Application of PtoELF3.1 gene in creating non-dormant evergreen poplars

By knocking out the poplar PtoELF3.1 gene through CRISPR/Cas9 technology, the dormancy period during its seasonal growth process was changed, solving the problem of poplar trees remaining evergreen under short-day conditions, extending the growth period and increasing biomass accumulation.

CN119614618BActive Publication Date: 2025-09-23SOUTHWEST UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510074225.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-17
Publication Date
2025-09-23
Estimated Expiration
2045-01-17

AI Technical Summary

Technical Problem

Poplars enter dormancy in autumn and winter, which limits their growth period and photosynthetic carbon fixation. Existing technologies have failed to effectively alleviate their sensitivity to short-day light, affecting biomass accumulation.

Method used

The poplar PtoELF3.1 gene was knocked out through the CRISPR/Cas9 editing system, changing its dormancy period during seasonal growth, allowing it to remain evergreen under short-day conditions. The poplar PtoELF3.1 gene was edited using CRISPR/Cas9 technology to create poplar germplasm that does not enter dormancy.

Benefits of technology

It extends the growing period of poplar trees, improves photosynthetic carbon fixation and biomass accumulation, enables poplar trees to remain evergreen under short-day conditions, and adapts to the growth needs of different climatic conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119614618B_ABST
    Figure CN119614618B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of the PtoELF3.1 gene in creating non-dormant evergreen poplars, belonging to the fields of biotechnology and molecular biology. The poplar ELF3.1 gene is a protein encoding the amino acid sequence shown in SEQ ID No. 1. By targeting the PtoELF3.1 gene with the CRISPR / Cas9 gene editing system, a Ptoelf3.1 mutant strain of Populus tomentosa was obtained. Compared with wild-type (WT) Populus tomentosa plants, the Ptoelf3.1 mutant plants still maintained an evergreen phenotype with non-dormant terminal and lateral buds under short-day conditions in autumn and winter. The present invention shows that knocking out the PtoELF3.1 gene causes the poplar to be insensitive to short-day conditions and lacks a response to seasonal changes, thereby maintaining an evergreen, non-dormant growth state. The present invention has great application prospects in improving photosynthetic carbon fixation in forests, increasing timber yield, and creating ornamental tree germplasm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the fields of biotechnology and molecular biology, and particularly relates to the application of a poplar biological clock gene PtoELF3.1 in seasonal growth regulation. Background Art

[0002] Trees growing in temperate and boreal forests exhibit distinct seasonal characteristics: budding in spring, vigorous growth in summer, dormancy and leaf drop in autumn, and dormancy in winter. Poplar (Populus L.), a fast-growing tree species primarily used for timber and landscaping in my country, exhibits a typical seasonal growth pattern. Growth cessation and dormancy in autumn and winter restrict photosynthetic carbon sequestration and wood production. Seasonal growth is primarily regulated by two environmental factors: photoperiod and temperature. Short-day conditions in autumn are the primary factor in dormancy in poplars. When trees perceive short-day conditions, their apical meristems cease growth, and bud scales, formed by the metamorphosis of stipules, encase the apical meristem and leaf primordia to adapt to the winter's low temperature stress (Maurya and Bhalerao, 2017; Singh et al., 2017). However, persistent low temperatures in winter are essential for breaking dormant buds. Low temperatures cause dormant buds to return to an ecologically dormant state, enabling them to respond to the long, warm days of spring, breaking green and resuming a new cycle of growth. Perennial trees undergo this repetitive cycle of growth and dormancy, which is crucial for their ability to adapt to different latitudes and altitudes. The further north a tree grows, or the higher its altitude, the earlier it enters dormancy and the later it sprouts in spring (Nilsson, 2022). Therefore, understanding the mechanisms regulating seasonal tree growth is crucial for developing diverse forest germplasm that can adapt to climate change and meet human needs.

