Gene OsMYB1 and application thereof in negative regulation of anthocyanin synthesis

Abstract

The invention belongs to the technical field of gene engineering, and provides a gene OsMYB1 and application thereof in negative regulation of anthocyanin synthesis. The cDNA (complementary deoxyribonucleic acid) sequence of the gene OsMYB1 is as shown in SEQ ID NO. 1. A systematic molecular biology experiment proves that the OsMYB1 inhibits the expression of the OsDFR by combining with a promoter region of an anthocyanin synthesis key structural gene OsDFR, so that the synthesis of anthocyanin is inhibited. Meanwhile, the OsMYB1 can form an MBW ternary complex with the OsB2 and the OsPAC1 to competitively inhibit the synthesis of the anthocyanin, which indicates that the transcription factor OsMYB1 is a negative regulation factor for the synthesis of the rice anthocyanin, the content of the rice anthocyanin can be increased by knocking out the transcription factor OsMYB1, and a certain theoretical basis is provided for cultivating high-quality purple rice with high anthocyanin content.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a gene OsMYB1 and an application thereof in negatively regulating anthocyanin synthesis. Background Art

[0002] Purple rice is an ancient and precious special rice variety in my country. It is purple or black because of the accumulation of anthocyanins in its pericarp and seed coat (Chen et al., 2016). Studies have found that the nutritional value of purple rice is higher than that of white rice, and it also contains biologically active substances such as anthocyanins, oryzanol, alkaloids and phytosterols. Anthocyanins are a type of phenolic compound synthesized in the cytoplasm of plants (Saigo et al., 2020). Pentose phosphate and intermediates of the glycolysis pathway are catalyzed by multiple steps of enzymes to form phenylalanine, which then enters the phenylpropanoid biosynthesis pathway and the flavonoid biosynthesis pathway to synthesize a variety of phenolic compounds including anthocyanins. The structural genes for anthocyanin synthesis have been studied relatively clearly in rice, but research on its transcriptional regulation has been slow.

[0003] Therefore, it is necessary to develop a gene and method that can negatively regulate anthocyanin synthesis. Summary of the invention

[0004] The purpose of the present invention is to overcome the defects of the prior art, provide a gene OsMYB1 and its application in negatively regulating anthocyanin synthesis, the gene OsMYB1 has a negative regulatory effect in the regulation of anthocyanin synthesis in rice, and knocking it out can increase the content of anthocyanins in rice, providing a certain theoretical basis for cultivating high-quality purple rice with a high anthocyanin content.

[0005] To achieve the above object, the present invention is achieved as follows:

[0006] In a first aspect of the present invention, a gene OsMYB1 is provided, and the nucleotide sequence of the gene OsMYB1 is shown in SEQ ID NO:1.

[0007] Furthermore, the gene OsMYB1 has a nucleotide sequence with more than 80% homology with the nucleotide sequence shown in SEQ ID NO: 1, which is generated by adding, replacing, inserting or deleting one or more nucleotides.

[0008] In a second aspect of the present invention, a protein encoded by the gene OsMYB1 is provided, wherein the protein has an amino acid sequence as shown in SEQ ID NO: 2.

[0009] Furthermore, the protein has an amino acid sequence that is at least 90% homologous to the amino acid sequence shown in SEQ ID NO.2 and has similarity.

[0010] In the third aspect of the present invention, a gene knockout or knockdown expression vector targeting the gene OsMYB1 is provided.

[0011] In a fourth aspect of the present invention, a method for constructing a knockout or knockdown vector of the gene OsMYB1 is provided, the method comprising:

[0012] The gRNA targeting the gene OsMYB1 was recombined into the CRISPR / Cas9 gene editing vector to obtain a knockout or knockdown vector.

[0013] Furthermore, the nucleotide sequence of the gRNA targeting the gene OsMYB1 is shown in SEQ ID NO: 3.

[0014] In the fifth aspect of the present invention, a transformant of the expression vector is provided.

[0015] In some embodiments, the transformant is Agrobacterium tumefaciens, and / or a plant cell (or organism); the organism is a transgenic plant, which is one of tomato, rice, corn, wheat, barley, tobacco, soybean, sorghum, cotton, hemp, peanut, rapeseed, sugarcane, or sugar beet.

[0016] In the sixth aspect of the present invention, a method for increasing the content of anthocyanins in plants is provided, wherein the vector mediates plant genetic transformation by means of genetic engineering means, and the transgenic plants obtained thereby increase the content of anthocyanins in plants.

[0017] In the seventh aspect of the present invention, provided is the use of the gene OsMYB1 or the protein in negatively regulating anthocyanin synthesis.

