Method for regulating and controlling transcriptional activity of PAFAH1B1 gene and application of method

Abstract

The invention provides a method for regulating and controlling the transcriptional activity of a PAFAH1B1 gene and application of the method, and belongs to the technical field of gene expression regulation and control. The method comprises the step of influencing the methylation level of a PAFAH1B1 gene promoter region by using a gRNA fragment, a DNA methyltransferase inhibitor or an RNA interference fragment of DNA methyltransferase. The method is applied to the ovarian granulosa cells, and under different treatments, the mRNA level and the protein expression level of PAFAH1B1 in the ovarian granulosa cells can be remarkably promoted or inhibited. According to the application, the obvious influence of DNA methylation on the transcriptional activity of the PAFAH1B1 gene in the ovarian granular cells is determined for the first time, the position of the DNA methylation applied to the promoter region of the PAFAH1B1 gene is determined for the first time, and the mechanism that the DNA methylation affects the expression of the PAFAH1B1 gene by changing the chromatin structure of the promoter region of the PAFAH1B1 gene is disclosed, so that the expression of the PAFAH1B1 gene in the ovarian granular cells is improved. The invention provides a simpler and more effective new way for regulating and controlling granular cell functions and ovarian development, and has important application value for subsequent research on mammal ovarian granular cell functions, follicular development and initial estrus initiation.

Description

Technical Field

[0001] The present invention relates to the technical field of gene expression regulation, and in particular to a method for regulating the transcription activity of PAFAH1B1 gene and an application thereof. Background Art

[0002] DNA methylation is an epigenetic mark that regulates gene expression without changing the nucleotide sequence of the gene by affecting chromatin structure and the way DNA interacts with proteins. Studies have shown that during the development of mouse follicles, ovarian granulosa cells continue to undergo large-scale DNA demethylation. The onset of puberty in mammals is also a period when DNA is highly sensitive to epigenetic changes. Lomniczi et al. found that when female rats before puberty were treated with an inhibitor of DNA methylase (5-Aza-CdR), 5-Aza-CdR treatment significantly delayed the onset of puberty in rats compared with the control group. In summary, DNA methylation may affect ovarian granulosa cell function and follicle development by regulating the expression of key genes in granulosa cells.

[0003] PAFAH1B1 (Platelet Activating Factor Acetylhydrolase 1b RegulatorySubunit 1) is a regulatory subunit of platelet activating factor acetylhydrolase 1B, which is involved in regulating various cell activities such as cell proliferation, apoptosis, and cycle.

[0004] At present, the mechanism of regulating PAFAH1B1 gene expression is still unclear, and there is no report on the association between PAFAH1B1 gene expression and methylation during granulosa cell and follicle development. This study intends to explore whether DNA methylation can affect PAFAH1B1 gene expression by changing the chromatin structure of the PAFAH1B1 promoter region. This will have important application value in the regulation mechanism of PAFAH1B1 gene in granulosa cells and the use of PAFAH1B1 gene to affect the initiation of mammalian puberty. Summary of the invention

[0005] In order to study the effect of DNA methylation on the transcriptional activity of PAFAH1B1 gene in granulosa cells, the first object of the present application is to provide a method for regulating the transcriptional activity of PAFAH1B1 gene.

[0006] The second object of the present application is to provide application of the above method for regulating the transcriptional activity of the PAFAH1B1 gene in granulosa cells.

[0007] In order to achieve the first objective of the present application, the present application provides a method for regulating the transcriptional activity of the PAFAH1B1 gene, which adopts the following technical scheme:

[0008] A method for regulating the transcriptional activity of a PAFAH1B1 gene comprises using gRNA to influence the methylation level of the PAFAH1B1 gene, thereby affecting the expression of the PAFAH1B1 gene; or using an RNA interference fragment of a DNA methyltransferase, thereby affecting the methylation level of the PAFAH1B1 gene, thereby affecting the expression of the PAFAH1B1 gene; or using a DNA methyltransferase inhibitor, thereby affecting the methylation level of the PAFAH1B1 gene, thereby affecting the expression of the PAFAH1B1 gene.