[0003] The circadian clock is considered a crucial mechanism for connecting plants to the external environment, regulating all aspects of plant growth and development. Currently, the circadian clock system can be simplified into three processes: the input pathway, the core oscillator, and the output pathway. The plant circadian clock core oscillator is primarily composed of three interconnected transcriptional-translational feedback loops: the morning loop, the central loop, and the evening loop (Wei Hua, Wang Yan, Liu Baohui, & Wang Lei, 2018). The circadian clock helps organisms anticipate cyclical changes in the environment and adjust their activities in advance, thereby enhancing their environmental adaptability and optimizing their growth economy. LHY and CCA1 are MYB-like transcription factors expressed in the morning and inhibit the transcription of circadian clock-related genes expressed from morning to evening. The evening loop is primarily regulated by GI, EC (Evening Complex), and TOC1. The evening complex (EC), composed of proteins encoded by EARLY FLOWERING 3 (ELF3), ELF4, and the transcription factor-encoding gene LUXARRHYTHMO (LUX), directly regulates plant growth. This complex is circadian, reaching its peak activity at dusk (Nusinow et al., 2011; Nakamichi, 2020). ELF3, acting as a scaffolding protein, directly binds to ELF4 and LUX. LUX, a MYB-like transcription factor, recruits EC to the promoters of target genes, repressing their expression. ELF3 and LUX have been reported in model plants such as Arabidopsis, soybean, rice, and maize to participate in the output pathways that maintain and regulate circadian oscillations and photoperiodic flowering (Yu et al., 2008; Yang et al., 2013; Lu et al., 2017; Bu et al., 2021; Zhao et al., 2023). However, the function of the poplar circadian clock gene ELF3 in tree growth remains unclear, and whether it plays a role in seasonal growth in poplars warrants further investigation. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a method for changing the dormancy period of poplar trees in their seasonal growth process, losing their sensitivity to short-day light, extending the tree growth period and increasing their biomass.

[0005] The technical solution of the present invention is: the application of the poplar PtoELF3.1 gene in regulating the transition from dormancy to dormancy during seasonal growth of poplars. The poplar PtoELF3.1 gene is a gene encoding a protein with the amino acid sequence shown in SEQ ID No.1.

[0006] Furthermore, the application is to knock out the PtoELF3.1 gene through the CRISPR / Cas9 editing system, thereby obtaining poplar germplasm that does not enter a dormant period and remains evergreen under short-day conditions in autumn.

[0007] Furthermore, the nucleotide sequence of the poplar PtoELF3.1 gene is shown as SEQ ID No.2.

[0008] A method for constructing a poplar plant line that does not enter an autumn dormancy period comprises the following steps:

[0009] (1) Using CRISPR / Cas9 editing technology, an editing vector targeting the poplar PtoELF3.1 gene was constructed;

[0010] (2) Genetic transformation of Populus tomentosa: The editing vector constructed in step (1) was transferred into sterile young wild-type Populus tomentosa leaves using the Agrobacterium-mediated leaf disc method.

[0011] (3) Identification of transgenic plants: positive plants were identified through poplar tissue culture and DNA extraction.

[0012] Furthermore, the editing vector targeting the PtoELF3.1 gene expresses the sgRNA of the nucleotide sequence shown in SEQ ID No. 3 or / and 4.

[0013] A sgRNA targeting the poplar PtoELF3.1 gene, wherein the sgRNA nucleotide sequence is shown in either SEQ ID No. 3 or SEQ ID No. 4.

[0014] A gene editing vector expressing an sgRNA having a nucleotide sequence shown in SEQ ID No. 3 or / and SEQ ID No. 4.

[0015] The present invention provides the application of the circadian clock gene PtoELF3.1 in sensing and regulating seasonal changes. Using CRISPR / Cas9 transgenic technology, the PtoELF3.1 gene in Populus tomentosa was edited, resulting in base deletions or insertions at the target sites of the PtoELF3.1 gene. The results showed that the Ptoelf3.1-L1 mutant had a single insertion at the T1 target site and a three-base deletion at the T2 target site. The Ptoelf3.1-L2 mutant had a total of 104 base deletions from the T1 to T2 target sites. Under long-day conditions in a normal greenhouse, the Ptoelf3.1 mutant plants exhibited a significant increase in the number of lateral branches compared to wild-type plants. After culturing wild-type and Ptoelf3.1 mutant plants of Populus tomentosa under long-day conditions (16 hours light / 8 hours dark) for two months, some were transferred to short-day conditions (8 hours light / 16 hours dark), while others (the control group) continued to be cultured under long-day conditions. Approximately three weeks after the short-day treatment, the terminal buds of the WT poplars stopped growing, while those of the Ptoelf3.1 mutant plants maintained high growth activity under short-day conditions. After 15 weeks of short-day treatment, the terminal buds of the WT poplars had entered a state of internal dormancy, while those of the Ptoelf3.1 mutant plants were still growing. Under natural outdoor light conditions in Chongqing, WT plants stopped growing and entered a dormant state in October and November, while the Ptoelf3.1 mutant had not entered dormancy by the end of December. Combined indoor and outdoor experiments showed that the Ptoelf3.1 mutant plants had lost their perception of the photoperiod and could still maintain growth under short-day conditions (autumn and winter), remaining evergreen and leafless, which could increase the photosynthetic carbon fixation and biomass accumulation of trees.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] This study demonstrates that knocking out the PtoELF3.1 gene can alter the dormancy transitions of poplar trees during their seasonal growth. This approach, which prevents dormancy and allows them to remain evergreen under short-day conditions in autumn, has significant potential applications in extending the tree's growth period and increasing photosynthetic carbon fixation and biomass accumulation. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 .Creation of Populus tomentosa Ptoelf3.1 mutant materials; (A) Gene structure of Populus tomentosa PtoELF3.1 and design of sgRNA targets (T1, T2); (B) Analysis of genotype sequencing results of Populus tomentosa Ptoelf3.1 mutant materials (two lines, L1 and L2).

