Method for regulating fatty acid content in tobacco by NtMFP2 gene in tobacco and application thereof

Abstract

The application provides a method for regulating the content of fatty acids in tobacco, which comprises the step of regulating the expression level of NtMFP2 gene in tobacco. The application also provides the use of NtMFP2 gene in tobacco. The NtMFP2 gene in tobacco can regulate the content of fatty acids in tobacco leaves, and by regulating the expression of the gene, the biomass of tobacco seedlings under sugar-free and high-sugar culture conditions can be improved, the content of fatty acids in the leaves of tobacco seedlings at the seedling stage can be improved, and then high-fat leaves and excellent growth of tobacco seedlings are realized.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant genetic engineering, and in particular to a method for regulating the content of fatty acids in tobacco by NtMFP2 gene and application. BACKGROUND

[0002] Tobacco is an important economic crop, widely planted and has a long history of cultivation. As a model plant of Solanaceae, tobacco has important scientific value in gene function research and molecular breeding, etc. In tobacco, the composition, content and distribution of fatty acids play an important regulatory role in response to various stress. Fatty acids are not only important components of plant growth and development and cell structure, but also have a significant impact on the quality and flavor of tobacco leaves. With the development of leaves, the content and composition of fatty acids in tobacco leaves will also change.

[0003] Therefore, it is of great significance to study the fatty acids in tobacco, obtain tobacco leaves with high fatty acid content, improve the stress resistance and quality of tobacco, and obtain excellent style. SUMMARY

[0004] Therefore, in order to at least partially solve at least one of the above-mentioned technical problems, the present application provides a method for regulating the content of fatty acids in tobacco by NtMFP2 gene and application.

[0005] According to an embodiment of the present application, a method for regulating the content of fatty acids in tobacco is provided, which comprises the step of regulating the expression level of NtMFP2 gene in tobacco.

[0006] According to an embodiment of the present application, the base sequence of NtMFP2 gene is shown in SEQ ID No. 1.

[0007] According to an embodiment of the present application, the NtMFP2 gene encodes a polypeptide shown in SEQ ID No. 2.

[0008] According to an embodiment of the present application, the regulation comprises increasing or decreasing the expression level of NtMFP2 gene in tobacco.

[0009] According to an embodiment of the present application, the method comprises decreasing the expression level of NtMFP2 gene in tobacco or knocking out NtMFP2 gene by CRISPR-Cas9, zinc finger nuclease, TALENs or RNAi gene silencing technology.

[0010] According to an embodiment of the present application, the decrease of the expression level of NtMFP2 gene in tobacco or the knockout of NtMFP2 gene is carried out by targeting the target site shown in SEQ ID No. 3 in NtMFP2 gene.

[0011] According to an embodiment of the present application, the NtMFP2 gene is knocked out by using the sgRNA sequence shown in SEQ ID No. 4 to adopt the CRISPR-Cas9 gene editing technology.

[0012] According to an embodiment of another aspect of the present application, there is provided an application of the NtMFP2 gene in tobacco, and the application comprises any one of the following applications:

[0013] (1) increasing the germination rate of tobacco seedlings;

[0014] (2) increasing the biomass of tobacco seedlings;

[0015] (3) increasing the content of short-chain and / or long-chain fatty acids in the tobacco seedling emergence period;

[0016] (4) for tobacco breeding;

[0017] (5) regulating the fatty acid content of tobacco leaves; and / or

[0018] (6) changing the flavor of tobacco.

[0019] According to an embodiment of another aspect of the present application, there is provided a homozygous non-transgenic mutant tobacco breeding method of the NtMFP2 gene, comprising:

[0020] constructing a knockout vector according to the sgRNA sequence shown in SEQ ID No. 4;

[0021] transferring the constructed knockout vector into an Agrobacterium competent cell and infecting tobacco leaves;

[0022] culturing and screening to obtain a homozygous non-transgenic mutant tobacco strain.

[0023] According to an embodiment of another aspect of the present application, there is provided a mutant gene of the NtMFP2 gene in tobacco, and the sequence of the mutant gene of the NtMFP2 gene in tobacco is that the GC base deletion occurs at the 15th and 16th bp of the target site base sequence shown in SEQ ID No. 3.

