SNP (Single Nucleotide Polymorphism) molecular marker related to pig daily gain character and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the daily gain character of a pig. The SNP molecular marker is a Ggt (Glutathione Ggt) located at the position of 160773437bp of a first chromosome of a pig genome Ensembl Sscrofa11.1 version; a mutation. Through the SNP molecular marker, the SNP molecular marker can be applied to breeding of the daily weight gain character of the Duroc long commercial pigs, so that the daily weight gain character of the Duroc long commercial pigs is improved, the growth performance and the slaughter weight of the Duroc long commercial pigs are improved, and the economic value and the economic benefit of the Duroc long commercial pigs are improved. And the variety of the Duroc long commercial pigs can be improved, the daily gain character of the variety is further improved, improved variety breeding is performed, and the market competitiveness of the Duroc long commercial pigs is improved. In addition, due to the fact that the Duroc long hybrid population is adopted as a research object, the Duroc long hybrid population can also serve as a reference population of a male parent Duroc purebred population, and reference and application values are improved for breeding of male parent Duroc boars in daily gain.

Description

Technical Field

[0001] The present invention relates to the field of pig molecular marker technology and animal breeding, and in particular to a SNP molecular marker related to the daily weight gain trait of pigs and an application thereof. Background Art

[0002] Average Daily Gain (ADG) is a key indicator for measuring pig growth performance and has significant economic value for genetic improvement of breeding pigs. In the pig production process, Duroc breeding pigs are popular for their rapid growth rate and efficient feed conversion rate and are often used as terminal sires. Therefore, improving the daily weight gain of Duroc breeding pigs is one of the focuses of breeding work. Doing so can not only shorten the fattening cycle of commercial pigs and increase the frequency of fattening batches, but also significantly reduce feed costs.

[0003] With the development of high-throughput sequencing technology and the emergence of whole-genome chips, genome-wide association studies (GWAS) analyze genetic variations of the entire genome through sequencing or microarray technology, which can quickly and comprehensively screen out genes or mutation sites related to traits and functions, and provide an effective technical means for analyzing the location of candidate genes for complex quantitative traits. Traditional GWAS studies mainly focus on the phenotypes of purebred pig populations in high-health environments. However, hybrid pigs in commercial production are usually raised under poor environmental conditions. Studies have shown that the use of hybrid populations as reference populations is of great value because they are closer to the actual production environment. In some cases, hybrid populations can even be used as reference populations for purebred populations, provided that there is a certain genetic association between the two. Given the limited size of purebred populations (especially Duroc terminal sires), it has become particularly important to identify SNP markers associated with important economic traits (such as daily weight gain and feed efficiency) in hybrid populations. With the rapid development of molecular biology technology, these markers are used to establish marker-assisted selection (MAS) strategies and combined with conventional breeding, which can effectively accelerate the selection process of pig growth traits. The identified SNP molecular markers and related genes can be integrated into the prediction models of genomic selection and MAS to improve the accuracy of trait prediction and accelerate the genetic progress of target traits in the evaluation population. This method can not only be used to assist in the selection of purebred animals, indirectly improve the performance of hybrid offspring, and enhance the competitiveness of commercial pigs, but also provide new strategies and tools for pig breeding programs, which is expected to significantly improve breeding efficiency and increase economic benefits. Summary of the invention

[0004] The purpose of the present invention is to provide a new SNP molecular marker related to the daily weight gain trait of pigs and its application, which can improve the daily weight gain of hybrid pigs, especially Duroc pigs, provide a new tool strategy for genetic breeding, shorten the breeding period and increase economic benefits.

[0005] According to the first aspect of the present invention, a SNP molecular marker related to the daily weight gain trait of pigs is provided, and the SNP molecular marker is a G>A mutation located at the 160773437bp position of chromosome 1 of the pig genome Ensembl Sscrofa11.1 version. By applying the molecular marker to the breeding of Duroc breeding pigs or Duroc Changda commercial pigs, the breeding years can be effectively shortened, the daily weight gain of the pig population can be increased, the breeding efficiency can be significantly improved, and the economic benefits can be increased. Since the Duroc Changda hybrid population is used as the research object, it can also be used as a reference population for the paternal Duroc purebred population, which improves the reference and application value for the breeding of Duroc pigs in terms of daily weight gain.

