. Knockout or directional gene editing of a pAPN gene can make the pig completely resistant to the TGEV.

[0003] At present, a plurality of teams at home and abroad have successfully prepared pAPN gene edited pigs, and a challenge test proves that pAPN gene editing can completely resist TGEV infection. At present, AE26-CAAS gene edited pigs are obtained through gene editing technology, the pAPN gene of the pigs is genetically modified, a 26 bp base deletion occurs in the second exon, the pAPN gene is prematurely terminated during translation, and a functional APN protein cannot be generated, so that resistance to the transmissible gastroenteritis TGEV virus of the pig is realized.

[0004] Nucleic acid detection of a gene edited animal is a prerequisite for supervision and management of the gene edited animal and products thereof, and therefore, a method for accurately detecting the gene edited animal needs to be researched. SUMMARY

[0005] The technical problem solved by the application is how to quickly and accurately detect AE26-CAAS gene edited disease resistant pigs.

[0006] To solve the above technical problem, the first aspect of the application provides a crRNA group, which comprises crRNA1,

[0007] The nucleotide sequence of the target point to which the crRNA1 is combined is SEQ ID NO. 3.

[0008] The crRNA group targets the pAPN gene.

[0009] The crRNA1 is obtained by in vitro transcription of a transcription template 1.

[0010] The transcription template 1 is a product obtained by annealing of a single-stranded DNA molecule shown in SEQ ID NO. 5 and a single-stranded DNA molecule shown in SEQ ID NO. 7.

[0011] In the crRNA group, the nucleotide sequence of the crRNA1 is SEQ ID NO. 1.

[0012] In the crRNA group, the crRNA group further comprises crRNA2,

[0013] The nucleotide sequence of the target point bound by the crRNA2 is SEQ ID NO. 4.

[0014] In the crRNA group, the crRNA2 is obtained by in vitro transcription of a transcription template 2.

[0015] The transcription template 2 is a product obtained by annealing a single-stranded DNA molecule shown in SEQ ID NO. 6 and a single-stranded DNA molecule shown in SEQ ID NO. 8.

[0016] In the crRNA group, the nucleotide sequence of the crRNA2 is SEQ ID NO. 2.

[0017] In a second aspect, the present application provides a product comprising the crRNA1, the Cas12a protein, the primer pair for specifically amplifying each binding target point and the single-stranded DNA probe as described in the first aspect.

[0018] Alternatively, the product comprises the crRNA1 and the crRNA2, the Cas12a protein, the primer pair for specifically amplifying each binding target point and the single-stranded DNA probe as described in the first aspect.

[0019] And / or, the single-stranded DNA probe is labeled with different groups at both ends.

[0020] And / or, the groups are fluorescent groups, quenching groups and / or biotin.

[0021] In the above product, the primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO. 9 and a single-stranded DNA molecule shown in SEQ ID NO. 10.

[0022] The above product is a kit, a test strip or a fluorescence detection system.

[0023] The single-stranded DNA probe is a single-stranded DNA with AT base rich and a length of 10-50 nt.

[0024] The single-stranded DNA probe can be specifically as follows:

[0025] The single-stranded DNA probe for fluorescence detection is labeled with fluorescent groups and quenching groups at both ends.

[0026] The single-stranded DNA probe for test strip detection is labeled with fluorescent groups and biotin at both ends.

[0027] The product has any of the following functions:

[0028] B1) identifying or assisting in identifying AE26-CAAS gene edited pigs;

[0029] B2) identifying or assisting in identifying whether a test sample contains the AE26-CAAS gene editing sequence;

[0030] B3) identifying or assisting in identifying the genotype of the AE26-CAAS gene edited pig.

[0031] In a third aspect, the present application provides any of the following:

[0032] A1) the Cas12a protein and the crRNA described in the second aspect, or a complex formed by the two;

[0033] A2) the Cas12a protein, the crRNA1 and the crRNA2 described in the second aspect, or a complex formed by each with the Cas12a protein;

[0034] A2) the primer pair described in the second aspect.

[0035] In a fourth aspect, the present application provides the use of the crRNA group described in the first aspect, the product described in the second aspect in any of the following:

[0036] B1) identifying or assisting in identifying the AE26-CAAS gene edited pig;

[0037] B2) identifying or assisting in identifying whether a test sample contains the AE26-CAAS gene editing sequence;

[0038] B3) identifying or assisting in identifying the genotype of the AE26-CAAS gene edited pig.