[0009] Further, affecting the methylation level of the PAFAH1B1 gene includes affecting the methylation level of the PAFAH1B1 gene promoter region, the PAFAH1B1 gene promoter region includes a CpG island (CGI), and the CGI is located within the range of -880bp to +170bp of the PAFAH1B1 gene. Further, the CGI includes CGI1, CGI2, and CGI3; the CGI1 is located within the range of -880bp to -592bp of the PAFAH1B1 gene, the CGI2 is located within the range of -506bp to -296bp of the PAFAH1B1 gene, and the CGI3 is located within the range of -7bp to +170bp of the PAFAH1B1 gene.

[0010] Furthermore, gRNA1 is used to inhibit the DNA methylation level of the CGI3 and promote the expression of the PAFAH1B1 gene, and the sequence of the gRNA1 is: 5′-GCCAACGGGACGCCGCGGUCGG-3′.

[0011] Furthermore, gRNA2 is used to inhibit the DNA methylation level of the CGI3 and promote the expression of the PAFAH1B1 gene, and the sequence of the gRNA2 is 5′-GCGCUCAUGCGGCCGACCGCGG-3′.

[0012] Furthermore, the RNA interference fragment of the DNA methyltransferase includes si-DNMT1, si-DNMT3A or si-DNMT3B, the RNA interference fragment si-DNMT3A promotes the transcriptional activity of the CGI3 and the expression of the PAFAH1B1 gene; the RNA interference fragments si-DNMT1 and si-DNMT3B inhibit the expression of the PAFAH1B1 gene.

[0013] Furthermore, the DNA methyltransferase inhibitor includes 5-Aza-CdR, and the 5-Aza-CdR promotes the expression of the PAFAH1B1 gene.

[0014] In order to achieve the second purpose of the present application, the present application provides a method for regulating the transcriptional activity of PAFAH1B1, which is applied in granulosa cells, using the following technical scheme:

[0015] According to the application of the above method for regulating the transcriptional activity of PAFAH1B1 in granulosa cells, the granulosa cell cycle is regulated by regulating the methylation level of the promoter region of the PAFAH1B1 gene.

[0016] Furthermore, the granulosa cells are human ovarian granulosa cancer cell line COV434 with a cell confluence of 70%-80%.

[0017] Furthermore, the usage amount of the methyltransferase inhibitor 5-Aza-CdR is 0.3-0.8 μM.

[0018] In summary, the present application provides a method for regulating the transcriptional activity of the PAFAH1B1 gene and its application, which have the following technical effects:

[0019] First, this application clarifies for the first time that DNA methylation can have a significant effect on the transcriptional activity of the PAFAH1B1 gene in granulosa cells, which provides a simpler and more effective new approach to regulate the transcriptional activity of PAFAH1B1 in granulosa cells and further regulate the granulosa cell cycle, function and ovarian development without subsequent genetic modification.

[0020] Secondly, this application explores the effect of DNA methylation on the promoter region of the PAFAH1B1 gene and clarifies the specific locations of several CGIs in the promoter region of the PAFAH1B1 gene acted upon by DNA methylation. This provides an experimental basis for subsequent studies on the use of PAFAH1B1 gene CGI to regulate PAFAH1B1 gene methylation, thereby affecting the transcriptional activity of the PAFAH1B1 gene in cells.

[0021] Furthermore, the present application clarifies the specific effects of 5-Aza-CdR, si-DNMT3A, si-DNMT1, si-DNMT3B, gRNA1, and gRNA2 on the transcription and protein expression of the PAFAH1B1 gene in granulosa cells through in vitro experiments, providing a method and effect reference for the subsequent use of DNA methylation to regulate the transcriptional activity of the PAFAH1B1 gene in granulosa cells, and providing an important experimental basis for subsequent animal or human experiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 A is the effect of 5-Aza-CdR on the expression level of PAFAH1B1 mRNA detected by qRT-PCR.