[0024] According to an embodiment of the present application, the NtMFP2 gene in tobacco can regulate the fatty acid content of tobacco leaves, and by regulating the expression of the gene, the biomass of tobacco seedlings under sugar-free and high-sugar culture conditions can be increased, the fatty acid content of tobacco leaves in the emergence period can be increased, and then high-fat leaves and excellent growth of tobacco seedlings can be realized. BRIEF DESCRIPTION OF DRAWINGS

[0025] The above and other objects, features and advantages of the present application will become more apparent from the following description of embodiments of the present application taken in conjunction with the accompanying drawings, in which:

[0026] The above and other objects, features and advantages of the present application will become more apparent from the following description of embodiments of the present application taken in conjunction with the accompanying drawings, in which:Figure 1 Figure 6 is an electrophoretogram of NtMFP2 gene amplification of an embodiment of the present application;

[0027] Figure 2 Figure 7 is a comparison chart of NtMFP2 expression in different tissues of an embodiment of the present application;

[0028] Figure 3 Figure 8 is a schematic diagram of construction of NtMFP2 gene knockout vector of an embodiment of the present application;

[0029] Figure 4 Figure 9 is a schematic diagram of editing forms of NtMFP2 target site of an embodiment of the present application;

[0030] Figure 5 Figure 10 is a chart of NtMFP2 mutant germination rate under different culture mediums of an embodiment of the present application;

[0031] Figure 6 Figure 11 is a chart of NtMFP2 mutant biomass under different culture mediums of an embodiment of the present application;

[0032] Figure 7 Figure 12 is a chart of NtMFP2 mutant short-chain fatty acid phenotype identification results in seedling stage of an embodiment of the present application;

[0033] Figure 8 Figure 13 is a chart of NtMFP2 mutant medium-long chain fatty acid phenotype identification results in seedling stage of an embodiment of the present application; (a) is a medium-long chain fatty acid clustering heat map; (b) is a column chart of NtMFP2 down-regulating medium-long chain fatty acid content compared with K326; (c) is a column chart of NtMFP2 up-regulating the top four medium-long chain fatty acid contents compared with K326. DETAILED DESCRIPTION

[0034] Hereinafter, embodiments of the present application will be described with reference to the accompanying drawings. It is to be understood, however, that the description is merely exemplary of the present application, and is not intended to limit the scope of the present application. In the following detailed description of the embodiments of the present application, numerous specific details are set forth in order to provide a thorough understanding of the present application. However, it will be apparent to one skilled in the art that the present application can be practiced without these specific details. In other instances, well-known structures and functions have not been described in detail in order to avoid obscuring aspects of the present application.

[0035] The terms used herein are merely used to describe specific embodiments, and are not intended to limit the present application. The term "include" used herein indicates the presence of a feature, step, operation, but does not exclude the presence or addition of one or more other features.

[0036] In the case of a statement such as "at least one of A, B, and C", generally this is to be interpreted to mean that the scope of the statement includes A alone, B alone, C alone, as well as either A and B, A and C, B and C, or A and B and C. In the case of a statement such as "at least one of A, B, or C", generally this is to be interpreted to mean that the scope of the statement includes A alone, B alone, C alone, as well as either A and B, A and C, B and C, or A and B and C.

[0037] The term "homology" refers to the level of similarity or percent identity between polynucleotide sequences in terms of percent nucleotide position identity (i.e., sequence similarity or identity). The term homology as used herein also refers to the concept of similar functional properties between different polynucleotide molecules, for example, promoters with similar functions can have homologous cis-elements. Polynucleotide molecules are homologous when they specifically hybridize under certain conditions to form a duplex molecule. Under these conditions (referred to as stringent hybridization conditions) one polynucleotide molecule can be used as a probe or primer to identify another polynucleotide molecule that shares homology.

[0038] The term "promoter" refers to a polynucleotide molecule that in its natural state is located upstream or 5' of the translation initiation codon of an open reading frame (or protein coding region) and is involved in the recognition and binding of RNA polymerase II and other proteins (trans-acting transcription factors) to initiate transcription.

[0039] The term "operably linked" refers to linkage of a first polynucleotide molecule (e.g., a promoter) to a second transcribable polynucleotide molecule (e.g., a gene of interest) in which the polynucleotide molecules are arranged such that the first polynucleotide molecule affects the function of the second polynucleotide molecule. Preferably, the two polynucleotide molecules are part of a single contiguous polynucleotide molecule and are more preferably adjacent. For example, a promoter is operably linked to a gene of interest if the promoter regulates or mediates transcription of the gene of interest in a cell.