[0039] B4) preparing a product for identifying or assisting in identifying the AE26-CAAS gene edited pig;

[0040] B5) preparing a product for identifying or assisting in identifying whether a test sample contains the AE26-CAAS gene editing sequence;

[0041] B6) preparing a product for identifying or assisting in identifying the genotype of the AE26-CAAS gene edited pig.

[0042] In a fifth aspect, the present application provides a method for identifying or assisting in identifying the AE26-CAAS gene edited pig, comprising the following steps:

[0043] C1) using the nucleic acid of the test sample as a template, performing RPA amplification with the primer pair described in the second aspect to obtain an RPA amplification product;

[0044] C2) preparing a CRISPR-Cas12a detection system containing the following components: the PCR product, the Cas12a protein described in the second aspect, the crRNA1 in the crRNA described in the second aspect, and the single-stranded DNA probe described in the second aspect;

[0045] C3) reacting the CRISPR-Cas12a detection system, detecting the reaction product, thereby identifying or assisting in identifying the AE26-CAAS gene edited pig;

[0046] The above detection reaction product, thereby identifying or assisting in identifying the AE26-CAAS gene edited pig as follows:

[0047] Each reaction product is detected by a fluorescence detector instrument such as a microplate reader, a fluorescence quantitative PCR instrument, etc.

[0048] If the fluorescence intensity of the reaction product of the detection system is significantly higher than that of the negative control system, the sample to be tested is derived from or candidate derived from the AE26-CAAS gene edited pig; if the fluorescence intensity of the reaction product of the detection system is not significantly higher than that of the negative control system, the sample to be tested is not derived from or candidate derived from the AE26-CAAS gene edited pig; the negative control system is different from the detection system only in that no crRNA1 is added.

[0049] In a sixth aspect, the present application provides a method for identifying or assisting in identifying the genotype of AE26-CAAS gene edited pig, comprising the following steps:

[0050] D1) using the nucleic acid of the sample to be tested as a template, RPA amplification is performed with the primer pair in the second aspect to obtain an RPA amplification product;

[0051] D2) preparing a CRISPR-Cas12a detection system 1 and a CRISPR-Cas12a detection system 2 containing the following components:

[0052] The CRISPR-Cas12a detection system 1 comprises the PCR product, the Cas12a protein in the second aspect, the crRNA1 in the crRNA in the second aspect, and the single-stranded DNA probe in the second aspect;

[0053] The CRISPR-Cas12a detection system 2 comprises the PCR product, the Cas12a protein in the second aspect, the crRNA2 in the crRNA in the second aspect, and the single-stranded DNA probe in the second aspect;

[0054] D3) reacting the CRISPR-Cas12a detection system 1 and the CRISPR-Cas12a detection system 2 respectively, detecting the reaction products of the two systems to identify or assist in identifying the genotype of the AE26-CAAS gene edited pig.

[0055] In the above, identifying or assisting in identifying AE26-CAAS gene-edited pig genotypes according to detecting the reaction products of the two systems can be detected by fluorescence detection instruments such as a microplate reader, a fluorescence quantitative PCR instrument, and the like, and the specific judgment is as follows:

[0056] If the fluorescence intensity of the reaction product of the detection system 1 is extremely significantly (P<0.01) higher than that of the negative control system, and the fluorescence intensity of the reaction product of the detection system 2 is not significantly (P>0.05) higher than that of the negative control system, then the sample to be tested is derived from or is a candidate for being derived from an AE26-CAAS gene-edited pig homozygote. P P

[0057] If the fluorescence intensity of the reaction product of the detection system 1 is extremely significantly (P<0.01) higher than that of the negative control system, and the fluorescence intensity of the reaction product of the detection system 2 is extremely significantly (P<0.01) higher than that of the negative control system, then the sample to be tested is derived from or is a candidate for being derived from an AE26-CAAS gene-edited pig heterozygote. P P

[0058] In the above, the sample to be tested is the ear or other tissues of a pig to be tested.

[0059] In the above, the method is not for the purpose of disease diagnosis and treatment.

[0060] The crRNA group provided by the present application can be used to detect AE26-CAAS gene-edited pigs or nucleic acids thereof, and the detection method has high sensitivity, strong specificity, is simple and easy to operate, and is convenient for on-site rapid detection. BRIEF DESCRIPTION OF DRAWINGS

[0061] Figure 1 Sequencing results of AE26-CAAS gene-edited pigs and pAPN gene wild type (WT) standard plasmids.

[0062] Figure 2 RPA primer amplification results.