[0006] According to a second aspect of the present invention, there is provided an application of a SNP molecular marker in the breeding of daily weight gain traits of Duroc pigs or Duroc-Changda pigs, wherein the SNP molecular marker is a G>A mutation located at the 160773437bp position of chromosome 1 of the pig genome Ensembl Sscrofa11.1 version. Thus, by using the SNP molecular marker for breeding, the daily weight gain of Duroc pigs or Duroc-Changda pigs can be increased, thereby improving their economic benefits.

[0007] According to the third aspect of the present invention, there is provided an application of a SNP molecular marker for increasing the daily weight gain of Duroc pigs or Duroc-Changda pigs. Thus, the application can efficiently and conveniently increase the daily weight gain of Duroc pigs or Duroc-Changda pigs, shorten the breeding period, and improve economic benefits.

[0008] In certain embodiments, the application method includes selecting individuals with the genotype of AA or AG at position 160773437bp on chromosome 1 in Duroc pigs or Duroc-Changda pigs, which can improve the daily weight gain trait.

[0009] According to a fourth aspect of the present invention, there is provided an application of a SNP molecular marker in breeding a high daily weight gain pig strain, the pig being a Duroc pig or a Duroc-Changda pig, the SNP molecular marker being a G>A mutation located at position 160773437bp of chromosome 1 of the pig genome Ensembl Sscrofa11.1 version, the application comprising the following steps:

[0010] S1: Detecting the genotype of the SNP molecular markers in the reserve breeding pigs;

[0011] S2: selecting individuals with the AA or AG genotype at the 160773437bp position of chromosome 1 detected in step S1 as breeding pigs, and breeding the breeding pigs;

[0012] S3: The genotype of the SNP molecular marker is detected in the piglets born from mating in step S2, and the detected AA or AG genotype individuals are selected and retained, and then bred to breed pig strains with high daily weight gain. In this way, the breeding period can be greatly shortened, and Duroc pigs or Duroc-Changda pig strains with high daily weight gain traits can be bred.

[0013] According to a fifth aspect of the present invention, there is provided an application of a SNP molecular marker in improving the daily weight gain trait of a pig, the pig being a Duroc pig or a Duroc-Changda pig, the SNP molecular marker being a G>A mutation located at the 160773437bp position of chromosome 1 of the pig genome Ensembl Sscrofa11.1 version, and the application comprising the following steps:

[0014] S1: Detecting the genotype of the SNP molecular markers in the reserve breeding pigs;

[0015] S2: selecting individuals with the AA or AG genotype at the 160773437bp position of chromosome 1 detected in step S1 as breeding pigs, and breeding the breeding pigs;

[0016] S3: Detect the genotype of the SNP molecular marker in the piglets born from mating in step S2, keep the detected AA or AG genotype individuals, and then breed them, retain the AA or AG individuals with the dominant genotype in the offspring pigs, and eliminate the GG genotype, so as to increase the frequency of the dominant allele A generation by generation, thereby increasing the daily weight gain of the pig group and improving the daily weight gain trait of the offspring pigs. In this way, the daily weight gain trait of Duroc pigs or Duroc-Changda pigs can be efficiently improved, and their economic benefits can be improved.

[0017] According to the sixth aspect of the present invention, there is provided an application of a SNP molecular marker for detecting / screening / identifying / evaluating the daily weight gain trait of Duroc pigs or Duroc-Changda pigs, wherein the SNP molecular marker is a G>A mutation located at the 160773437bp position of chromosome 1 of the pig genome EnsemblSscrofa11.1 version. Thus, the daily weight gain trait of Duroc pigs or Duroc-Changda pigs can be detected / screened / identified / evaluated quickly, safely, conveniently and efficiently.

[0018] According to the seventh aspect of the present invention, there is provided a use of a SNP molecular marker in preparing a kit for detecting / screening / identifying / evaluating the daily weight gain trait of Duroc pigs or Duroc-Changda pigs, wherein the SNP molecular marker is a G>A mutation located at the 160773437bp position of chromosome 1 of the pig genome Ensembl Sscrofa11.1 version. Thus, by preparing a corresponding detection kit with the SNP molecular marker, the daily weight gain trait of Duroc pigs or Duroc-Changda pigs can be detected / screened / identified / evaluated quickly, safely, conveniently and efficiently.