[0040] The term "recombinant plant expression vector" refers to one or more DNA vectors used to effect plant transformation; these vectors are often referred to in the art as binary vectors. Binary vectors, along with vectors having helper plasmids, are most commonly used for Agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, a selectable marker engineered to be expressible in plant cells, a heterologous DNA sequence to be transcribed, etc.

[0041] The term "transformation" refers to the introduction of a heterologous DNA sequence into a host cell or organism.

[0042] The term "expression" refers to the transcription and / or translation of an endogenous gene or transgene in a plant cell.

[0043] The term "recombinant host cell strain" or "host cell" means a cell which contains a polynucleotide of the present application, whether or not the polynucleotide is integrated into the host genome, or maintained as a non-integrated vector, such as a plasmid, or otherwise. The host cell can be a prokaryotic or eukaryotic cell, and the host cell can be a monocotyledonous or dicotyledonous plant cell.

[0044] In the process of realizing the present concept, it is found that the related art indicates that the fatty acid oxidation β-oxidation multifunctional protein (MFP) in rice can regulate mRNA localization or translation in addition to its peroxisome function, and the seedlings of mfp2 mutant in Arabidopsis require exogenous sucrose supply to grow normally, and the mature plants show abnormal inflorescence meristem phenotype in the mutation of abnormal inflorescence meristem gene AIM1 (AtMFP2 homologous gene). It is shown that different MFP genes have different effects, and the Arabidopsis mfp2-1 and aim1 double mutants stop developing at the early stage of embryonic development. A MFP gene is also identified in tobacco, and when NtMFP is inhibited by RNAi, the transgenic tobacco shows dwarf, early senescence and reduced expression of jasmonic acid response gene phenotype.

[0045] At present, there is no related art to effectively change the fatty acid content in tobacco leaves by regulating the expression of MFP gene. Therefore, the research and application of the newly identified NtMFP2 gene can not only obtain tobacco with high fatty acid content, but also provide a new strategy for tobacco quality breeding. The present application is proposed in this background, and aims to provide a technical scheme for improving the fatty acid content in tobacco leaves by regulating the expression of NtMFP2 gene, so as to improve the quality of tobacco, obtain high-fat and excellent style tobacco leaves, and then realize the improvement of economic benefit.

[0046] According to an embodiment of one aspect of the present application, a method for regulating the fatty acid content in tobacco is provided, which comprises the step of regulating the expression level of NtMFP2 gene in tobacco.

[0047] According to the embodiment of the present application, the NtMFP2 gene in tobacco can regulate the content of fatty acid in tobacco leaves, and by regulating the expression of the gene, the biomass of tobacco seedlings can be increased under the conditions of no sugar and high sugar culture, the content of fatty acid in the leaves of tobacco seedlings at the seedling stage can be increased, and then high-fat leaves and excellent growth of tobacco seedlings are realized.

[0048] In some specific embodiments of the present application, the editing vector of the NtMFP2 gene can be constructed by a conventional gene editing technology or a construction method of a gene knockout vector, or a recombinant plant expression vector containing the NtMFP2 gene can be constructed according to a conventional method in the art, which are all familiar to those skilled in the art; for example, the NtMFP2 gene is operably linked to an expression regulatory element to obtain a recombinant plant expression vector that can express the gene in plants; the recombinant plant expression vector comprises a promoter, a CDS sequence of the NtMFP2 gene and a terminator; the promoter can be a constitutive promoter, an inducible promoter, a tissue or organ specific promoter, and the terminator sequence can be taken from a Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase termination region. The vector can also contain a selectable marker gene for selecting transformed cells, for selecting transformed cells or tissues. The marker gene includes: a gene encoding antibiotic resistance and a gene conferring herbicide resistance, etc.

[0049] In some specific embodiments of the present application, a kit for regulating the content of fatty acid in tobacco is provided, which comprises an editing vector of the NtMFP2 gene constructed by a conventional gene editing technology or a construction method of a gene knockout vector, or a recombinant plant expression vector containing the NtMFP2 gene constructed according to a conventional method in the art, and other conventional optional components, such as a marker gene, etc., or necessary components required for selecting a gene editing method, etc.

[0050] According to the embodiment of the present application, the base sequence of the NtMFP2 gene is shown in SEQ ID No. 1.