[0023] Figure 1B is the effect of 5-Aza-CdR on the expression level of PAFAH1B1 protein detected by Western blot.

[0024] Figure 2 A is the effect of interfering with DNMT1 and DNMT3A on the expression level of PAFAH1B1 mRNA detected by qRT-PCR.

[0025] Figure 2 B is the effect of interfering with DNMT1 and DNMT3A on the expression level of PAFAH1B1 protein detected by Western blot.

[0026] Figure 3 This is a schematic diagram of the distribution of CGI and NCGI in the PAFAH1B1 promoter region.

[0027] Figure 4 The dual fluorescence activity analysis was used to detect the effect of interfering with DNMT3A on the activity of the PAFAH1B1 promoter region.

[0028] Figure 5 Chromatin accessibility analysis was used to detect the effect of interfering with DNMT3A on the chromatin accessibility of the PAFAH1B1 promoter region.

[0029] Figure 6 A is qRT-PCR detection of the effects of dCas9-TET1-gRNA1 and dCas9-TET1-gRNA2 on the expression level of PAFAH1B1 mRNA.

[0030] Figure 6 B is Western blot detection of the effects of dCas9-TET1-gRNA1 and dCas9-TET1-gRNA2 on the expression level of PAFAH1B1 protein.

[0031] Figure 7 BSP detected the effect of dCas9-TET1-gRNA1 on the methylation level of CGI3 in the PAFAH1B1 promoter region. DETAILED DESCRIPTION

[0032] The present application discloses a method for regulating the transcriptional activity of PAFAH1B1 and its application, which is carried out in vitro using human ovarian granulosa carcinoma cell line COV434 as experimental cells.

[0033] The human ovarian granulosa carcinoma cell line COV434 used in this application was purchased from Wuhan Pronocell Life Science Co., Ltd. and revived, maintained and cryopreserved in the cell laboratory of South China Agricultural University.

[0034] The following will further illustrate the embodiments of the present invention in conjunction with the accompanying drawings and specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. It should be noted that many specific details are set forth in the following description to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein, and therefore, the protection scope of the present invention is not limited by the specific embodiments disclosed below. If specific conditions are not specified in the embodiments, they are carried out according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified in the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0035] The present invention applies statistical methods to analyze the results of three independent experiments in each embodiment, calculate the "mean ± standard deviation", and use one-way analysis of variance to perform significant difference analysis (in the figure, "*" indicates P < 0.05, and "**" indicates P < 0.01).

[0036] Example 1: Cultivation of human ovarian granulosa carcinoma cell line COV434

[0037] COV434 resuscitation: The frozen cells were thawed in a 37°C water bath, centrifuged at 1000 rpm for 5 min, the supernatant was discarded, the cells were resuspended in DMEM complete medium, and inoculated into a 25 mL cell culture flask (Thermo, USA). The medium composition was 4.45 mL DMEM high glucose medium (Hyclone, USA), 500 μL calf serum (Hyclone, USA) and 50 μL penicillin-streptomycin double antibody (Hyclone, USA). The flask was placed at 37°C with 5% CO. 2 Incubator.

[0038] COV434 plating: Observe the status of COV434 cells. When the cell confluence reaches about 80%, discard the culture medium and wash the cells twice with PBS preheated at 37°C (containing 1% (v / v) penicillin-streptomycin double antibody). Use 0.25% trypsin preheated at 37°C to digest the cells for 5 minutes, use DMEM complete culture medium to terminate the digestion, and wash the cells twice with PBS preheated at 37°C (containing 1% (v / v) penicillin-streptomycin double antibody). Resuspend the cells with DMEM complete culture medium, add the cell suspension evenly to the cell culture plate, add DMEM complete culture medium to supplement the volume, and shake gently to evenly. Place at 37°C, 5% CO 2 Incubator, observe the growth of KGN after 24 h, and conduct subsequent experiments when the confluence of cells in the cell culture plate reaches about 80%.