[0019] According to the eighth aspect of the present invention, a nucleotide sequence containing a SNP molecular marker related to the daily weight gain trait of pigs is provided, the sequence containing a nucleotide sequence as shown in SEQ ID No: 1, and the 101st base M in the sequence represents a G>A base mutation. Thus, through the above nucleotide sequence containing the SNP molecular marker related to the daily weight gain trait of pigs, primers or probes can be designed to detect the genotype of the SNP molecular marker at the corresponding site, and then the daily weight gain trait of pigs can be further selected according to the test results; or primers designed by the nucleotide sequence are made into corresponding detection kits to be directly used for the detection of SNP molecular markers, and then the daily weight gain trait of pigs can be selected according to the detected genotype. The detection efficiency can be greatly improved, thereby improving the breeding efficiency.

[0020] According to the ninth aspect of the present invention, there is provided an application of a nucleotide sequence of a SNP molecular marker related to the daily weight gain trait of a pig in detecting / screening / identifying / evaluating the daily weight gain trait of a Duroc pig or a Duroc-Changda pig, the sequence containing a nucleotide sequence as shown in SEQ ID No: 1, and the 101st base M in the sequence represents a G>A base mutation. Thus, a primer or probe is designed by the sequence to detect the genotype of the SNP molecular marker at the corresponding site, and then the daily weight gain trait of the pig is further selected according to the test results; or a primer is designed by the nucleotide sequence to make a corresponding detection kit to be directly used for the detection of the SNP molecular marker, and then the daily weight gain trait of the pig is selected according to the detected genotype. The detection efficiency can be greatly improved, thereby improving the breeding efficiency, and the application is simple, convenient and efficient.

[0021] According to the tenth aspect of the present invention, there is provided a use of a nucleotide sequence containing a SNP molecular marker related to the daily weight gain trait of a pig in the preparation of a product for detecting / screening / identifying / evaluating the daily weight gain trait of a Duroc pig or a Duroc-Changda pig, the sequence containing a nucleotide sequence as shown in SEQ ID No: 1, and the 101st base M in the sequence represents a G>A base mutation. Thus, by preparing a corresponding detection product from the sequence, it is possible to achieve simple, convenient and efficient detection / screening / identification / evaluation of SNP molecular markers related to the daily weight gain trait of a pig, laying a foundation for subsequent breeding.

[0022] Beneficial effects of the present invention: The present invention discloses a SNP molecular marker related to the daily weight gain trait of pigs. Through the SNP molecular marker, it can not only be applied to the selection and breeding of the daily weight gain trait of Duroc Changda commercial pigs, thereby improving the daily weight gain trait of Duroc Changda commercial pigs, improving their growth performance and market weight, and improving their economic value and economic benefits. The breed of Duroc Changda commercial pigs can also be improved to further improve the daily weight gain trait of the breed, and carry out fine breeding to improve its market competitiveness. Moreover, since the Duroc Changda hybrid population is used as the research object, it can also be used as a reference population for the paternal Duroc purebred population, which improves the reference and application value for the selection and breeding of Duroc pigs in terms of daily weight gain. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The Manhattan diagram of the FarmCPU model and the MLM model: the X-axis is the position of the SNP site on the chromosome, the Y-axis is the -log10 (P value) corresponding to the SNP site, the dotted line is the significant P value threshold of 1 / 114501, the solid line is the significant P value threshold of 0.05 / 114501, and the point marked "yz_rs81219178" in the Manhattan diagram is the molecular marker screened by the present invention, and its significant P values ​​are 7.41E-21 (FarmCPU model) and 2.73E-12 (MLM model), respectively;

[0024] Figure 2 QQ diagram of FarmCPU model and MLM model. DETAILED DESCRIPTION

[0025] The invention will be further described in detail below in conjunction with the accompanying drawings.

[0026] Example 1 Genome-wide association analysis of daily weight gain traits of Duchangda commercial pigs

[0027] 1. Test materials

[0028] The population used in this study was Duroc Changda commercial pigs from the breeding experimental field of Guangxi Yangxiang Group Co., Ltd. [Duroc Changda commercial pigs are a hybrid of Duroc boars (paternal) × Changda binary hybrid sows (maternal); while Changda binary hybrid sows are a hybrid of Landrace boars (paternal) × Yorkshire sows (maternal)]. Individual data records of the measurement station were collected from 2022 to 2023 for this study. After filtering the abnormal phenotypic data, a total of 4346 pigs were obtained for daily weight gain trait (30-120KG) observations for phenotype-genotype association analysis.