[0051] The sequence of SEQ ID No. 1 is shown as follows:

[0052] ATGAGCTCAAAGAGTAGAAGTACCATTGAGGTTGGAGCTGATGGAGTTGCTGTTATCACCATTGTTAACCCTCCTGTCAATTCTCTTTCCTTAGATGTTTTGTACAGCTTGGAAGAGAAATTACAGGAAGGCTTAAGGAGAGATGATGTGAAGGCAATTGTTGTGATAGGTTATCAAGGAAATTTCTCGGGTGGTTTCCATATCTCT TCCTTTGCTGACTTGCAACA

[0053] According to an embodiment of the present application, the NtMFP2 gene encodes a polypeptide as shown in SEQ ID No. 2.

[0054] The sequence of SEQ ID No. 2 is shown as follows:

[0055] MSSKSRSTIEVGADGVAVITIVNPPVNSLSLDVLYSLEEKLQEGLRRDDVKAIVVIGYQGNFSGGFHISSFADLQQGKVAQPKPGYVSVDILTDTVEAARKPFVAAIDGHALGGGLEIAMCCHARISTPNAQLGLPELHLGIIPGFGGTQRLPRLTAKLAKGEEALDLGLVDAIVSPNQLLETARKWALDIWERKRPWIPTLNRNDKVESVSDAKDILKFARAQAIKQAPNLYHPLAYIDVIEEGVVSGPRAGLMKEYETFEVLLRSDTCKALVHIFFARRGTTKVPGVTDLGLVPRHVKKVAIVGGGLMGSGIATAFLLSNYAVILKEVNDKFLEAGIDRQICNATLKGKLSEEKFEKALSLLKGTLDYESFKDVDMAVTEDVPLKQQIFIDLEKFCPPHCILASNTSTIDLNLIGERTKSQDRIIGAHFFSPAHVIPLLEIVRAQQTSPQVIVDLLDVGKKIKKTPVVVRNCTGFAVNRMFFPYTQAALLLVEHGTDMYCIDRAFTKFGMHMGPFRLCDLIGIGVAMATEAQFILNMPDRTYKSMLIPLMQQDKRLGETTQRGFYIYDERCKAKPDPEIKKYIEKARDISGVSTDTKLEKLSDKDIVEMISFPVVNEACRLLAEGIAVKAADLDIASVMGTSVMF*.

[0056] According to an embodiment of the present application, NtMFP2 is a gene encoding a multifunctional protein (MFP) for peroxisomal fatty acid beta-oxidation. The catabolism of fatty acids is mainly carried out through the beta-oxidation cycle, and the multifunctional protein MFP has hydrase, dehydrogenase, isomerase and epimerase activities, catalyzing the hydration step of beta-oxidation. MFP is mainly located in peroxisomes and is induced during development and growth.

[0057] According to an embodiment of the present application, the regulation comprises increasing or decreasing the expression level of the NtMFP2 gene in tobacco.

[0058] According to an embodiment of the present application, the decreasing of the expression level of the NtMFP2 gene in tobacco or the knockout of the NtMFP2 gene is achieved by CRISPR-Cas9, zinc finger nuclease, TALENs or RNAi gene silencing technology.

[0059] In some specific embodiments of the present application, how to increase or decrease the expression level of the NtMFP2 gene in tobacco can be achieved by various conventional technical means by those skilled in the art; for example, by constructing an overexpression vector of the NtMFP2 gene, by Agrobacterium-mediated genetic transformation to obtain an overexpression strain of the NtMFP2 gene; or by CRISPR, VIGS method to knockout or interfere with the NtMFP2 gene in tobacco or the NtMFP2 homologous gene in other plants, so as to cause deletion or mutation of the NtMFP2 gene in tobacco or the NtMFP2 homologous gene in other plants or decrease the expression level of the NtMFP2 gene, thereby achieving regulation of the fatty acid content in tobacco.

[0060] According to an embodiment of the present application, by CRISPR-Cas9, zinc finger nuclease, TALENs or RNAi gene silencing technology, the expression of peroxisomal fatty acid beta-oxidation multifunctional protein can be achieved by decreasing the expression level of the NtMFP2 gene, thereby regulating the fatty acid content in tobacco; the knockout of the NtMFP2 gene can also achieve regulation of the fatty acid content in tobacco. The regulation mode or knockout mode of the NtMFP2 gene in the present application is not specifically limited, and the target site of the regulation mode or knockout mode of the expression level of various genes can be selected according to various modes, and one or more target sites can be selected for regulation or knockout of the expression level of the gene.