[0039] Example 2: 5-Aza-CdR treatment of COV434 cells

[0040] Treatment: Take the COV434 cells with a cell confluence of 80% in Example 1, discard the culture medium, wash the cells twice with PBS preheated at 37°C (containing 1% (v / v) penicillin-streptomycin double antibody); use 0.5 μM DNA methylase inhibitor (5-Aza-CdR, HY-A0004, MCE, USA) to treat the cells washed with PBS, and the control group is to treat the cells washed with PBS in S1 with 0.5 μM DMSO solution. The cell culture plate treated with 0.5 μM 5-Aza-CdR was placed at 37°C, 5% CO 2 Incubator, observe cell growth after 24 hours.

[0041] qRT-PCR: The test cells that grew well after the above treatment were taken and total RNA was extracted using Trizol (Takara, Japan). RT Master Mix cDNA reverse transcription kit (Takara, Japan), the extracted total cell RNA was reverse transcribed into cDNA. Using the cDNA as a template, the Maxima SYBR Green qPCR Master Mix (2X) kit (Thermo Scientific, USA) was used to carry out qRT-PCR detection. The experiment used the comparative Ct value method to detect the relative expression of genes in the sample, and GAPDH was used as an internal reference for the detection gene. The specific calculation formula was: gene relative expression = 2-{〈﹙experimental group target gene Ct value﹚-﹙experimental group internal reference gene Ct value﹚〉-〈﹙control group target gene Ct value﹚-﹙control group internal reference gene Ct value﹚〉}. The qRT-PCR primers used in the present invention are shown in Table 1.

[0042] Table 1 qRT-PCR primer sequences

[0043]

[0044]

[0045] Western Blot: With reference to the total protein extraction kit (Thermo, USA), the total protein of COV434 cells treated with 5-Aza-CdR in this example was extracted, and protein quantification, SDS-PAGE, and Western Blot were performed using the BCA protein quantification kit. The protein bands in the Western Blot film were analyzed using Image Plus software to study the effect of 5-Aza-CdR treatment on the expression level of PAFAH1B1 gene protein in COV434. Antibodies include Anti-PAFAH1B1 (Santacruz, China, sc-374586) and Anti-alpha Tubulin (Bioss, China, bs-20496R).

[0046] The results of qRT-PCR study on the effect of 5-Aza-CdR treatment on PAFAH1B1 mRNA levels in cells are shown in Figure 1 A, Compared with the control group, 5-Aza-CdR significantly promoted the mRNA level of PAFAH1B1. Western Blot results are shown in Figure 1 B, The results showed that 5-Aza-CdR significantly promoted the protein expression level of PAFAH1B1 compared with the control group.

[0047] Example 3: Treatment of COV434 cells with si-DNMT1, si-DNMT3A and si-DNMT3B

[0048] Use of Lipofectamine TM The 3000 kit (Thermofisher, USA) was used for liposome transfection, and the interfering RNA si-DNMT1, si-DNMT3A, si-DNMT3B (sequences are shown in Table 2, "t" represents "U" in the sequence table) and the control si-NC (RNA fragment of non-interfering DNA methyltransferase, Guangzhou Dongze Biotechnology Co., Ltd., China) were used to transfect the COV434 cells with a cell confluence of 80% in Example 1. The transfected COV434 was used as a sample, and qRT-PCR was performed on the COV434 transfected with si-DNMT1, si-DNMT3A, si-DNMT3B and the control si-NC according to the qRT-PCR method described in Example 2. Western Blot was performed on the COV434 transfected with si-DNMT1, si-DNMT3A, si-DNMT3B and the control si-NC according to the Western Blot method described in Example 2.