[0063] Figure 3 crRNA activity detection results of the pAPN gene sequence targeting AE26-CAAS gene-edited pigs. ** indicates that there is an extremely significant difference (P<0.01) compared with the negative control group, and ns indicates that there is no significant difference (P>0.05) compared with the negative control group. P P

[0064] Figure 4 ​​​​​​The results of the crRNA activity detection for targeting WT pig pAPN gene sequence. ** indicates a very significant difference compared with the negative control group P <0.01), ns indicates no significant difference compared with the negative control group P > 0.05).

[0065] Figure 5 The results of the AE26 crRNA-F1 system for pig nucleic acid sample detection. ** indicates a very significant difference compared with the negative control group P <0.01), ns indicates no significant difference compared with the negative control group P > 0.05).

[0066] Figure 6 The results of the WT26 crRNA-F1 system for pig nucleic acid sample detection. ** indicates a very significant difference compared with the negative control group P <0.01), ns indicates no significant difference compared with the negative control group P > 0.05).

[0067] Figure 7 The results of the combined detection of pig nucleic acid sample using the AE26 crRNA-F1 system and the WT26 crRNA-F1 system. ** indicates a very significant difference compared with the negative control group P <0.01), ns indicates no significant difference compared with the negative control group P > 0.05). DETAILED DESCRIPTION

[0068] The application will be further described in conjunction with the specific embodiments, and the examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0069] The experimental methods in the following examples are all routine methods, unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0070] Unless otherwise specified, the quantitative tests in the following examples are all set up with three repeated experiments, and the results are averaged.

[0071] The application will be described in relation to specific examples which are intended to be illustrative only and not limiting of the application. Unless otherwise indicated, the examples are performed in accordance with conventional procedures, such as Sambrook et al. Molecular Cloning: a Laboratory Manual, 2001, or as suggested by the manufacturer's instructions.

[0072] The main reagents used in the following examples are as follows:

[0073] LbCas12a protein (EDE0005-2000) was purchased from Guangzhou Aidigen Biotechnology Co., Ltd.; 10x LbCas12a Cleavage Buffer (EDE0005-B) was purchased from Guangzhou Aidigen Biotechnology Co., Ltd.; Tissue DNA extraction kit (DP304-03) was purchased from Tiangen Biotech Co., Ltd.; EX Taq enzyme (RR001Q) was purchased from Takara Co., Ltd.; CloneSmarter TOPO cloning vector kit (C5865-50) was purchased from Zhejiang Aoke Biotechnology Co., Ltd.; E. coli DH5a competent cells (B528413-0100) were purchased from Sangon Biotech (Shanghai) Co., Ltd.; Primers were synthesized by Beijing Qikeland Biotech Co., Ltd.; T7 in vitro transcription kit (AM1354) was produced by Invitrogen Co., Ltd.; Single-stranded DNA fluorescent probe was synthesized by Sangon Biotech (Shanghai) Co., Ltd.; Cas12 / 13 special nucleic acid detection test strip (JY0301) was purchased from Beijing Libotaiye Technology Co., Ltd.; TWistAmp Basic kit (TABS03KIT) was purchased from Beijing Libotaiye Technology Co., Ltd.

[0074] The main instruments are as follows: PCR instrument (C1000 TouchTM, BIO-RAD); benchtop high-speed refrigerated centrifuge (Heraeus Multifuge X1R, Thermo); bacterial incubator (MIR-254, SANYO); vortex shaker (SA8, Stuart-equipment); electronic balance (Sartorius SQP, Sartorius Scientific Instrument Co., Ltd.); gel imaging system (BIO-RID, Universal Hood II); constant temperature water bath (HHS-21-4, Changzhou Nuoke Instrument Co., Ltd.); fluorescent quantitative PCR instrument (QuantStudioTM5, Thermo Scientific).

[0075] The AE26-CAAS gene edited pigs in the following examples were prepared as follows:

[0076] DKO pigs are mated with wild type Landrace pigs (from Tianjin Ninghe Original Pig Farm, hereinafter also referred to as pAPN gene wild type pigs (wild type, WT)), and offspring pigs are produced, genotyping is performed on the offspring pigs, and offspring pigs with only a 26 bp deletion in the pAPN gene are selected, i.e. AE26-CAAS pigs.

[0077] The method of the above genotyping is as follows:

[0078] Genomic DNA of the offspring pig's ear skin or tail skin tissue is extracted, and pAPN-PCR-F (5'-TACCCAGTTCAGTGACCTTCGTC-3') primer and pAPN-PCR-R (5'-TGCTCGGCATTCTTGTTCTTCT-3') are used for PCR amplification and gel electrophoresis detection.