[0019] Figure 2Phenotypic observation of the Ptoelf3.1 mutant of Populus tomentosa; (A) Growth phenotypes of wild-type (WT) and Ptoelf3.1 mutant plants of Populus tomentosa under long-day conditions; (B) Statistical analysis of the number of lateral branches of WT and Ptoelf3.1 plants; (C) Terminal bud phenotypes of WT and Ptoelf3.1 plants after short-day (SD, 8 h light / 16 h dark) treatment in the greenhouse; (D) Phenotypic observation of WT and Ptoelf3.1 plants of Populus tomentosa cultivated in the wild in Chongqing during winter. DETAILED DESCRIPTION

[0020] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0021] (1) Construction of CRISPR / Cas9 knockout vector for the PtoELF3.1 gene

[0022] First, the sequence of the Populus tomentosa ELF3.1 gene (gene ID: Potri.006G233800) was downloaded from the Phytozome database, and gene-specific primers were designed. Using a Populus tomentosa cDNA library as a template, the PtoELF3.1 gene was amplified and sequenced to obtain the accurate PtoELF3.1 gene sequence (e.g., SEQ ID No. 2, encoding the protein as SEQ ID No. 1). SnapGene Viewer software was then used to design PtoELF3.1 gene-specific target sequences (sgRNA design). To ensure gene editing efficiency, two optimal target sequences were designed for each gene.

[0023] Table 1 Designed sgRNA sequences

[0024] target genes Target T1 Target T2 PtoELF3.1 GAGGGCCTAGAGCTCCCCCAAGG ACTAGCGACTTAGCTCCTACAGG

[0025] These target sequences were then linked into the pYLCRISPR / Cas9P35S-N vector through homologous recombination, and the vector was verified to be correct by PCR sequencing before transformation into Agrobacterium.

[0026] (2) Genetic transformation and genotype identification of Populus tomentosa

[0027] Using Populus tomentosa as the recipient material, the successfully constructed CRISPR / Cas9 vector was introduced into poplar leaves through the Agrobacterium-mediated leaf disc method, and positive transgenic plants with kanamycin resistance were screened through poplar tissue culture.

[0028] First, the successfully constructed CRISPR / Cas9 vector was transformed into Agrobacterium GV3101 and cultured on YEP solid medium (containing 50 mg / L Kan + 40 mg / L Rif) in a 28°C incubator for 2 days. Then, a single clone was picked and inoculated into YEP liquid medium (containing 50 mg / L Kan + 40 mg / L Rif) and cultured in a shaking incubator at 28°C overnight until OD600 was 0.8-1.0. The overnight cultured Agrobacterium was inoculated into YEP liquid medium (containing 50 mg / L Kan + 400 mg / L Rif) at a ratio of 1:50 and cultured in a shaking incubator at 28°C until OD600 was 0.8-1.0. 600 To 0.4-0.6; then centrifuge in a 4°C cold centrifuge at 4000rpm for 10 minutes, collect the bacteria, resuspend them in WPM resuspension solution supplemented with AS, add the resuspension solution to 50mL, and shake incubate at 28°C for 40 minutes for transformation. Select sterile, well-grown poplar leaves, cut into 4-6mm leaf discs in a clean bench, and place them in the shaken culture solution for 7-10 minutes, shaking three times during the process. Then, use sterile paper to dry the surface of the leaf disc and place it on the co-cultivation medium for dark incubation for 2 days. After 2 days, transfer to a medium with kanamycin resistance and culture in the dark for about 4 weeks until callus grows and is transferred to a budding medium with kanamycin resistance. When the adventitious buds grow to approximately 2cm, they are cut and transferred to a rooting medium with kanamycin to induce rooting.