[0049] Table 2 si-DNMT1, si-DNMT3A, si-DNMT3B sequences

[0050] Si-RNA Name Sequence (5'-3') si-DNMT1 UACAGUUGUUGACAAACGAG(SEQ ID NO.5) si-DNMT3A ACCCUUACAAAGAAGUUUACA(SEQ ID NO.6) si-DNMT3B CUCAUUUUAUCUUCUAAAACU(SEQ ID NO.7)

[0051] The qRT-PCR results are shown in Figure 2 A, The results showed that compared with the control group, si-DNMT3A significantly promoted the mRNA level of PAFAH1B1, while si-DNMT1 and si-DNMT3B significantly inhibited the mRNA level of PAFAH1B1.

[0052] Western Blot results are shown in Figure 2 B, The results showed that compared with the control group, si-DNMT3A significantly promoted the protein expression level of PAFAH1B1, and si-DNMT3B significantly inhibited the protein expression level of PAFAH1B1.

[0053] Example 4: Analysis of PAFAH1B1 Promoter CpG Island (CGI)

[0054] Bioinformatics website http: / / www.urogene.org / cgi-bin / methprimer / methprimer.cgi , predict the CGI of PAFAH1B1 promoter region (-2000 / +200, +1 is the transcription start site). Figure 3 The results showed that there were three CGIs in the PAFAH1B1 promoter region, namely CGI1 (-880 / -592), CGI2 (-506 / -296) and CGI3 (-7 / +170), and two non-CpG islands (NCGIs), NCGI1 (-1135 / -930) and NCGI2 (-318 / -51bp).

[0055] Example 5: Dual fluorescence activity analysis

[0056] Construction of CGI and NCGI overexpression vectors: Primers were designed using the primer design software Primer5, and the primer sequences were shown in Table 3 below. The CGI and NCGI sequences in Example 4 were amplified as target fragments. The amplified target fragments were purified and recovered, connected to the pMD18T vector (purchased from Takara), transformed, screened, and sequenced to identify the correct common plasmids. BioEdit software was used for analysis to clarify that the restriction sites of the upstream and downstream primers were MIu I and Xho I, respectively. Using the pMD18T recombinant plasmid as a template, the restriction primers were cut for PCR amplification; the fragments were purified and recovered, double-digested, connected to the pGL3-basic vector, transformed, screened, and sequenced to identify the correct endotoxin-free plasmids (Magen, USA), named pGL3-CGI1, pGL3-CGI2, pGL3-CGI3, pGL3-NCGI1, and pGL3-NCGI2.

[0057] Table 3 Example 5 Construction of CGI and NCGI overexpression vector primer sequences

[0058]

[0059] Note: The black bold font part is the protected base, and the underline is the restriction site.

[0060] Transfection: Experimental group was set up, COV434 cells with a confluence of 80% in Example 1 were taken and used The above plasmids pGL3-CGI1, pGL3-CGI2, pGL3-CGI3, pGL3-NCGI1, pGL3-NCGI2, pGL3-basic, pGL3-control and si-DNMT3A were transfected into COV434 cells using the 3000 kit (Invitrogen, USA), of which pGL3-basic was used as a negative control (Guangzhou Dongze Biotechnology Co., Ltd., China) and pGL3-control was used as a positive control (Guangzhou Dongze Biotechnology Co., Ltd., China). The corresponding control group was set up, and the COV434 cells with a confluence of 80% in Example 1 were taken and used The above plasmids pGL3-CGI1, pGL3-CGI2, pGL3-CGI3, pGL3-NCGI1, pGL3-NCGI2, pGL3-basic, pGL3-control and si-NC were transfected into COV434 cells using the 3000 kit (Invitrogen, USA). Three replicates were set up for each group, and the transfected wells were placed at 37°C and 5% CO 2 Culture in an incubator. Observe the cell status 24 h after transfection. Collect cells if they grow well.

