Nuclear localization specific PCR (Polymerase Chain Reaction) primer or composition for detecting expression level of renal tissue nuclear protein GRP78 gene and application of primer or composition in kit

Abstract

The invention relates to the technical field of biological diagnosis preparations, and particularly discloses a nuclear localization specific PCR primer or composition for detecting the expression level of a renal tissue nuclear protein GRP78 gene and application of the primer or composition in a kit, and the primer or composition comprises an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.2; the invention also provides a diabetic nephropathy progress monitoring reagent or kit based on detection of the expression level of the nucleoprotein GRP78 in the kidney tissue. The kit for evaluating the disease progress of the diabetic nephropathy based on detecting the gene expression level of the nuclear protein GRP78 in the renal tissue of the diabetic nephropathy is suitable for researching the expression of the GRP78 in the nuclear protein of a renal tissue slice of the diabetic nephropathy, and the GRP78 has obvious nuclear translocation in a patient with the diabetic nephropathy, so that the disease progress condition of the diabetic nephropathy can be clearly indicated; the kit has the advantages of high universality, convenience, rapidness, high sensitivity and low cost, so that the kit can be used as a diagnostic kit for indicating the disease progress of diabetic nephropathy.

Description

Technical Field

[0001] The present invention relates to the technical field of biological diagnostic preparations, in particular to a kit for evaluating the progression of diabetic nephropathy based on the gene expression level of nuclear protein GRP78 in renal tissue cells. Background Art

[0002] Diabetic nephropathy (DN) is a common microvascular complication in diabetic patients and the main cause of death in diabetic patients. It usually develops into end-stage renal disease (ESRD). Although intensive glucose, lipid, urine protein and blood pressure reduction can slow the progression of diabetic nephropathy to ESRD, it still cannot effectively block its progression to ESRD. Therefore, it is necessary to further explore its occurrence and progression mechanism, discover new molecular diagnostic markers, reveal new molecular intervention targets, and then establish a more accurate DN diagnosis and treatment model. It has become an urgent task and key to curb this important chronic disease that affects human health.

[0003] Glucose-regulated protein 78 (GRP78) is also known as immunoglobulin heavy chain binding protein (Bip). GRP78 is a member of the heat shock protein 70 family. It is mainly expressed in the endoplasmic reticulum and participates in the regulation of cell endoplasmic reticulum stress as an important molecular chaperone. GRP78 participates in preventing the aggregation of new peptides, plays a role in regulating the calcium homeostasis of the endoplasmic reticulum, and assists normal protein folding through two domains, the nucleotide binding domain (NBD) and the substrate binding domain (SBD). When misfolded proteins accumulate in the endoplasmic reticulum, the endoplasmic reticulum homeostasis is unbalanced, leading to endoplasmic reticulum stress, and the unfolded protein response (UPR) is quickly initiated, including a series of comprehensive reactions including protein synthesis suspension, endoplasmic reticulum molecular chaperone GRP78 and folding enzyme expression upregulation, and endoplasmic reticulum-related degradation, in order to reduce the burden of the endoplasmic reticulum and promote cell survival. Therefore, endoplasmic reticulum stress is an adaptive protection mechanism of cells. GRP78 is an important indicator of endoplasmic reticulum stress and participates in the regulation of UPR. Continuous endoplasmic reticulum stress eventually induces cell apoptosis. GRP78 is extremely sensitive to subtle changes in the endoplasmic reticulum environment. Pathophysiological factors such as hyperglycemia, hypertension, vascular stenosis, viral infection or other external interferences can cause endoplasmic reticulum stress in kidney cells, leading to increased expression of GRP78. Therefore, studying the expression level of GRP78 will help clarify the pathogenesis of the disease and the therapeutic mechanism of the drug.

[0004] Studies have found that under the action of various stimuli, not only is GRP78 protein expression upregulated, but it can also function by migrating to different cell compartments or organelles. Recent studies have also confirmed that under the induction of endoplasmic reticulum stress or after GRP78 overexpression, GRP78 will undergo nuclear translocation and play the role of a transcriptional regulator. This study found that after high glucose stimulation of renal tubular cells, GRP78 underwent obvious nuclear translocation, and staining of renal tissue sections of patients with diabetic nephropathy found that GRP78 nuclear translocation was obvious. This suggests that the nuclear translocation of GRP78 in renal tubular cells is related to the progression of diabetic nephropathy. Therefore, the expression of tubular cell nuclear protein GRP78 may be an effective biological marker for monitoring the progression of diabetic nephropathy. Summary of the invention

[0005] To solve the above problems, the present invention aims to provide a marker for the expression of nuclear protein GRP78 associated with the progression of diabetic nephropathy and nuclear localization-specific PCR primers and compositions for detecting the expression level of nuclear protein GRP78 gene in renal tissue cells.