[0018] In the eighth aspect of the present invention, provided is the use of the expression vector or the expression vector prepared by the method or the transformant in increasing the content of anthocyanins in plants.

[0019] The plant is selected from at least one of tomato, rice, corn, wheat, barley, tobacco, soybean, sorghum, cotton, hemp, peanut, rapeseed, sugarcane, or sugar beet.

[0020] The present invention has the following beneficial effects:

[0021] The present invention confirms through systematic molecular biological experiments that OsMYB1 inhibits the expression of OsDFR by binding to the promoter region of the key structural gene OsDFR for anthocyanin synthesis, thereby inhibiting the synthesis of anthocyanins. At the same time, OsMYB1 can also form an MBW ternary complex with OsB2 and OsPAC1 to competitively inhibit the synthesis of anthocyanins, indicating that the transcription factor OsMYB1 is a negative regulatory factor for the synthesis of rice anthocyanins, and knocking it out can increase the content of rice anthocyanins, providing a certain theoretical basis for cultivating high-quality purple rice with high anthocyanin content. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Analysis of the spatiotemporal specific expression of OsMYB1.

[0023] Figure 2 These are the gene-edited forms of two OsMYB1 homozygous mutant lines.

[0024] Figure 3 The expression level of OsMYB1 in WT, KO-1 and KO-2 was identified.

[0025] Figure 4 Determination of anthocyanin content in leaves of WT, KO-1 and KO-2, where A is the leaf phenotype after OsMYB1 gene knockout, and B is the comparison of anthocyanin content in leaves after OsMYB1 gene knockout

[0026] Figure 5 Subcellular localization of OsMYB1.

[0027] Figure 6 The interaction relationship among OsMYB1, OsB2 and OsPAC1.

[0028] Figure 7 The dual luciferase reporter gene experiment was used to verify the negative regulatory effect of OsMYB1 on the OsDFR promoter. DETAILED DESCRIPTION

[0029] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0030] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0031] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0032] The technical solution of the embodiment of the present application is to solve the above technical problems, and the overall idea is as follows:

[0033] This application identified the OsMYB1 gene in rice for the first time and conducted a systematic expression pattern analysis and functional study of the gene, clarifying the negative regulatory role of the OsMYB1 gene in the regulation of rice anthocyanin synthesis.

[0034] The results of real-time fluorescence quantitative PCR showed that the gene was expressed in various tissues of rice seedling, tillering, heading and filling stages, among which the relative expression level was the highest in the heading stage. The expression level gradually increased at different stages after flowering, and then showed a downward trend 30 days after flowering. This result indicated that the gene was closely related to the development process of caryopsis.

[0035] The CRISPR / Cas9 gene editing recombinant vector was constructed and transferred into the purple rice 'Yunnan Zinuo' through the Agrobacterium tumefaciens-mediated method. Two homozygous mutants KO-1 and KO-2 were screened in the T1 generation. Compared with the wild-type plants, the expression level of the OsMYB1 gene in the two homozygous mutant plants was significantly downregulated. Compared with the wild-type plants, the anthocyanin content in the leaves of the T1 generation of mutant plants was significantly increased. The results showed that the expression level of this gene affects the content of anthocyanins in rice leaves.

[0036] Through systematic molecular biology experiments, it was confirmed that OsMYB1 inhibits the expression of OsDFR, a key structural gene for anthocyanin synthesis, by binding to the promoter region. At the same time, OsMYB1 can also form an MBW ternary complex with OsB2 and OsPAC1 to competitively inhibit the synthesis of anthocyanins.

[0037] The present invention cloned the R2R3-MYB transcription factor OsMYB1 that negatively regulates anthocyanin synthesis from the purple rice 'Dian Zi Nuo'. OsMYB1 was edited in the purple rice 'Dian Zi Nuo' using CRISPR / Cas9 technology, and the anthocyanin content of the leaves of the OsMYB1 gene-edited plants and wild-type plants was compared. It was found that the anthocyanin content of the OsMYB1 gene-edited plants was significantly higher than that of the wild-type plants, indicating that the transcription factor OsMYB1 is a negative regulatory factor for anthocyanin synthesis in rice, and knocking it out can increase the content of anthocyanins in rice, providing a certain theoretical basis for cultivating high-quality purple rice with high anthocyanin content.

[0038] The gene OsMYB1 of the present invention and its application in negatively regulating anthocyanin synthesis are described in detail below with reference to the examples.