[0061] According to an embodiment of the present application, the decreasing of the expression level of the NtMFP2 gene in tobacco or the knockout of the NtMFP2 gene is achieved by targeting the target site shown in SEQ ID No. 3 of the NtMFP2 gene.

[0062] According to an embodiment of the present application, the regulation of the expression level of the NtMFP2 gene or the knockout of the NtMFP2 gene is located at 207bp~227bp in the base sequence of the NtMFP2 gene, i.e. the underlined part, as shown in SEQ ID No. 1.

[0063] The sequence of the target site SEQ ID No. 3 is as follows:

[0064] TCCTTTGCTGACTTGCAACA.

[0065] According to an embodiment of the present application, the NtMFP2 gene is knocked out by using the sgRNA sequence shown in SEQ ID No. 4 through the CRISPR-Cas9 gene editing technology.

[0066] According to an embodiment of the present application,

[0067] The sgRNA sequence is shown in SEQ ID No. 4:

[0068] TCCTTTGCTGACTTGCAACAAGG.

[0069] According to an embodiment of the present application, the NtMFP2 gene in tobacco is knocked out by using the CRISPR-Cas9 gene editing technology, and corresponding primers are designed according to the sgRNA sequence corresponding to the target site, so that efficient gene editing can be realized in various cell types and species, the success rate and efficiency of gene editing are improved, and the sgRNA sequence shown in SEQ ID No. 4 can specifically recognize and cut the target site SEQ ID No. 3 sequence in the NtMFP2 gene, so as to realize precise gene knockout.

[0070] According to an embodiment of the present application, the NtMFP2 gene in tobacco is knocked out by using the CRISPR-Cas9 gene editing technology, and corresponding primers are designed according to the sgRNA sequence corresponding to the target site, so that efficient gene editing can be realized in various cell types and species, the success rate and efficiency of gene editing are improved, and the sgRNA sequence shown in SEQ ID No. 4 can specifically recognize and cut the target site SEQ ID No. 3 sequence in the NtMFP2 gene, so as to realize precise gene knockout.

[0071] (1) increasing the germination rate of tobacco seedlings;

[0072] (2) increasing the biomass of tobacco seedlings;

[0073] (3) increasing the content of short-chain and / or long-chain fatty acids in tobacco seedlings during the emergence period;

[0074] (4) for tobacco breeding;

[0075] (5) regulating the fatty acid content of tobacco leaves; and / or

[0076] (6) changing the flavor of tobacco.

[0077] According to an embodiment of the present invention, knocking out the NtMFP2 gene using CRISPR-Cas9 technology can significantly improve the germination rate of tobacco seedlings. This is because knocking out the NtMFP2 gene may reduce the influence of certain adverse factors in fatty acid metabolism, thereby promoting seedling germination; after knocking out the NtMFP2 gene, the biomass of tobacco seedlings increases significantly, possibly due to changes in fatty acid metabolism pathways, allowing more energy and nutrients to be allocated to growth and development; knocking out the NtMFP2 gene using CRISPR-Cas9 technology can increase the content of short-chain and long-chain fatty acids in tobacco seedlings at the emergence stage, helping to improve the stress resistance and quality of tobacco; knocking out or regulating the NtMFP2 gene can be an important means of tobacco breeding, and through gene editing technology, tobacco varieties with higher germination rates, larger biomass, and better stress resistance can be bred; knocking out the NtMFP2 gene using CRISPR-Cas9 technology can effectively regulate the fatty acid content in tobacco leaves, helping to optimize the chemical composition of tobacco and improve its quality and economic value; changes in fatty acid metabolism pathways may affect the flavor of tobacco, and knocking out the NtMFP2 gene can alter the flavor of tobacco to better meet market demands.

[0078] According to another embodiment of the present invention, a method for breeding homozygous non-transgenic tobacco mutants of the NtMFP2 gene is provided, comprising:

[0079] A knockout vector was constructed based on the sgRNA sequence shown in SEQ ID No. 4;

[0080] The constructed knockout vector was transferred into Agrobacterium competent cells and infected tobacco leaves;

[0081] Homozygous, non-transgenic mutant tobacco lines were obtained through cultivation and screening.

[0082] According to the embodiments of the present invention, tobacco plants with homozygous non-transgenic mutants can be obtained rapidly and efficiently by knocking out the NtMFP2 gene in tobacco breeding. Agrobacterium competent cells can be used as host cells to screen for lines with homozygous editing of the NtMFP2 gene, obtaining T0 generation transgenic positive lines. In the T1 generation, one non-transgenic homozygous line can be obtained.