[0029] 2. Test methods

[0030] 2.1 Genotyping and quality control

[0031] Ear tissue samples of commercial pigs were collected, total DNA was extracted, and genotyping of qualified DNA samples was performed using the pig 80K functional locus gene chip [Shadow Gene, CHN, DNBSEQ-T7 (MGI), code P231103]. For all SNP markers located on 18 autosomes, quality control was performed using Plink software, with the following criteria: removal of SNP detection rate <99%, minimum allele frequency <0.05, Hardy-Weinberg equilibrium test P value less than 10 -6 As well as individuals with individual detection rates <95%. For missing genotypes, Beagle software (version 5.1) was used for filling, and quality control was performed again after filling. The quality control conditions were the same as before. After quality control, 4346 Duroc Changda commercial pigs and 114,501 SNP loci were finally used for subsequent whole-base group association analysis.

[0032] 2.2 Genome-wide association analysis

[0033] GWAS analysis was performed using the FarmCPU model (Liu X, Huang M, Fan B, et al. Iterative usage of fixed and random effect models for powerful and efficient genome-wide association studies [J]. PLoS genetics, 2016, 12 (2): e1005767) and the MLM model (Yu J, Pressoir G, Briggs WH, et al. A unified mixed-model method for association mapping that accounts for multiple levels of relatedness [J]. Nature genetics, 2006, 38 (2): 203-208.) in the MVP software package in the R statistical environment. The Bonferroni correction method was used to determine the genome-wide and chromosome-wide significance thresholds for the detection of significant loci at the genome level. The chromosome-level significance threshold was 1 / 114501, and the genome-wide significance threshold was 0.05 / 114501. The SNP markers significantly associated with the daily weight gain trait detected by the two methods were obtained respectively, and the SNP markers detected by both methods were taken as candidate SNPs.

[0034] 3. Screening of trait-associated markers

[0035] In this study, 4346 Duroc pigs were selected as the subjects. 114501 SNPs obtained by gene chip technology were used to conduct GWAS analysis on daily weight gain of pigs. The analysis found a SNP locus that was significantly related to daily weight gain of pigs at the 5% genome level after Bonferroni correction (P<0.05 / 114501). Its location on the chromosome was chr1:160773437. The molecular marker was recorded as yz_rs81219178. The results are as follows Figure 1 and Figure 2 As shown: Among them, Figure 1 This is the Manhattan diagram of the FarmCPU model and the MLM model. Figure 1 The significant P values ​​of the yz_rs81219178 molecular marker were 7.41E-21 (FarmCPU model) and 2.73E-12 (MLM model); Figure 2 QQ diagram of FarmCPU model and MLM model.

[0036] Example 2 Comparison of daily weight gain of commercial pigs with different genotypes using yz_rs81219178 SNP molecular marker

[0037] The generalized linear model (GLM) was used to analyze the effect of different genotypes of the molecular marker yz_rs81219178 (G>A) on daily weight gain. The analysis model is as follows:

[0038] y ijk =μ+G i +Sex j +e ijk

[0039] Among them, y ijk is the individual daily weight gain phenotype value; μ is the mean; G i is the ith genotype effect; Sex j is the jth gender effect; e ijk is the random residual.

[0040] The statistical results of daily weight gain of pigs with different genotypes of yz_rs81219178 (chr1:160773437) are shown in Table 1. Among them, the daily weight gain of AA genotype pigs is 41.97g higher than that of GG genotype pigs; the daily weight gain of AG genotype pigs is 31.30g higher than that of GG genotype pigs; the difference between the groups reached an extremely significant level (P<0.001). The daily weight gain of AA genotype pigs is 10.67g higher than that of AG genotype pigs, and the difference is significant (P<0.05). Therefore, AA is the dominant genotype for increasing the daily weight gain of Durocopterus longipes commercial pigs, and A is the dominant allele for increasing the daily weight gain of Durocopterus longipes commercial pigs.

[0041] Table 1 Differences in daily weight gain of commercial pigs with different genotypes at the yz_rs81219178 locus

[0042]

[0043] Note: Mean means mean; SD means standard deviation. P-value < 0.05 means significant difference, P-value < 0.01 means highly significant difference, and p-value < 0.001 means extremely significant difference.