[0039] Example 1: Analysis of spatiotemporal expression patterns of OsMYB1

[0040] (1) Collection of tissue samples:

[0041] Purple rice 'Yunnan Zinuo' was used as the experimental material. Leaves and roots were collected at the seedling stage, leaves, leaf sheaths and roots were collected at the tillering stage, flag leaves before and after flowering, spikelets before and after flowering were collected at the heading stage, and labels were hung on the day of flowering. Caryopsis were collected 7, 14, 21 and 30 days after flowering. After sampling, they were immediately frozen with liquid nitrogen and stored in a -80℃ refrigerator.

[0042] (2) RT-qPCR:

[0043] The samples were ground into powder with liquid nitrogen, and total RNA was extracted using the Takara Total RNA Extraction Kit (9108). The specific method was referred to the instruction manual. TM The cDNA was synthesized using the RT reagent Kit with gDNAEraser (RR047A) according to the instructions.

[0044] The primer sequences for OsMYB1 quantitative qPCR are:

[0045] F:5'-ATCAGTTCTGTGCCGAGGATGC-3';

[0046] R:5'-CGCCTAACTGCTCGTCGTTGA-3',

[0047] OsGAPDH was used as the internal reference gene, and the primer sequences were:

[0048] F: 5′-GCCTCCTCCTTGATTGC-3′;

[0049] R: 5′-CTTTCCGTGTTCCCACA-3′;

[0050] ReferenceTakara TB Premix Ex Taq TM II (RR820A) reaction system and qPCR procedure, the results were obtained using 2 –△△Ct The gene expression was analyzed by the value method.

[0051] The temporal and spatial expression patterns of the OsMYB1 gene were analyzed by RT-qPCR, and the results are shown in Figure 1The results showed that the expression level of the gene in leaves was higher than that in roots at the seedling stage; the expression levels in leaves and roots were lower at the tillering stage, and higher in leaf sheaths; the expression levels in flag leaves and spikelets after flowering were higher at the heading stage; and the expression levels in the grain filling stage increased 14 and 21 days after flowering, and decreased 30 days after flowering. During the entire development period, the expression level of the OsMYB1 gene was highest at the heading stage, and it increased first and then decreased during the development of the caryopsis.

[0052] Example 2: Anthocyanin content increased significantly after OsMYB1 knockout

[0053] 1. Construction of CRISPR / Cas9 recombinant knockout vector

[0054] The target was designed according to the OsMYB1 gene sequence in the rice genome, and the gRNA sequence was designed as follows:

[0055] CCACAGCCTCCTCGGCAACA (SEQ ID NO. 3), PCR amplification was performed using primers F: 5'-cagtGGTCTCatgcaatcgcgtacatcagggcgcag'; R: 5'-cagtGGTCTCaaaacccacagcctcctcggcaac-3', and then gel recovery and purification were performed; the gene editing vector was double-digested with BsaI / Eco31I

[0056] pYL-HU-U3-CCDB-tRNA (K1) (purchased from Wuhan Boyuan Biological Products Co., Ltd.) was used to obtain a linearized vector, and then the fragment was recombined and connected with the linearized vector using Takara's Infusion recombinase to construct a CRISPR / Cas9 recombinant knockout vector.

[0057] 2. Obtaining OsMYB1 homozygous mutants

[0058] The recombinant knockout vector obtained in the previous step was used to infect rice 'Yunnan Zinuo' callus tissue with Agrobacterium for genetic transformation to obtain T0 generation gene-edited plants. The genomic DNA of the gene-edited plants was extracted and PCR amplified using primers F: 5'-GGCAGATTGGACAATCGCTCG'; R: 5'-GCTTGATGTGCGTGTTCCAG-3' to amplify the fragment containing the target site and send it to Chengdu Biotechnology for sequencing.

[0059] The seeds of the homozygous mutant KO-1 and KO-2 plants were harvested and propagated, and the T1 generation was further sequenced and identified, all of which were homozygous mutant plants. KO-1 and KO-2 plants had 1 / 2 bases missing in the target region, respectively, which resulted in the premature appearance of the stop codon and the termination of translation, leading to the functional change of the mutant OsMYB1 gene.

[0060] Two homozygous mutants KO-1 and KO-2 were screened in the T1 generation, and the editing format is shown in Figure 2 Compared with the wild-type plants, the expression levels of OsMYB1 gene in the two homozygous mutant plants were significantly downregulated ( Figure 3 ).