[0006] The second object of the present invention is to provide a use of a PCR primer or composition targeting the GRP78 nuclear localization sequence in the preparation of a monitoring reagent or kit for evaluating the progression of diabetic nephropathy based on detecting the gene expression level of the nuclear protein GRP78 in renal tissue cells.

[0007] The third object of the present invention is to provide a reagent or kit for monitoring the progression of diabetic nephropathy based on detecting the expression level of renal tissue nuclear protein GRP78.

[0008] To achieve the above object, the present invention provides the following technical solutions: The present invention provides a nuclear localization specific PCR primer for detecting the expression level of the nuclear protein GRP78 gene in renal tissue cells, comprising an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.2.

[0009] SEQ ID NO.1: GACCAGCGTGTCATGGAACACTTCAT; SEQ ID NO.2: CGAGTCGAGCCACCAACAAGAACAAT.

[0010] The present invention also provides a composition for detecting the expression level of the renal tissue nuclear protein GRP78 gene, comprising an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.2, wherein the concentration range of the upstream primer and the downstream primer is 0.1-1 μM.

[0011] The present invention also provides a use of the nuclear localization specific PCR primers as described above in the preparation of a diabetic nephropathy disease progression monitoring reagent or kit based on detecting the expression level of renal tissue nuclear protein GRP78.

[0012] The present invention also provides a use of the above-mentioned composition in the preparation of a diabetic nephropathy disease progression monitoring reagent or kit based on detecting the expression level of renal tissue nuclear protein GRP78.

[0013] The present invention also provides a diabetic nephropathy disease progression monitoring reagent or kit based on detecting the expression level of renal tissue nuclear protein GRP78, including nuclear localization specific PCR primers as shown in SEQ ID NO.1 and SEQ ID NO.2. It also contains a renal tissue paraffin section RNA extraction reagent, a reverse transcription reaction reagent, and a real-time quantitative PCR reagent containing SYBR.

[0014] The RNA extraction reagent for paraffin sections of renal tissue contains: dewaxing solution, buffer PKD, proteinase K, DNase booster buffer, DNase I stock solution, buffer RBC, buffer RPE, and RNase-free water.

[0015] Reverse transcription reaction reagents: RNase Free dH2O, 5X RT Master Mix.

[0016] The reverse transcription reaction system is: 0.5μL of the sample RNA to be tested, 2μL of 5X RT Master Mix, 7.5μL of RNase FreedH2O, and the total reaction system is 10uL. The concentration of the sample RNA to be tested is calibrated to 1μg / μl.

[0017] The reverse transcription reaction procedure is: 37℃ 15 minutes (reverse transcription reaction) 85℃ for 5 seconds (inactivation of reverse transcriptase) The samples are stored at 4°C. The 5X RT Master Mix contains all the reagents required for the reverse transcription reaction of real-time quantitative PCR (PrimeScript RTase, RNase Inhibitor, Random 6 mers, Oligo dT Primer, dNTPMixture, reaction buffer). The reaction can be carried out quickly by adding template RNA and water. The template cDNA used for real-time quantitative PCR can be efficiently synthesized in a short time.

[0018] Real-time quantitative PCR reagents containing SYBR: 2 × AceQ Universal SYBR qPCR Master Mix.

[0019] The reaction system of real-time quantitative PCR reagent is: 2 × AceQ Universal SYBR qPCR Master Mix 10μl, Primer R (10 μM) 1μl, Primer R (10 μM) 1μl, template cDNA 2μl, ddH2O 6μl. The total reaction system is 20ul.

[0020] Compared with the prior art, the present invention has the following beneficial effects: The kit for evaluating the progression of diabetic nephropathy based on detecting the gene expression level of the nuclear protein GRP78 in renal tissue cells of the present invention is suitable for studying the expression of GRP78 in the nuclear protein of diabetic nephropathy renal tissue sections. Since GRP78 has obvious nuclear translocation in patients with diabetic nephropathy, it can clearly indicate the progression of diabetic nephropathy. It has the advantages of strong universality, convenience, high sensitivity and low cost. Therefore, it can be used as a diagnostic kit for indicating the disease progression of diabetic nephropathy. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a GRP78 staining of kidney tissue sections from patients with diabetic nephropathy. The positive brown signal is located in the cell nucleus. Figure 2 The results of this kit for evaluating the progression of diabetic nephropathy based on the detection of the gene expression level of nuclear protein GRP78 in renal tissue cells were tested on healthy people, patients with early diabetic nephropathy and patients with late diabetic nephropathy; Figure 3 Evaluation of universal GRP78 primers for diabetic nephropathy. DETAILED DESCRIPTION