[0079] Electrophoresis detection shows that samples with a single band of 260 bp are pAPN single gene editing on two homologous chromosomes and are 26 bp deletion genotypes, and are named AE26-CAAS gene editing pig homozygotes.

[0080] Electrophoresis detection shows that samples with two bands of 286 bp and 260 bp are pAPN single gene editing on one homologous chromosome and are 26 bp deletion genotypes, and the other is a wild type pAPN gene, and are named AE26-CAAS gene editing pig heterozygotes.

[0081] Electrophoresis detection shows that samples with a single band of 286 bp are wild type pAPN genes on two homologous chromosomes, and are named pAPN gene wild type pigs or wild type pigs.

[0082] The AE26-CAAS gene editing pig homozygote has only the second exon 82-107 (position 82-107 of the pAPN gene nucleotide sequence shown in genbank No. NM_214277) of the pAPN gene (genbank No. NM_214277, submission date 2024-6-2) deleted (26 bp bases) in the two homologous chromosomes, and other genes remain unchanged.

[0083] The AE26-CAAS gene edited pig hybrid has a deletion of only the second exon 82-107 (position 82-107 of the pAPN gene nucleotide sequence shown in genbank number: NM_214277) of the pAPN gene (genbank number: NM_214277, submission date: 2024-6-2) in one homologous chromosome (26bp bases) compared with the wild type pAPN gene pig, and the other homologous chromosome is the same as the wild type pAPN gene pig.

[0084] The above-mentioned DKO pig is a gene edited pig with the CD163 and pAPN genes knocked out, and the pAPN gene has two genotypes of 5bp deletion and 26bp deletion. After genetic modification of the pAPN gene, a 26 bp base deletion occurs in the second exon, so that the pAPN gene terminates translation prematurely and cannot generate functional APN protein, thereby achieving resistance to the transmissible gastroenteritis virus (TGEV) of swine.

[0085] The DKO pig is described in the following document, and the name in the document is double-gene-knockout (DKO) pigs. The document is Xu K, Zhou Y, Mu Y, Liu Z, Hou S, Xiong Y, Fang L, Ge C, Wei Y, Zhang X, Xu C, Che J, Fan Z, Xiang G, Guo J, Shang H, Li H, Xiao S, Li J, Li K. CD163 and pAPN double-knockout pigs are resistant to PRRSV and TGEV and exhibit decreased susceptibility to PDCoV while maintaining normal production performance. Elife. 2020 Sep 2;9:e57132. doi: 10.7554 / eLife.57132.

[0086] Example 1, design and implementation of RPA-CRISPR / Cas12a nucleic acid detection system for pAPN gene edited disease-resistant pigs

[0087] I. Obtaining crRNA

[0088] 1. Standard plasmid construction

[0089] The tissue DNA extraction kit was used to extract the DNA of the AE26-CAAS gene edited pig homozygote and the pAPN gene wild type pig (wild type, WT) pig ear tissue. The primers shown in Table 1 were used to amplify the sequences of the upper and lower target sites of the second exon of the pAPN gene, and the PCR products were obtained.

[0090] Table 1 is the primer for amplifying the pAPN gene

[0091]

[0092] The PCR reaction system is shown in Table 2:

[0093] Table 2 is the PCR reaction system

[0094]

[0095] The PCR reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 65℃ annealing for 30 s, 72℃ extension for 1 min, 36 cycles; 72℃ for 5 min.

[0096] The PCR product was gel recovered and purified, and the purified product was connected to the pClone-EZ-TOPO vector (C5865-50, Beijing, USA and Biotechnology Co., Ltd.), and the standard plasmid pClone-EZ-TOPO-AE26 of the gene edited pig pAPN gene and the standard plasmid pClone-EZ-TOPO-WT of the wild type pig pAPN gene were obtained after sequencing verification.

[0097] pClone-EZ-TOPO-AE26 is a vector obtained by replacing the AE26-CAAS gene editing sequence (SEQ ID NO. 11) between the TOPO I sites of the pClone-EZ-TOPO vector.

[0098] pClone-EZ-TOPO-WT is a vector obtained by replacing the wild type sequence (SEQ ID NO. 12) between the TOPO I sites of the pClone-EZ-TOPO vector.

[0099] The above gene editing sequence and the wild type sequence are sequences obtained by deleting the 487-512th position of the wild type sequence.

[0100] The sequencing results of the two plasmids are shown in Figure 1 , Figure 1 A is the sequencing result of the AE26-CAAS gene edited pig pAPN gene standard plasmid, Figure 1 B is the sequencing result of the wild type pig pAPN gene standard plasmid.