[0061] 3. Anthocyanin content detection

[0062] The tillering leaves of WT, KO-1 and KO-2 were ground into powder using a mortar and liquid nitrogen. After weighing, they were hydrolyzed with 1% hydrochloric acid solution, extracted at 70°C for 1 hour, 6000 r / min, and centrifuged for 10 min. The supernatant was taken to measure the absorbance at 525 nm, and the anthocyanin content was calculated, C = 1 / 958×v / 100×1 / m×ABS×100000 (v: constant volume ABS: absorbance value).

[0063] The anthocyanin content in T1 leaves was detected by hydrochloric acid extraction method. Figure 4 Compared with the wild type, the anthocyanin content of the mutant plants was significantly increased, and the results showed that the expression level of this gene affects the anthocyanin content in rice leaves.

[0064] Example 3: Subcellular localization of OsMYB1

[0065] The cDNA sequence of OsMYB1 (without the stop codon) (as shown in SEQ ID NO.1) was obtained by PCR amplification, and the vector pSuper 1300-GFP (purchased from Puint Biotechnology Co., Ltd., catalog number 5518) was linearized by double digestion with HindIII and SalI, and GFP was ligated and fused using homologous recombinase to obtain a recombinant plasmid.

[0066] The constructed recombinant vector pSuper1300-OsMYB1-GFP was transformed into rice protoplasts, and the GFP fluorescence signal was observed using a laser confocal microscope.

[0067] Results Figure 5 , and found that OsMYB1 was located in the cell nucleus.

[0068] Example 4: Yeast two-hybrid experiment

[0069] 1. Vector construction

[0070] The CDS sequence of OsMYB1 was constructed into the pGADT7 vector (commercially available, such as Ubao Biotechnology, product number VT1639) by homologous recombination to construct the recombinant vector pGADT7-OsMYB1; the CDS sequences of OsPAC1 and OsB2 were homologously recombined into the pGBKT7 vector (commercially available, such as Ubao Biotechnology, product number VT1638) to construct the recombinant vectors pGBKT7-OsPAC1 and pGBKT7-OsB2, respectively.

[0071] The primer sequence of OsMYB1 is:

[0072] F:5'-GACGTACCAGATTACGCTCATATGatggggaggtcgccgtgc-3';

[0073] R:5'-TCGATGCCCACCCGGGTGGAATTCtatgtactggccttgttccaac-3';

[0074] The primer sequences for OsPAC1 are:

[0075] F:5'-ATCTCAGAGGAGGACCTGCATATGatggagcagcccaagccg-3';

[0076] R:5'-AGGTCGACGGATCCCCGGGAATTCtcagaccctgagaagctggac-3';

[0077] The primer sequence of OsB2 is:

[0078] F:5'-ATCTCAGAGGAGGACCTGCATATGatggcatctgctcctccagtt-3';

[0079] R:5'-AGGTCGACGGATCCCCGGGAATTCttacggcgccttcccctgt-3'.

[0080] 2. Detection of self-activation activity of bait expression vector

[0081] The recombinant vectors pGBKT7-OsPAC1 and pGBKT7-OsB2 constructed in the previous step were co-transformed with the empty vector pGADT7 into yeast Y2HGold, spread on SD / -Leu-Trp and SD / -Trp-Leu-His-Ade plates, respectively, and cultured inverted at 30°C for 3 days to observe the growth of the yeast strains.

[0082] 3. Protein interaction analysis

[0083] Different recombinant plasmids were co-transformed into the yeast strain Y2HGold and spread on SD / -Leu / -Trp medium. After 3 days, the positive clones were transferred to SD / -Leu / -Trp / -His / -Ade medium. Finally, X-α-gal was added to the SD / -Leu / -Trp / -His / -Ade medium as a substrate for detecting β-galactosidase activity.

[0084] Results Figure 6 , OsMYB1 can interact with OsB2 and OsPAC1 to form a ternary complex to regulate the synthesis of rice anthocyanins.

[0085] Example 5: Dual luciferase reporter gene experiment

[0086] 1. Vector construction

[0087] The CDS sequence of transcription factor OsMYB1 (as shown in SEQ ID NO. 1) was recombined into the pGreenII 62-SK vector (purchased from Puint Biotechnology Co., Ltd., product number 5239) by homologous recombination. The primer sequences were F: 5'-GGCCGCTCTAGAACTAGTGGATCCATGGGGAGGTCGCCGTGC-3'; R: 5'-ATCGATAAGCTTGATATCGAATTCTATGTACTGGCCTTGTTCCAAC-3'.

[0088] The promoter sequence of the structural gene OsDFR is:

[0089]

[0090] The promoter sequence of OsDFR was recombined into the pGreenII 0800-LUC vector (purchased from Puint Biotechnology Co., Ltd., catalog number 5240), and the primer sequence was

[0091] F:5'-GAGGTCGACGGTATCGATAAGCTTACGTGCACGTAGCTCACA-3';

[0092] R: 5'-GGCCGCTCTAGAACTAGTGGATCCGCGTACCGTGCGTGATC-3'.