[0083] According to another embodiment of the present invention, a mutant gene of the tobacco NtMFP2 gene is provided, wherein the mutant gene sequence of the tobacco NtMFP2 gene is characterized by GC base deletion at the 15th and 16th bp of the target site sequence shown in SEQ ID No. 3.

[0084] According to the embodiment of the present application, the NtMFP2 gene target site is deleted by CRISPR-Cas9 technology, and the mutation type is a frameshift mutation.

[0085] The present application will be further explained in conjunction with specific examples. In the following examples, if not specifically stated, all reagents are commercially available.

[0086] Example 1 Amplification of NtMFP2 gene

[0087] According to the genomic and expression information of tobacco genome database and RNA-seq database, specific primers are designed to specifically amplify NtMFP2 gene using tobacco bud CDS as a template, and the electrophoretogram is shown in Figure 1 .

[0088] Amplification primer:

[0089] BD-NtMFP2 F, the sequence is shown in SEQ ID No. 5 as follows:

[0090] GCCATGGAGGCCGAATTC ATGAGCTCAAAGAGT .

[0091] BD-NtMFP2 R, the sequence is shown in SEQ ID No. 6 as follows:

[0092] CTGCAGGTCGACGGATCC TCAGAACATAACAGA .

[0093] The first half of the amplification primer is a specific primer for the target gene, and the underlined part in the second half is a homologous arm of the sequencing vector.

[0094] Figure 1 The electrophoretogram of NtMFP2 gene amplification in the present application example.

[0095] According to Figure 1 It can be seen that NtMFP2 gene is successfully amplified, and the size is about 2000 bp.

[0096] After the gene is constructed into a sequencing vector, the sequence information of the gene is obtained by first-generation sequencing.

[0097] NtMFP2 is 1944 bp long, the sequence is shown in SEQ ID No. 1, and it encodes 647 amino acids, and the amino acid polypeptide sequence is shown in SEQ ID No. 2. Sequence alignment shows that the gene has three homologous genes in tobacco, and two are similar.

[0098] Example 2 Detection of tissue-specific expression

[0099] Samples were collected from different tissues of different tobacco plants, including young leaves, mature leaves, petioles, veins, stems, roots, and flower buds.

[0100] High-throughput sequencing technology was used to sequence the extracted RNA to obtain expression data of the NtMFP2 gene in different tissues. The results are as follows: Figure 2 As shown.

[0101] Figure 2 This is a comparison diagram of NtMFP2 expression in different tissues according to an embodiment of the present invention.

[0102] according to Figure 2 It can be seen that the NtMFP2 gene is expressed at the highest level in the flower bud, while its expression level is relatively low in other parts, i.e., TPM<1.

[0103] Example 3 Construction of NtMFP2 gene knockout vector

[0104] Primers were designed based on the sgRNA sequence shown in SEQ ID No. 4.

[0105] The primers for the double-stranded sgRNA are shown below:

[0106] The BsaI-sgRNA-F sequence is shown in SEQ ID No. 7:

[0107] 5'-TGCATCCTTTGCTGACTTGCAACA.

[0108] The BsaI-sgRNA-R sequence is shown in SEQ ID No. 8:

[0109] 5'-AAACTGTTGCAAGTCAGCAAAGGA.

[0110] The target product, double-stranded sgRNA with adapter, was obtained after annealing and purified. The linearized gene editing vector and the target product were ligated using T4 DNA ligase. The ligated product was transformed into DH5α competent E. coli cells. The transformed E. coli were plated on LB acclimatization plates containing antibiotics (kanamycin, Kansin) and incubated overnight at 37°C inverted position for screening positive clones. Single colonies with accurate sequencing were selected, cultured, and plasmids were extracted to complete the construction of the target product. Figure 3 As shown.

[0111] Figure 3 This is a schematic diagram illustrating the construction of the NtMFP2 gene knockout vector in an embodiment of the present invention.