[0101] 2, crRNA target point design

[0102] According to the DNA sequence in the range of 40 bp upstream and downstream of the pAPN gene second exon targeting site of the pAPN gene of the AE26-CAAS gene edited pig and the wild type pig, a sequence meeting the recognition requirements of LbCas12a was searched, and three candidate target sites were screened according to the sequence GC content, sequence complementarity and other rules, wherein AE26crRNA-T1 to AE26crRNA-T2 were candidate target sites screened for the AE26-CAAS edited disease-resistant pig, and WTcrRNA-T1 was a candidate target site screened for the wild type pig (wild type, WT), as shown in Table 3.

[0103] Table 3 is the crRNA of the candidate target site

[0104]

[0105] 3. Preparation of specific crRNA in vitro transcription template

[0106] According to the sequence of the candidate target site, a T7 promoter sequence (TAATACGACTCACTATAGGG) (Chen J S et al. Science, 2018, 360(6387): 436-439.) and a crRNA repeat region template sequence (TAATTTCTACTAAGTGTAGAT) were added to form the specific crRNA in vitro transcription template positive strand DNA sequence (SEQ ID NO. 5-6) shown in Table 4. According to the complementary pairing of the positive strand DNA sequence, the negative strand DNA sequence (SEQ ID NO. 7-8) was formed.

[0107] Table 4 is the positive strand and negative strand of the specific crRNA in vitro transcription template

[0108]

[0109] The positive and negative strand DNA single strands were synthesized, and the specific crRNA in vitro transcription template was prepared by annealing. The annealing reaction system was prepared in a PCR tube as follows:

[0110] Table 5 is the annealing reaction system

[0111]

[0112] The PCR tube was placed in a PCR instrument, incubated at 95°C for 10 min, and then immediately turned off the PCR instrument, and the double strands were slowly cooled at room temperature for 90 min, and then placed on ice for 5 min. The product after annealing, i.e. the crRNA in vitro transcription template, can be used for crRNA in vitro transcription.

[0113] 4. In vitro transcription of specific crRNA

[0114] The transcription system was prepared in a PCR tube as shown in Table 6 using a T7 in vitro transcription kit (AM1354) produced by Invitrogen.

[0115] Table 6: In vitro transcription system of specific crRNA

[0116]

[0117] The transcription system was incubated overnight in a 37°C incubator. The crRNA was recovered using an RNA purification recovery kit produced by NEB.

[0118] The sequence of the recovered crRNA is shown in Table 7.

[0119] Table 7: Sequence of crRNA

[0120] Name Sequence (5'-3') Length AE26 crRNA-F1 (SEQ ID NO. 1) UAAUUUCUACUAAGUGUAGAUCAAGGCCCUGGGCGGCCGUG 41 bp AE26 crRNA-F2 UAAUUUCUACUAAGUGUAGAUUACAUUUCCAAGGCCCUGGGCGGC 45 bp WT26 crRNA-F1 (SEQ ID NO. 2) UAAUUUCUACUAAGUGUAGAUCAAGGCCCUGGGCAUCCUGG 41 bp

[0121] II. Design and screening of RPA primers

[0122] According to the sequence upstream and downstream of the targeting site of the second exon of the pig pAPN gene, RPA amplification primers were designed. The sequence of the candidate RPA primers is shown in Table 8.

[0123] Table 8: RPA amplification primers

[0124]

[0125] The RPA reaction system is shown in Table 9.

[0126] Table 9: RPA reaction system

[0127]

[0128] The RPA reaction conditions are as follows:

[0129] 37°C constant temperature reaction for 30 min.

[0130] The AE26-CAAS gene edited pig pAPN gene standard plasmid pClone-EZ-TOPO-AE26 with a concentration of 3.2 x 10 10 copies / μL was used as a template, and each primer pair (F and R) shown in Table 8, the system shown in Table 9, and the RPA reaction conditions were used for RPA amplification to obtain RPA amplification products.

[0131] The RPA amplification products of each primer pair were subjected to agarose gel electrophoresis, and the results are shown in Figure 2 It can be seen that the pAPN-RPA-4F / R amplification effect is good.

[0132] The primers pAPN-RPA-4F (SEQ ID NO. 9) and pAPN-RPA-4R (SEQ ID NO. 10) with better amplification effect were selected as the RPA amplification primers.