[0044] Example 3: yz_rs81219178 SNP molecular marker sequence and application

[0045] The marker yz_rs81219178 screened according to the above Example 1 is located at the 160773437bp position of pig chromosome 1 by referring to Ensembl (Sscrofa11.1), which is a G>A mutation. The SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.1: the base M at this site indicates that its allele is G or A, and the sequence of SEQ ID NO.1 is as follows: CTTAATATTCTATATCTCCTGCCCCCAGAATCCATACTGTGTGTGCTTCATGTCTCACTTTAATTTGTATCTCATCCTGATCATGTGTAATTCCATCATC M(G / A) ATCCCCTGATTTATGCACTCCGGAGCCAAGAACTGAGGAAAA CCTTCAAAGAGATCATCTGTTGCTATCCCCTGGGTGGCCTCTGTGATTTGTCTAGCAG.

[0046] Through the above-mentioned nucleotide sequence containing the SNP molecular marker related to the daily weight gain trait of pigs, primers or probes can be designed to detect the genotype of the SNP molecular marker at the corresponding site, and then the daily weight gain trait of pigs can be further selected based on the test results; or primers can be designed through the nucleotide sequence to make corresponding detection kits that are directly used for the detection of SNP molecular markers, and then the daily weight gain trait of pigs can be selected based on the detected genotype.

[0047] Example 4: Application of yz_rs81219178 SNP molecular marker in Duroc boar breeding

[0048] The genotypes of SNP molecular markers of reserve Duroc boars were tested. By selecting individuals with the genotype AA or AG of yz_rs81219178 (chr1: 160773437) of the genome version EnsemblSscrofa11.1 as breeding boars and eliminating the GG type, the frequency of the dominant allele A can be gradually increased, thereby increasing the daily weight gain of the breeding population and increasing the growth rate.

[0049] Example 5: Application of yz_rs81219178 SNP molecular marker in detecting / screening / identifying / evaluating daily weight gain traits of Duroc boars

[0050] The genotype of the molecular marker yz_rs81219178 (chr1: 160773437) of the Duroc boar to be tested / screened / identified / evaluated is identified. When the genotype is AA or AG, the boar to be evaluated has a large daily weight gain; when the genotype is GG, the boar to be evaluated has a small daily weight gain.

[0051] Example 6: Application of yz_rs81219178 SNP molecular marker in evaluating daily weight gain traits of Durococcus spp. commercial herds

[0052] The genotype of the molecular marker yz_rs81219178 (chr1: 160773437) of the Duroc boar to be evaluated was identified. When the Duroc boar with a genotype of AA or AG was used to breed dual-purpose sows (Landrace×Large White), the Duroc Changda commercial pigs of the offspring of the boar with this genotype had a large daily weight gain; when the genotype was GG, the Duroc Changda commercial pigs of the offspring of the boar with this genotype had a small daily weight gain.

[0053] Example 7: Application of yz_rs81219178 SNP molecular marker in breeding high daily weight gain Duroc pig strain

[0054] S1: Detect the genotype of the molecular marker yz_rs81219178 (chr1: 160773437) in the reserve Duroc pigs;

[0055] S2: selecting individuals with the AA or AG genotype detected in step S1 as breeding pigs, and breeding the breeding pigs;

[0056] S3: The genotype of the molecular marker yz_rs81219178 (chr1: 160773437) is detected in the piglets born from mating in step S2, and the detected AA or AG genotype individuals are selected and retained, and then bred to breed Duroc pig strains with high daily weight gain.

[0057] Example 8: Application of yz_rs81219178 SNP molecular marker in breeding high daily weight gain Duroc pig strain

[0058] S1: Detect the genotype of the molecular marker yz_rs81219178 (chr1: 160773437) in the reserve Duroc boar;

[0059] S2: Selecting individuals with AA or AG genotypes detected in step S1 as breeding boars and breeding them with grown-up dual-purpose sows;

[0060] S3: Detect the genotype of the molecular marker yz_rs81219178 (chr1: 160773437) in the piglets born from mating in step S2, select and retain the detected AA or AG genotype individuals, and then breed them to breed a Duroc pig strain with high daily weight gain.

[0061] Example 9: Application of yz_rs81219178 SNP molecular marker in improving daily weight gain traits of Duroc pigs

[0062] S1: The genotype of the yz_rs81219178 (chr1: 160773437) molecular marker was detected in the reserve Duroc breeding pigs;

[0063] S2: selecting individuals with AA or AG genotype detected in step S1 as breeding pigs, and breeding the breeding pigs;

[0064] S3: Detect the genotype of the molecular marker yz_rs81219178 (chr1: 160773437) in the piglets born from mating in step S2, retain the individuals with the AA or AG genotype detected, and then breed them, retain the individuals with the dominant genotype of AA or AG in the offspring pigs, and eliminate the GG genotype, so as to increase the frequency of the dominant allele A from generation to generation, thereby increasing the daily weight gain of the pig group and improving the daily weight gain trait of the offspring pigs.