[0112] Example 4: NtMFP2 homozygous non-transgenic mutant

[0113] The NtMFP2 gene knockout vector plasmid obtained in Example 3 is transformed into Agrobacterium competent LBA4404 using the electric shock transformation method, and after transformation, SOC medium is added and cultured at 30°C at 100 rpm for 1 h. After culture, the bacterial solution is spread on LB plates containing rifampicin (Rif) and kanamycin (Kan), and after 48 h of inverted culture at 30°C, single colonies are selected, and the LB liquid culture medium containing the same resistance is cultured at 28°C at 200 rpm for 16 h. After culture, the bacteria are preserved (600 μL of bacterial solution + 600 μL of 50% glycerol), and after correct verification by PCR, the bacterial solution is expanded and used for tobacco genetic transformation.

[0114] K326 variety as the chassis, the tobacco leaf is infected by leaf disc method. The T0 generation transgenic positive strain is screened by kanamycin resistance screening and transgenic molecular identification, and sequencing is performed using target site detection primers. The sequence of the target site detection primer is as follows.

[0115] The sgRNA JC-F sequence is shown in SEQ ID No. 9:

[0116] 5'-TTAGGTTTACCCGCCAATA-3'.

[0117] The sgRNA JC-R sequence is shown in SEQ ID No. 10:

[0118] 5'-CGGTGCCACTTTTTCAAGTT-3'.

[0119] The NtMFP2 gene homozygous editing strain is screened, and the T0 generation transgenic positive strain is obtained. In the T1 generation, the transgenic and target site sequencing identification are used to screen a non-transgenic homozygous strain. One generation sequencing determines that the NtMFP2 gene target site of the strain has a "GC" base deletion, and the mutation type is a frameshift mutation, as shown below. Figure 4

[0120] Figure 4 The editing form of the NtMFP2 target site of the embodiment of the application is shown in the figure.

[0121] According to Figure 4 It can be seen that the 15th and 16th bp of the NtMFP2 target site have a "GC" base deletion.

[0122] Example 5: Phenotype analysis of NtMFP2 mutant

[0123] The germination rate of the NtMFP2 mutant is determined by configuring different MS culture media, i.e. adding M519 4.43 g, sucrose 25 g, adjusting the pH value to 5.8, and then adding agar 9 g to 1000 mL of culture medium. The change in germination rate under different culture conditions is analyzed.​

[0124] Among them, normal MS medium as a control group, two times sucrose (sucrose 50 g) high sugar MS medium and no sugar MS medium without adding sucrose as the experimental group. The seeds are placed in different culture media after vernalization at 4℃ for three days, and then placed in a constant temperature photoperiod culture room at 25℃. The results are shown in Figure 5 .

[0125] The phenotype of NtMFP2 mutant 18-day-old seedlings in different culture media is analyzed and counted, and the results are shown in Figure 6 .

[0126] Figure 5 The NtMFP2 mutant germination rate statistical graph under different culture media of the embodiment of the application is shown in Figure 6 The NtMFP2 mutant biomass statistical graph under different culture media of the embodiment of the application is shown in

[0127] According to Figure 5 It can be seen that the germination rate of NtMFP2 and the control group K326 (CK) is similar in the normal medium, and K326 is slightly higher than NtMFP2; the control and NtMFP2 both germinate in advance under the culture condition without sugar, NtMFP2 basically germinates on the fifth day and the germination rate of NtMFP2 is higher than that of the control; the germination of the control and NtMFP2 is inhibited in the 2 times sucrose medium, and the germination rate on the fourth day is much lower than that in the sugar-free culture medium and the normal culture medium, and the germination rate of NtMFP2 is higher than that of the control. It is shown that the NtMFP2 mutant has the phenotype of increasing the germination rate under the culture conditions without sugar and high sugar.

[0128] According to Figure 6 It can be seen that the leaf area of the mutant is significantly higher than that of the control group under the culture condition of 2 times sugar, and the maximum leaf length of the mutant is significantly higher than that of the control under the culture condition without sugar. It is shown that the NtMFP2 mutant has the phenotype of increasing the biomass under the culture conditions without sugar and 2 times sugar.

[0129] Example 6: Phenotype identification of short-chain fatty acids of NtMFP2 mutant seedlings

[0130] The short-chain fatty acid content of two cotyledons of NtMFP2 mutant and control K326 seedlings, i.e. 10-day-old seedlings after germination, is measured. Targeted metabolomics is used to detect short-chain fatty acids and medium-chain fatty acids, and the detection method uses an LC / MS platform based on multiple reaction monitoring mode (MRM) to detect the content. After the steps of sample collection, target metabolite extraction, standard curve establishment, method verification, LC-MS / MS detection, data analysis is carried out, and a total of 10 kinds of short-chain fatty acids are detected. The results are shown in Figure 7 .