[0093] The recombinant vectors (pGreenII 62SK-OsMYB1 and pGreenII 0800-proOsDFR-LUC) and the empty vector (pGreenII 62-SK) were transformed into Agrobacterium GV3101, respectively. After culturing at 28°C in the dark for 2-3 days, single colonies were picked and positive clones were identified by bacterial liquid PCR.

[0094] 2. Nicotiana benthamiana injection

[0095] Agrobacterium containing the recombinant plasmid was inoculated into a fresh REB liquid medium containing 50 mg / L Rif and cultured overnight to about OD600 = 1.0. Under sterile conditions, fresh bacterial solution was taken in a 50 mL centrifuge tube and centrifuged at 4°C 8000 rpm for 10 min, the supernatant was removed, and the bacteria were resuspended in an infiltration medium (ddH2O containing 10 mM MgCl2, 10 mM MES and 200 μM acetosyringone, pH = 5.6), and the bacterial solution concentration was adjusted to OD600 = 0.8, placed in the dark at room temperature for 3 hours, and the bacterial solution was injected into the leaves of Nicotiana benthamiana plants with the same growth potential using a disposable syringe without a needle.

[0096] 3. Luminescence detection

[0097] Three days after the injection of this type of tobacco, the Dual-Luciferase Repoter Assay Kit (Vazyme, China) and the multifunctional microplate reader EnVision (PerkinElmer, USA) were used for luminescence detection. First, a sample was taken from the injection area with a hole punch into a 1.5 ml centrifuge tube, ground with liquid nitrogen, and 500 μL 1× Cell Lysis Buffer was added and vortexed and mixed, then allowed to stand for 5 min, centrifuged at 12000 rpm for 2 min, and the supernatant was taken into a new 1.5 mL centrifuge tube. 100 μL Luciferase Substrate and 20 μL lysate were added to a 96-well microplate, and the Firefly luciferase reporter gene activity was detected after rapid pipetting and mixing. Subsequently, 100 μL Renilla substrate working solution was added, and the Renilla luciferase reporter gene activity was immediately detected after rapid mixing.

[0098] Results Figure 7 It was found that the Luc / Ren ratio of tobacco leaves co-transformed with pGreenII 62SK-OsMYB1 and pGreenII 0800-proOsDFR-LUC in the experimental group was significantly lower than that in the control group, indicating that OsMYB1 negatively regulates the expression of OsDFR.

[0099] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0100] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0101] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A gene OsMYB1, characterized in that The nucleotide sequence of the gene OsMYB1 is shown in SEQ ID NO:

1.

2. The gene OsMYB1 according to claim 1, characterized in that The gene OsMYB1 has a nucleotide sequence with more than 90% homology, which is generated by adding, replacing, inserting or deleting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO:

1.

3. A protein encoded by the gene OsMYB1 according to claim 1, characterized in that: The protein has an amino acid sequence as shown in SEQ ID NO: 2, or has an amino acid sequence that has at least 90% homology to the amino acid sequence as shown in SEQ ID NO. 2 and has the same characteristics. A gene knockout or knockdown vector targeting the gene OsMYB1 according to claim 1 .

5. A method for constructing a knockout or knockdown vector of the gene OsMYB1, characterized in that: The method comprises: The gRNA targeting the gene OsMYB1 was recombined into the CRISPR / Cas9 gene editing vector to obtain a knockout or knockdown vector.

6. The method for constructing a knockout or knockdown vector of the gene OsMYB1 according to claim 5, characterized in that: The nucleotide sequence of the gRNA targeting the OsMYB1 gene is shown in SEQ ID NO:

3.

7. A transformant comprising the expression vector according to claim 4 or the gene knockout or knockdown vector prepared by the method according to any one of claims 5 to 6.

8. A method for increasing the content of anthocyanins in plants, characterized in that: The vector described in claim 4 or the vector prepared by the method described in any one of claims 5-6 is used to mediate plant genetic transformation by genetic engineering means to obtain transgenic plants, thereby increasing the content of plant anthocyanins.

9. Use of the gene OsMYB1 according to any one of claims 1-2 or the protein according to claim 3 in negatively regulating anthocyanin synthesis.

10. Use of the vector according to claim 4, the vector prepared by the method according to any one of claims 5 to 6, or the transformant according to claim 7 in increasing the content of anthocyanins in plants.

Images