[0133] III. Establishment of RPA-CRISPR / Cas12a nucleic acid detection system and screening of crRNA

[0134] The DNA probe in Table 10 is a single-stranded DNA fluorescent probe labeled with 6-FAM and BHQ1 groups, and the sequence is 6-FAM-TTATT-BHQ1. The CRISPR / Cas12a fluorescence detection system was prepared according to the components shown in Table 10 below:

[0135] Table 10 is the CRISPR / Cas12a detection system

[0136]

[0137] The RPA products were obtained by RPA amplification using standard plasmids pClone-EZ-TOPO-AE26 and pClone-EZ-TOPO-WT as DNA templates, respectively. The AE26crRNA-F1, AE26crRNA-F2 and WT26crRNA-F1 detection systems were prepared according to the above system, 3 technical repeats were set for each detection system, and a negative control (NC) without crRNA was set. The prepared detection system was reacted at 37°C for 60 minutes in a Q5 quantitative PCR instrument, and the fluorescence intensity was detected every 30 seconds.

[0138] The results are shown in Figure 3 As shown in P <0.01) compared with the NC group, so AE26crRNA-F1 can specifically recognize AE26-CAAS sequence and can be used to distinguish AE26-CAAS and WT samples. AE26crRNA-F2 has cutting effect on AE26-CAAS sequence and WT sequence, and excites trans-cleavage activity, which produces fluorescence with extremely significant difference P <0.01) compared with the NC group, so AE26crRNA-F1 can specifically recognize AE26-CAAS sequence and can be used to distinguish AE26-CAAS and WT samples. AE26crRNA-F2 has cutting effect on AE26-CAAS sequence and WT sequence, and excites trans-cleavage activity, which produces fluorescence with extremely significant difference

[0139] Figure 4 WT26crRNA-F1 can specifically recognize WT sequence and has cutting effect, and excites trans-cleavage activity, which produces fluorescence with extremely significant difference PThe fluorescence of WT26crRNA-F1 is less than 0.01, and it cannot cleave the AE26-CAAS sequence. Therefore, WT26crRNA-F1 can specifically recognize the WT sequence and can be used to distinguish between AE26-CAAS and WT samples.

[0140] IV. Establishment of RPA-CRISPR / Cas12a Nucleic Acid Detection System Method

[0141] 1. RPA amplification

[0142] DNA was extracted from the sample to be tested and used as a template. RPA amplification was performed using pAPN-RPA-4F / pAPN-RPA-4R primers according to the system and RPA reaction conditions shown in Table 9 to obtain RPA amplification products.

[0143] 2. CRISPR / Cas12a detection

[0144] The RPA amplification products and AE26crRNA-F1 were prepared into a CRISPR / Cas12a detection system according to the system shown in Table 10 to obtain the AE26crRNA-F1 detection system.

[0145] The RPA amplification products and WT26crRNA-F1 were prepared into a CRISPR / Cas12a detection system according to the system shown in Table 10 to obtain the WT26crRNA-F1 detection system.

[0146] Each of the above detection systems was set up with three technical replicates, and a negative control (NC) without crRNA was also set up.

[0147] The prepared detection system was reacted at 37°C for 60 minutes in a Q5 quantitative PCR instrument.

[0148] 1) To identify or assist in identifying whether the sample to be tested contains the AE26-CAAS gene editing sequence, or to identify or assist in identifying whether the sample to be tested originates from AE26-CAAS gene-edited pigs;

[0149] After the above reactions were completed, the fluorescence intensity of the reaction products of each system was detected in real time using a Q5 quantitative PCR instrument.

[0150] If the fluorescence intensity of the reaction product in the AE26crRNA-F1 detection system is extremely significant ( P If the fluorescence intensity of the reaction product in the AE26crRNA-F1 reaction system is <0.01%, which is higher than that in the negative control system, then the test sample contains or is a candidate for containing the AE26-CAAS gene editing sequence (SEQ ID NO.11), or the test sample is derived from or is a candidate for derived from AE26-CAAS gene-edited pigs; if the fluorescence intensity of the reaction product in the AE26crRNA-F1 reaction system is not significant ( PIf the reaction product is greater than 0.05% in the negative control system, then the test sample does not contain or is not a candidate for containing the AE26-CAAS gene editing sequence, or the test sample is not derived from or is not a candidate for derived from AE26-CAAS gene-edited pigs.

[0151] The only difference between the above negative control system and the AE26crRNA-F2 detection system is that no crRNA is added.

[0152] The aforementioned AE26-CAAS gene-edited pigs are either homozygous or heterozygous AE26-CAAS gene-edited pigs.