[0061] Dual fluorescence activity analysis: Use the Dual Luciferase Assay Kit (Promega, USA), and refer to its instructions for specific steps. Wash the cells twice with PBS preheated at 37°C, digest the cells with 0.25% trypsin at 37°C for 5 min, use complete medium for final digestion, and wash the cells twice with PBS preheated at 37°C. Resuspend the cells with 75μL of PBS that has been preheated on ice, transfer the cell suspension to the dual fluorescence detection plate, add 75μL of Luciferase Assay Reagent, and incubate at 25°C for 20min. The luminescence value detected by the microplate reader is the expression level of the corresponding firefly luciferase. Add 75μL Stop& Reagent, mix well, react at 25℃ for 20min. The luminescence value detected by microplate reader is the expression level of the corresponding Renilla luciferase. The expression level of firefly luciferase is the expression level of Renilla luciferase, which is the relative activity of firefly luciferase.

[0062] The results of dual fluorescence activity analysis are shown in Figure 4 The results showed that compared with the control group, si-DNMT3A significantly promoted the dual luciferase activity of pGL3-CGI3, indicating that si-DNMT3A mainly promoted the transcription of CGI3 by affecting the methylation level of CGI3 in the promoter region of the PAFAH1B1 gene, and thus promoted the expression of the PAFAH1B1 gene. si-DNMT3A also had an effect on pGL3-CGI1, pGL3-CGI2, pGL3-NCGI1 and pGL3-NCGI2, but the effect was not significant.

[0063] Example 6: Chromatin accessibility analysis

[0064] Transfection: Take the COV434 cells with a confluence of 80% in Example 1, and transfect si-DNMT3A and its control si-NC into the COV434 cells. Set up 3 replicates for each group, and place the transfected well plate at 37°C and 5% CO 2 Culture in an incubator, observe the cell status 24 hours after transfection, and collect the cells if they grow well.

[0065] Using EpiQuik TM Chromatin Accessibility Assay Kit (EPIGENTEK, USA), refer to the instruction manual for specific steps. Sample chromatin extraction: Cell chromatin extraction, collect cells, add 400μL 1×LysisBuffer, transfer 200μL cell suspension to a new RNase-free tube (sample); transfer 200μL suspension to a new RNase-free tube (no-Nuclease Mix control). Incubate on ice for 10min, vortex for 10s, centrifuge at 5000rpm for 5min, and discard the supernatant. Add 1mL 1×Wash Buffer to wash once, centrifuge at 3000rpm at 4℃ for 5min. Chromatin extraction of ovarian tissue, take 200mg tissue, add 400μL 1×Lysis Buffer, grind the tissue using a homogenizer, transfer 200μL of the mixture to a new RNase-free tube (sample), and transfer 200μL of the mixture to another new RNase-free tube (no-Nuclease Mix control). Centrifuge at 5000rpm at 4℃ for 5min. Discard the supernatant and wash again with 1 mL 1× Wash Buffer.

[0066] Chromatin digestion: Add 0.5mL 1×Wash Buffer to wash the chromatin pellet, centrifuge at 3000rpm for 5min at 4℃, and discard the supernatant. Add 48μL Nuclear Digestion Buffer and 2μL Nuclease Mix to the Nuclease Mix reaction mixture. Add 50μL Nuclear Digestion Buffer to the no-Nuclease Mix reaction mixture. Mix well and incubate at 37℃ for 4min. Add 10μL Reaction Stop Solution and incubate at 37℃ for 10min. Add 2μL Proteinase K and incubate at 60℃ for 15min.