[0065] Example 10: Application of yz_rs81219178 SNP molecular marker in improving daily weight gain traits of Duroc pigs

[0066] S1: Detect the genotype of the molecular marker yz_rs81219178 (chr1: 160773437) in the reserve Duroc boar;

[0067] S2: Selecting individuals with AA or AG genotypes detected in step S1 as breeding boars and breeding them with grown-up dual-purpose sows;

[0068] S3: Detect the genotype of the molecular marker yz_rs81219178 (chr1: 160773437) in the piglets born from mating in step S2, and keep the individuals with the AA or AG genotype detected, and then breed them, retaining the individuals with the dominant genotype of AA or AG in the offspring pigs, and eliminating the GG genotype, so as to increase the frequency of the dominant allele A from generation to generation, thereby increasing the daily weight gain of the pig group and improving the daily weight gain trait of the offspring Duchangda pigs.

[0069] The above are only some embodiments of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the inventive concept of the present invention, which all belong to the protection scope of the invention.

Claims

1. SNP molecular markers related to daily weight gain traits of pigs, including: The SNP molecular marker is a G>A mutation located at the 160773437bp position of chromosome 1 in the pig genome Ensembl Sscrofa11.1 version.

2. Application of the SNP molecular marker described in claim 1 in the breeding of daily weight gain traits of Duroc pigs or Duroc-Changda pigs.

3. Use of the SNP molecular marker described in claim 1 in increasing the daily weight gain of Duroc pigs or Duroc-Changda pigs.

4. Use of the SNP molecular marker described in claim 1 in breeding high daily weight gain pig strains, wherein: The pig is a Duroc pig or a Duroc-Changda pig, and the application comprises the following steps: S1: Detecting the genotype of the SNP molecular marker as claimed in claim 1 on the reserve breeding pigs; S2: selecting individuals with the AA or AG genotype at the 160773437bp position of chromosome 1 detected in step S1 as breeding pigs, and breeding the breeding pigs; S3: Detect the genotype of the SNP molecular marker as described in claim 1 for the piglets born from mating in step S2, select the individuals with AA or AG genotype detected, and then cultivate them to cultivate a pig strain with high daily weight gain.

5. The use of the SNP molecular marker in improving the daily weight gain trait of pigs according to claim 1, wherein: The pig is a Duroc pig or a Duroc-Changda pig, and the application comprises the following steps: S1: Detecting the genotype of the SNP molecular marker as claimed in claim 1 on the reserve breeding pigs; S2: selecting individuals with the AA or AG genotype at the 160773437bp position of chromosome 1 detected in step S1 as breeding pigs, and breeding the breeding pigs; S3: The genotype of the SNP molecular marker as described in claim 1 is detected for the piglets born from mating in step S2, and the individuals with the AA or AG genotype detected are retained for breeding, and then bred, so as to retain the individuals with the dominant genotype of AA or AG in the offspring pigs, and eliminate the GG genotype, so as to increase the frequency of the dominant allele A from generation to generation, thereby increasing the daily weight gain of the pig group and improving the daily weight gain trait of the offspring pigs.

6. Use of the SNP molecular marker described in claim 1 in detecting / screening / identifying / evaluating the daily weight gain trait of Duroc pigs or Duroc-Changda pigs.

7. Use of the SNP molecular marker described in claim 1 in the preparation of a kit for detecting / screening / identifying / evaluating the daily weight gain trait of Duroc pigs or Duroc-Changda pigs.

8. A nucleotide sequence containing a SNP molecular marker associated with the daily weight gain trait of pigs, wherein: The sequence contains the nucleotide sequence shown in SEQ ID No: 1, and the 101st base M in the sequence represents a G>A base mutation.

9. Use of the nucleotide sequence containing the SNP molecular marker associated with the daily weight gain trait of pigs as described in claim 8 in detecting / screening / identifying / evaluating the daily weight gain trait of Duroc pigs or Duroc-Changda pigs.

10. Use of the nucleotide sequence containing the SNP molecular marker associated with the daily weight gain trait of pigs as claimed in claim 8 in the preparation of a product for detecting / screening / identifying / evaluating the daily weight gain trait of Duroc pigs or Duroc-Changda pigs.

Images