[0022] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Example 1 GRP78 is used to design PCR primers for detecting the nuclear localization specific reaction of the nuclear protein GRP78 gene in renal tissue cells; there is obvious GRP78 nuclear translocation in the nuclei of renal tissue cells in patients with diabetic nephropathy. Figure 1The renal tissue sections of patients with diabetic nephropathy were stained with GRP78 (brown indicates the expression location of GRP78, and blue indicates the expression location of the nucleus). The positive brown signal is located in the nucleus. Therefore, according to the nuclear localization sequence of the GRP78 gene as shown in SEQ ID NO.3, its characteristics were analyzed and a set of primers were designed, as shown in Table 1: Table 1

[0024] SEQ ID NO.3: The nuclear localization sequence of the GRP78 gene is: AAGATGTCAGGAAAGACAATAGAGCTGTGCAGAAA.

[0025] Example 2 A diabetic nephropathy disease progression monitoring kit based on detecting the expression level of renal tissue nuclear protein GRP78, comprising: The PCR primers for detecting the nuclear localization specific reaction of the nuclear protein GRP78 gene in kidney tissue cells of Example 1; The reagents for RNA extraction from paraffin sections of renal tissue were: dewaxing solution, buffer PKD, proteinase K, DNase boost buffer, DNase I stock solution, buffer RBC, buffer RPE, RNase-free water; Reverse transcription reaction reagents: RNase Free dH2O, 5X RT Master Mix; SYBR real-time quantitative PCR reagents: 2 × AceQ Universal SYBR qPCR Master Mix.

[0026] The method for detecting the expression of the nuclear protein GRP78 gene in paraffin sections of human kidney tissue using the kit of the present invention comprises the following steps: RNA template extraction and preparation from paraffin sections of renal tissue; RNA extraction from paraffin sections of renal tissue can be carried out using conventional methods in the art.

[0027] This example provides an option: using the RNeasy FFPE RNA extraction and purification kit. The specific process is as follows: (1) Use a scalpel to cut off the excess paraffin on the sample block and cut 5-20µm thick sections for the next step of sectioning.

[0028] (2) Immediately place the sections into a 1.5 ml microcentrifuge tube, add 160 µl of dewaxing solution, vortex vigorously for 10 seconds, and then centrifuge briefly to allow the sample to reach the bottom of the tube. Incubate at 56°C for 3 minutes and then cool at room temperature (15-25°C).

[0029] (3) Add 150 µl of buffer PKD, vortex to mix, and centrifuge at 11,000 x g (10,000 rpm) for 1 min.

[0030] (4) Add 10 µl of proteinase K to the bottom clear phase and gently mix up and down with a pipette. Incubate at 56°C for 15 minutes and then at 80°C for 15 minutes.

[0031] (5) Transfer the lower colorless phase to a new 2 ml microcentrifuge tube and incubate on ice for 3 minutes. Then, centrifuge at 20,000 x g (13,500 rpm) for 15 minutes.

[0032] (6) Transfer the supernatant to a new 1.5 mL microcentrifuge tube and add 16 µl of DNase booster buffer and 10 µl of DNase I stock solution. Invert the tube to mix.

[0033] (7) Incubate at room temperature for 15 min, add 320 µl of RBC buffer to adjust binding conditions, and mix the lysate.

[0034] (8) Add 720 µl of 100% ethanol to the sample; transfer 700 µl of the sample to an RNeasy MinElute spin column in a 2 ml collection tube. Centrifuge at 8000 x g for 15 seconds.

[0035] (9) Add 500 µl of Buffer RPE to the RNeasy MinElute spin column, gently close the lid, and centrifuge at 8000 x g for 15 seconds.

[0036] (10) Place the RNeasy MinElute spin column into a new 2 ml collection tube. Close the spin column cap and centrifuge at full speed for 5 minutes.

[0037] (11) Place the RNeasy MinElute spin column into a new 1.5 ml collection tube. Add 15 µl of RNase-free water directly onto the spin column membrane. Gently close the lid and centrifuge at full speed for 1 minute to elute the RNA and test the RNA concentration.

[0038] Preparation of cDNA template: The RNA obtained above was used as a sample to be tested for reverse transcription reaction to obtain a cDNA template.

[0039] Reverse transcription reaction reagents: RNase Free dH2O, 5X RT Master Mix.

[0040] The reverse transcription reaction system is: 0.5μL of the sample RNA to be tested, 2μL of 5X RT Master Mix, 7.5μL of RNase FreedH2O, and the total reaction system is 10uL. The concentration of the sample RNA to be tested is calibrated to 1μg / μl.