[0153] 2) Identify the genotype of the sample to be tested;

[0154] After the above reactions were completed, the fluorescence intensity of the reaction products of each system was detected in real time using a Q5 quantitative PCR instrument.

[0155] If the AE26crRNA-F1 system test result is positive (the fluorescence intensity of the reaction product in the AE26crRNA-F1 detection system is extremely significant), P The fluorescence intensity of the reaction product in the WT26crRNA-F1 system was not significant (<0.01) compared to the negative control system, and the WT26crRNA-F1 system test result was negative (the fluorescence intensity of the reaction product in the WT26crRNA-F1 detection system was not significant). P If the reaction product is >0.05% higher than that of the negative control system, then the test sample is derived from or is a candidate for AE26-CAAS gene-edited homozygous pigs.

[0156] If the AE26crRNA-F1 system test result is positive (the fluorescence intensity of the reaction product in the AE26crRNA-F1 detection system is extremely significant), P The fluorescence intensity of the reaction product in the WT26crRNA-F1 system was significantly higher than that in the negative control system (<0.01), and the detection result of the WT26crRNA-F1 system was also positive (the fluorescence intensity of the reaction product in the WT26crRNA-F1 detection system was extremely significant). P If the reaction product is <0.01) higher than that of the negative control system, then the test sample is derived from or is a candidate derived from AE26-CAAS gene-edited heterozygous pigs.

[0157] The above-mentioned AE26-CAAS gene-edited pig RPA-CRISPR / Cas12 detection system includes: AE26crRNA-F1 and / or WT26crRNA-F1, pAPN-RPA-4F primer, pAPN-RPA-4R primer, LbCas12a protein, and single-stranded DNA probe.

[0158] Example 2, detection of pig nucleic acid samples by the AE26crRNA-F1 and WT26crRNA-F1 gene editing pig nucleic acid detection system

[0159] The AE26-CAAS gene editing pig RPA-Cas12a detection system provided in Example 1 was used to analyze wild-type pig nucleic acid samples (sample numbers: 1352, 1356, 1362), AE26-CAAS gene editing pig nucleic acid samples (homozygous samples: 1347, 1350, 1491; heterozygous samples: 1433, 1488, 1489) to verify whether the system can accurately identify AE26-CAAS gene editing pig nucleic acid samples.

[0160] The above nucleic acid samples were all genomic DNA extracted from the ear tissue of each pig.

[0161] The RPA amplification system was prepared according to the components in Table 9, and the prepared detection system was reacted at 37°C for 30 minutes in a thermostat.

[0162] A single-stranded DNA probe labeled with 6-FAM and BHQ1 was synthesized, and the sequence was 6-FAM-TTATT-BHQ1. The AE26crRNA-F1 and WT26crRNA-F1 detection systems were prepared according to the components shown in Table 10, and a negative control (NC) without crRNA was set up.

[0163] The prepared detection system was reacted at 37°C for 60 minutes in a Q5 quantitative PCR instrument, and the fluorescence intensity was detected every 30 seconds.

[0164] The analysis results are shown in Figure 5 and Figure 6 :

[0165] Figure 5 The RPA-Cas12a detection system with AE26crRNA-F1 as the crRNA detected the pAPN gene wild-type pig and AE26-CAAS gene editing pig nucleic acid samples, and the nucleic acid sample without AE26-CAAS gene editing sequence (pAPN gene wild-type pig) had no significant difference in fluorescence compared with the NC group ( P >0.05), showing a negative result. The nucleic acid sample containing the AE26-CAAS gene editing sequence (AE26-CAAS gene editing homozygous pig and heterozygous pig) produced fluorescence with a very significant difference ( P <0.01) compared with the NC group, showing a positive result.

[0166] Figure 6In the RPA-Cas12a detection system using WT26crRNA-F1 as crRNA, when detecting nucleic acid samples from wild-type pigs and AE26-CAAS gene-edited pigs, the nucleic acid samples (AE26-CAAS gene-edited homozygous pigs) without the wild-type pAPN gene sequence (SEQ ID NO.12) showed no significant difference in fluorescence production compared to the NC group. P >0.05), indicating a negative result. Nucleic acid samples containing the wild-type pAPN gene sequence (wild-type pigs with the pAPN gene and AE26-CAAS gene-edited heterozygous pigs) showed highly significant differences compared to the NC group. P A fluorescence intensity of <0.01 indicates a positive result.