[0067] DNA purification: Add 250μL DNA Binding Solution to each column, add sample, centrifuge at 12000rpm for 30s, and discard the waste liquid. Add 200μL 1× DNA Washing Solution to each column, centrifuge at 12000rpm for 30s, discard the waste liquid, and repeat this step twice. Place the column in a new RNase-free tube, add 20μL Elution Solution, and centrifuge at 12000rpm for 45s to elute the DNA.

[0068] The purified transfected si-DNMT3A and its control si-NC DNA were treated according to the above EpiQuik TM Chromatin accessibility analysis was performed according to the instructions of the Chromatin Accessibility Assay Kit (EPIGENTEK, USA). The results are shown in Figure 5 The results showed that compared with the control group, interfering with the expression of DNMT3A in cells significantly increased the chromatin accessibility of the CGI3 region of the PAFAH1B1 promoter, indicating that si-DNMT3A mainly promoted the expression of the PAFAH1B1 gene by changing the chromatin structure of the CGI3 region and affecting the methylation of the CGI3 region.

[0069] Example 7: Construction of dCas9-TET1 system

[0070] In order to promote the low DNA methylation level of CGI3, two pairs of gRNAs were designed for the CGI3 (-7 / +170) region, namely dCas9-TET1-gRNA1 (gRNA 1) and dCas9-TET1-gRNA2 (gRNA 2), the sequences of which are shown in Table 4. The cells of Example 1 were treated with the dCas9-TET1 fusion vector and gRNA1 and the dCas9-TET1 fusion vector and gRNA2, respectively.

[0071] qRT-PCR results Figure 6 As shown in A, the results showed that compared with the control group, dCas9-TET1-gRNA1 or dCas9-TET1-gRNA2 treatment significantly promoted the mRNA level of PAFAH1B1 gene. Figure 6 As shown in B, the results showed that dCas9-TET1-gRNA1 or dCas9-TET1-gRNA2 treatment significantly promoted the protein expression level of the PAFAH1B1 gene.

[0072] Table 4 gRNA sequences

[0073] gRNA name Sequence (5'-3') dCas9-TET1-gRNA1 GCCAACGGGGACGCCGCGGUCGG(SEQ ID NO.18) dCas9-TET1-gRNA2 GCGCUCAUGCGGCCGACCGCGG(SEQ ID NO.19)

[0074] Example 8: Bisulfite sequencing PCR (BSP)

[0075] Based on the results of Example 7, the BSP experiment selected dCas9-TET1 fusion vector carrying gRNA1 and its blank control to treat the cells of Example 1, and extracted genomic DNA using a tissue DNA kit (Omega Bio-tek, USA). According to the steps of the instructions of the EZ DNA methylation gold standard kit (ZYMO RESEARCH, California, USA), the purified DNA was subjected to bisulfite conversion. Using bisulfite-converted DNA as a template, CGI3 was amplified with BSP primers, and the BSP primer sequences are shown in Table 5. Finally, the sequencing results were compared with the original sequences and a dot plot was drawn through the QUMA website (http: / / quma.cdb.riken.jp / ), and 10 clones were required for each sample to calculate the methylation rate.

[0076] The results of BSP methylation test are as follows Figure 7 As shown, the results showed that compared with the blank control, dCas9-TET1-gRNA1 significantly inhibited the methylation level of CGI3 (-7 / +170) in the PAFAH1B1 promoter region.

[0077] Table 5 BSP primer sequences

[0078]

[0079] The present application discloses the nature of the effect of DNA methylation level on the transcriptional activity of PAFAH1B1 gene, and based on this, studies a new, targeted method capable of effectively regulating the transcriptional activity of PAFAH1B1 gene. The method of regulating the transcriptional activity of PAFAH1B1 gene is applied to granulosa cells in vitro, and the results show that the method can effectively regulate the transcriptional activity of PAFAH1B1 gene in granulosa cells, so that the granulosa cell cycle can be regulated by regulating the methylation level of PAFAH1B1 gene. This provides an effective new approach for the study of the effects on the transcriptional activity of PAFAH1B1 gene and the regulation of the granulosa cell cycle, and can serve as a direct reference method for subsequent animal experiments.