[0029] To identify its genotype, plant leaves were taken and DNA was extracted using the CTAB method. Gene fragments containing the target sequence of the PtoELF3.1 gene were amplified using specific primers, and accurate genotype information was obtained through PCR sequencing. The specific results showed that in the Ptoelf3.1 mutant L1, there was a 1-base insertion in the T1 target site of the PtoELF3.1 gene and a 3-base deletion in the T2 target site. In the Ptoelf3.1 mutant L2, there was a 104-base deletion between the T1 and T2 target sites of the PtoELF3.1 gene ( Figure 1 ).

[0030] (3) Observation of seasonal growth phenotype of Populus tomentosa Ptoelf3.1 mutant

[0031] After culturing wild-type WT and Ptoelf3.1 Populus tomentosa under long-day conditions (16h light / 8h dark) for 2 months, some of the materials were transferred to short-day conditions (8h light / 16h dark) for treatment, while the other materials continued to be cultured under long-day conditions as a control group. Figure 2As shown in the figure, under long-day conditions, the number of lateral branches of Ptoelf3.1 mutant plants was significantly increased compared with wild-type (WT) plants. After about 3 weeks of short-day treatment, the terminal buds of WT poplars experienced growth arrest and gradually formed dormant buds, that is, bud scale structures wrapped around the apical meristem and leaf primordium. However, Ptoelf3.1 mutant plants did not form dormant buds and still maintained high growth activity under short-day conditions ( Figure 2 ). Populus tomentosa WT and Ptoelf3.1 mutants were planted in outdoor fields in Beibei District, Chongqing City, and it was found that WT had entered dormancy and shed its leaves in December of winter. However, the terminal buds of Ptoelf3.1 plants continued to grow, maintaining an evergreen state. The present invention shows that knocking out the PtoELF3.1 gene can change the phenology of poplars, eliminate their dormancy period transitions during seasonal growth, and make poplars insensitive to short-day conditions. The present invention creates evergreen, non-dormant poplar germplasm by targeted editing of the PtoELF3.1 gene through CRISPR / Cas9 technology, thereby improving photosynthetic carbon fixation and tree biomass accumulation, and also provides material for the creation of ornamental forest germplasm.

Claims

1. Poplar PtoELF3.1 Application of genes in regulating the transition from dormancy to seasonal growth in poplars, wherein the poplars PtoELF3.1 The gene is a gene encoding a protein with an amino acid sequence shown in SEQ ID No. 1, and the application is to knock out the gene by the CRISPR / Cas9 editing system. PtoELF3.1 Genes were obtained to obtain poplar germplasm that does not enter dormancy and remains evergreen under short-day conditions in autumn.

2. The use according to claim 1, characterized in that The poplar PtoELF3.1 The nucleotide sequence of the gene is shown in SEQ ID No.

2.

3. A method for constructing a poplar plant line that does not enter autumn dormancy, characterized in that: The steps include: (1) Using CRISPR / Cas9 editing technology to construct a gene targeting poplar PtoELF3.1 Gene editing vector; the poplar PtoELF3.1 The gene is a gene encoding a protein with the amino acid sequence shown in SEQ ID No. 1; (2) Genetic transformation of Populus tomentosa: The editing vector constructed in step (1) was transferred into sterile young wild-type Populus tomentosa leaves using the Agrobacterium-mediated leaf disc method; (3) Identification of transgenic plants: Identification of positive plants is carried out through poplar tissue culture and DNA extraction.

4. The method according to claim 3, wherein The poplar PtoELF3.1 The gene editing vector expresses the sgRNA of the nucleotide sequence shown in SEQ ID No. 3 and / or 4.

Citation Information

Patent Citations

  • Method for cultivating polyploid poplar and application of thereof

    CN112056212A

  • Watermelon gene conferring a high number of male flowers

    WO2022200149A1