[0167] By jointly analyzing the detection results of the RPA-Cas12a detection system using both AE26crRNA-F1 and WT26crRNA-F1 as crRNAs, the genotype of porcine nucleic acid samples can be accurately determined. For example... Figure 7 As shown, when the AE26crRNA-F1 system test result is positive and the WT26crRNA-F1 system test result is negative, it indicates that the nucleic acid sample contains only the AE26-CAAS genotype sequence, and is therefore an AE26-CAAS homozygous genotype sample; when the AE26crRNA-F1 system test result is positive and the WTcrRNA-F2 system test result is also positive, it indicates that the sample contains both the AE26-CAAS genotype and the pAPN wild-type gene sequence, and is therefore an AE26-CAAS heterozygous genotype sample; when the AE26crRNA-F1 system test result is negative and the WT26crRNA-F1 system test result is positive, it indicates that the nucleic acid sample contains only the pAPN wild-type gene sequence, and is a pAPN wild-type sample.

[0168] Therefore, by using the AE26crRNA-F1, WT26crRNA-F1 and other crRNAs and detection methods provided by this invention, the genotype of AE26-CAAS gene-edited pigs can be determined rapidly and with high specificity, and can be applied to multiple aspects such as the breeding, production and supervision of AE26-CAAS gene-edited pigs.

[0169] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a special example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the application. Some basic features can be applied within the scope of the following attached claims.

Claims

1.A method for identifying or assisting in identifying AE26-CAAS gene edited pigs, comprising the following steps: C1) using the nucleic acid of a sample to be tested as a template, performing RPA amplification with a primer pair to obtain an RPA amplification product; the primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO. 9 and a single-stranded DNA molecule shown in SEQ ID NO. 10; C2) preparing a CRISPR-Cas12a detection system containing the following components: the RPA amplification product, a Cas12a protein, a crRNA1 and a single-stranded DNA probe; the nucleotide sequence of the crRNA1 is SEQ ID NO. 1; the single-stranded DNA probe is labeled with different groups at both ends; the groups are fluorescent groups, quencher groups and / or biotin; the concentration of the Cas12a protein in the CRISPR-Cas12a detection system is 0.033 μM; the concentration of the crRNA1 in the CRISPR-Cas12a detection system is 8.33 μM; the concentration of the single-stranded DNA probe in the CRISPR-Cas12a detection system is 0.4 μM; C3) reacting the CRISPR-Cas12a detection system, detecting the reaction product, and thereby identifying or assisting in identifying AE26-CAAS gene edited pigs. 2.A method for identifying or assisting in identifying the genotype of AE26-CAAS gene edited pigs, comprising the following steps: D1) using the nucleic acid of a sample to be tested as a template, performing RPA amplification with a primer pair to obtain an RPA amplification product; the primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO. 9 and a single-stranded DNA molecule shown in SEQ ID NO. 10; D2) preparing a CRISPR-Cas12a detection system 1 and a CRISPR-Cas12a detection system 2 containing the following components: the CRISPR-Cas12a detection system 1 includes the RPA amplification product, a Cas12a protein, a crRNA1 and a single-stranded DNA probe; the nucleotide sequence of the crRNA1 is SEQ ID NO. 1; the single-stranded DNA probe is labeled with different groups at both ends; the groups are fluorescent groups, quencher groups and / or biotin; the concentration of the Cas12a protein in the CRISPR-Cas12a detection system 1 is 0.033 μM; the concentration of the crRNA1 in the CRISPR-Cas12a detection system 1 is 8.33 μM; the concentration of the single-stranded DNA probe in the CRISPR-Cas12a detection system 1 is 0.4 μM; the CRISPR-Cas12a detection system 2 includes the RPA amplification product, the Cas12a protein, a crRNA2 and the single-stranded DNA probe; the nucleotide sequence of the crRNA2 is SEQ ID NO. 2; the concentration of the Cas12a protein in the CRISPR-Cas12a detection system 2 is 0.033 μM; The concentration of the crRNA2 in the CRISPR-Cas12a detection system 2 is 8.33 μM; The concentration of the single-stranded DNA probe in the CRISPR-Cas12a detection system 2 is 0.4 μM; D3) Reacting the CRISPR-Cas12a detection system 1 and the CRISPR-Cas12a detection system 2 respectively, detecting the reaction products of the two systems to identify or assist in identifying the AE26-CAAS gene edited pig genotype.

Citation Information

Patent Citations

  • Crispr / cpf1 systems and methods

    CN110402287A

  • HEV specific crRNA based on CRISPR-Cas12a technology, detection kit and application of HEV specific crRNA

    CN113293165A

  • Disease-resistant and quality-improved pig breeding method capable of simultaneously knocking out CD163, pAPN and MSTN genes

    CN116855539A