[0041] The reverse transcription reaction procedure is: 37℃ 15 minutes (reverse transcription reaction) 85℃ for 5 seconds (inactivation of reverse transcriptase) (3) Real-time quantitative PCR Add each component reagent according to the system in Table 2 Table 2

[0042] Perform real-time quantitative fluorescence PCR reaction according to the following conditions in Table 3 Table 3

[0043] (4) Result judgment The CT value of each reaction was obtained according to the automatic baseline and logarithmic threshold of the instrument system, and the 2 of the GRP78 nuclear localization-specific PCR reaction was calculated. -（CT1-CT2） , taking the expression level of the housekeeping gene GAPDH as a reference, the calculation formula was CT1-CT2=CTGRP78-CTGAPDH.

[0044] The expression levels of nuclear protein GRP78 in renal tissues of patients in different groups were compared. As the condition of diabetic nephropathy patients worsens, the expression of nuclear protein GRP78 gradually increases.

[0045] Application Examples 1. A diabetic nephropathy disease progression assessment kit based on detecting the gene expression level of renal tissue nuclear protein GRP78 detects healthy people, early diabetic nephropathy and late diabetic nephropathy. According to the kit and method of Example 2, samples of 5 healthy people, 5 early diabetic nephropathy patients and 5 late diabetic nephropathy patients were tested. Among them, No. 1 to 5 are normal controls, No. 6 to 10 are early diabetic nephropathy, and No. 11 to 15 are late diabetic nephropathy.

[0046] 2. Each sample was also subjected to RT-qPCR using the commercially available GRP78 universal primers in parallel. The specific operation steps were carried out according to the standard steps of the selected kit. The GRP78 universal primers are shown in Table 4: Table 4

[0047] The primers for amplifying the human housekeeping gene GAPDH are: Table 5

[0048] 3. Results like Figure 2 As shown in the figure, the expression of renal tissue nuclear protein GRP78 in the normal control group is extremely low and negligible, while the expression of renal tissue nuclear protein GRP78 in early diabetic nephropathy and late diabetic nephropathy gradually increases. This indicates that during the progression of diabetic nephropathy, the nuclear translocation of GRP78 gradually increases, from nothing to something, and from little to much. Therefore, the expression of GRP78 in renal tissue nuclear protein can be used as a sensitive marker for the progression of diabetic nephropathy, and can be used for auxiliary diagnosis of diabetic nephropathy and early warning of the progression of the disease, which has important clinical significance. In addition, the nuclear localization specific primers for GRP78 in the present invention are similar to the GRP78 universal primers already available on the market (such as Figure 3 Compared with the above (as shown), it has higher sensitivity, stronger detection power and stronger substitutability.

[0049] The diabetic nephropathy disease progression assessment kit based on detecting the expression of renal tissue nuclear protein GRP78 of the present invention is suitable for studying the expression of GRP78 in nuclear protein of diabetic nephropathy renal tissue sections, and has the advantages of strong universality, high sensitivity, and low cost, and has higher sensitivity and detection ability than the GRP78 primers available on the market. Therefore, it can be used as a diagnostic kit to indicate the disease progression of diabetic nephropathy.

[0050] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.

[0051] It should be noted that the above content only illustrates the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications all fall within the protection scope of the claims of the present invention.

Claims

1. A nuclear localization-specific PCR primer for detecting the expression level of the nuclear protein GRP78 gene in renal tissue cells, characterized in that: It includes an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.

2.

2. A composition for detecting the expression level of the nuclear protein GRP78 gene in renal tissue cells, characterized in that: It comprises an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.2, and the concentration of the upstream primer and the downstream primer is 0.1-1 μM.

3. Use of the nuclear localization-specific PCR primers as claimed in claim 1 in the preparation of a diabetic nephropathy disease progression monitoring reagent or kit based on detecting the expression level of renal tissue nuclear protein GRP78.

4. Use of the composition according to claim 2 in the preparation of a reagent or kit for monitoring the progression of diabetic nephropathy based on detecting the expression level of renal tissue nuclear protein GRP78.

5. A reagent or kit for monitoring the progression of diabetic nephropathy based on detecting the expression level of renal tissue nuclear protein GRP78, characterized in that: It contains nuclear localization-specific PCR primers as shown in SEQ ID NO.1 and SEQ ID NO.

2.

6. A reagent or kit for monitoring the progression of diabetic nephropathy based on detecting the expression level of renal tissue nuclear protein GRP78 according to claim 5, characterized in that: The invention also comprises a renal tissue paraffin section RNA extraction reagent, a reverse transcription reaction reagent, and a real-time quantitative PCR reagent containing SYBR.

Images