[0131] Figure 7 Figure for phenotype identification of NtMFP2 mutant seedling stage short-chain fatty acid in the embodiment of the application.

[0132] According to Figure 7 It can be seen that 9 of the 10 short-chain fatty acids were significantly up-regulated in NtMFP2 compared with K326 (FC>1.2 or FC<0.833 and P-value<0.05), and the content of K326 isovaleric acid was 0.06 μg / g, and the content of NtMFP2 mutant was 0.08 μg / g, which was increased by 1.33 times. It can be shown that the NtMFP2 mutant has the phenotype of high content of short-chain fatty acids in the leaves of seedling stage, and it can be proved that the NtMFP2 gene can regulate the content of short-chain fatty acids in tobacco leaves.

[0133] Example 7 Phenotype identification of NtMFP2 mutant seedling stage medium and long-chain fatty acids

[0134] The same method as in Example 6 was used to determine the content of medium and long-chain fatty acids, and the results of 39 fatty acids determined are shown in Figure 8

[0135] Figure 8 Figure for phenotype identification of NtMFP2 mutant seedling stage medium and long-chain fatty acids in the embodiment of the application; (a) is a cluster heat map of medium and long-chain fatty acids; (b) is a columnar chart of down-regulation of medium and long-chain fatty acid content in NtMFP2 compared with K326; (c) is a columnar chart of the top four medium and long-chain fatty acid contents up-regulated in NtMFP2 compared with K326.

[0136] In Figure 8 , C number is the name of fatty acid, reflecting the number of carbon atoms, the number of double bonds and position.

[0137] According to Figure 8 It can be seen that of the 39 fatty acids determined, 2 fatty acids were significantly down-regulated in NtMFP2 compared with K326, C12:0 was down-regulated to 0.74 times, and C18:1(n-7)T was down-regulated to 0.43 times; 24 substances were significantly up-regulated, up-regulated to 1.23-7.80 times, and the top 4 substances with the highest up-regulation were C15:1 up-regulated to 4.07 times, C19:1(n-9)T up-regulated to 4.73 times, C22:2 up-regulated to 6.83 times, and C20:5 up-regulated to 7.80 times. Cluster analysis showed that the content of medium and long-chain fatty acids of NtMFP2 was higher than that of K326 except for two fatty acids, which can prove that the NtMFP2 gene can regulate the content of medium and long-chain fatty acids in tobacco leaves.

[0138] ​The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application. It should be understood that the above are only specific embodiments of the present application and are not intended to limit the present application. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A method for increasing the fatty acid content in tobacco leaves, comprising the step of reducing the expression level of the NtMFP2 gene in tobacco, said NtMFP2 gene encoding the protein shown in SEQ ID No.

2.

2. The method according to claim 1, wherein, The base sequence of the NtMFP2 gene is shown in SEQ ID No.

1.

3. The method according to any one of claims 1 to 2, wherein, The method includes the step of knocking out the NtMFP2 gene in tobacco using CRISPR-Cas9, zinc finger nucleases, TALENs, or RNAi gene silencing technology.

4. The method according to claim 3, wherein, The expression level of the NtMFP2 gene in tobacco was reduced by targeting the site shown in SEQ ID No. 3 of the NtMFP2 gene.

5. The method according to claim 4, wherein, The NtMFP2 gene was knocked out using CRISPR-Cas9 gene editing technology based on the sgRNA sequence shown in SEQ ID No.

4.

6. Application of the NtMFP2 gene in tobacco, among which, The application includes any of the following applications, wherein the NtMFP2 gene encodes the protein shown in SEQ ID No. 2: (1) Improving the germination rate of tobacco seedlings by knocking out the NtMFP2 gene; (2) Increase the biomass of tobacco seedlings by knocking out the NtMFP2 gene; (3) Increase the content of short-chain and / or long-chain fatty acids in tobacco seedlings during the emergence period by knocking out the NtMFP2 gene.

7. A method for breeding homozygous non-transgenic mutant tobacco of the NtMFP2 gene, wherein, The base sequence of the NtMFP2 gene is shown in SEQ ID No. 1, and the method includes: constructing a knockout vector according to the sgRNA sequence shown in SEQ ID No. 4; The constructed knockout vector was transferred into Agrobacterium competent cells and infected tobacco leaves; Homozygous non-transgenic mutant tobacco lines were obtained through cultivation and screening.

Images