[0080] The above description of the specific implementation methods of the present application discloses the technical details of the present application in detail and illustrates the technical ideas of the present application, which is intended to meet the authorization provisions of the Patent Law, but should not be considered as limiting the scope of protection of the present application. Researchers in this field can make various changes or deformations based on the present application and in combination with the knowledge and technology at that time. As long as they do not deviate from the core ideas and spirit of the present application, they should all fall within the scope of protection of the claims attached to the present application.

Claims

1. A method for regulating the transcriptional activity of PAFAH1B1 gene, characterized in that: Including using gRNA to affect the methylation level of the PAFAH1B1 gene, thereby affecting the expression of the PAFAH1B1 gene; Or using RNA interference fragments of DNA methyltransferase to affect the methylation level of the PAFAH1B1 gene and affect the expression of the PAFAH1B1 gene; Or use a DNA methyltransferase inhibitor to affect the methylation level of the PAFAH1B1 gene and affect the expression of the PAFAH1B1 gene.

2. A method for regulating the transcriptional activity of the PAFAH1B1 gene according to claim 1, characterized in that: Influencing the methylation level of the PAFAH1B1 gene includes influencing the methylation level of the PAFAH1B1 gene promoter region, the PAFAH1B1 gene promoter region includes a CpG island, and the CpG island is located within the range of -880 bp to +170 bp of the PAFAH1B1 gene.

3. A method for regulating the transcriptional activity of PAFAH1B1 gene according to claim 2, characterized in that: The CpG island includes CGI1, CGI2, and CGI3; the CGI1 is located within the range of -880bp to -592bp of the PAFAH1B1 gene, the CGI2 is located within the range of -506bp to -296bp of the PAFAH1B1 gene, and the CGI3 is located within the range of -7bp to +170bp of the PAFAH1B1 gene.

4. A method for regulating the transcriptional activity of PAFAH1B1 gene according to claim 3, characterized in that: gRNA1 is used to inhibit the DNA methylation level of the CGI3 and promote the expression of the PAFAH1B1 gene. The sequence of the gRNA1 is 5′-GCCAACGGGACGCCGCGGUCGG-3′.

5. The method for regulating the transcriptional activity of PAFAH1B1 gene according to claim 3, characterized in that: gRNA2 is used to inhibit the DNA methylation level of the CGI3 and promote the expression of the PAFAH1B1 gene. The sequence of the gRNA2 is 5′-GCGCUCAUGCGGCCGACCGCGG-3′.

6. The method for regulating the transcriptional activity of PAFAH1B1 gene according to claim 3, characterized in that: The RNA interference fragment of the DNA methyltransferase includes si-DNMT1, si-DNMT3A or si-DNMT3B. The RNA interference fragment si-DNMT3A promotes the transcription activity of CGI3 and the expression of the PAFAH1B1 gene; the RNA interference fragments si-DNMT1 and si-DNMT3B inhibit the expression of the PAFAH1B1 gene.

7. The method for regulating the transcriptional activity of PAFAH1B1 gene according to claim 3, characterized in that: The DNA methyltransferase inhibitor includes 5-Aza-CdR, and the 5-Aza-CdR promotes the expression of the PAFAH1B1 gene.

8. Use of a method for regulating PAFAH1B1 transcriptional activity according to any one of claims 2 to 7 in granulosa cells, characterized in that: The granulosa cell cycle is regulated by regulating the methylation level of the promoter region of the PAFAH1B1 gene.

9. The use according to claim 8, characterized in that: The granulosa cells are human ovarian granulosa cancer cell line COV434 with a cell confluence of 70%-80%.

10. The use according to claim 8, characterized in that: In the granulosa cells, the methyltransferase inhibitor 5-Aza-CdR was used in an amount of 0.3-0.8 μM.

Images