SNP (Single Nucleotide Polymorphism) molecular marker related to longissimus dorsi protein content of Beijing black pig and application of SNP molecular marker

Abstract

The invention discloses an SNP molecular marker related to the longissimus dorsi protein content of Beijing black pigs and application of the SNP molecular marker, and belongs to the technical field of livestock molecular markers. A PLA2G4B gene is used as a candidate gene influencing the protein content character of pig muscle (longissimus dorsi), a molecular marker related to the protein content of the pig muscle (longissimus dorsi) is developed on the basis of the candidate gene, the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 1, T / C mutation exists at the 501st site of the sequence, and it is found through experiments that T / C mutation exists at the 501st site of the sequence. The pig longissimus dorsi protein content when the mutation site is TT and TC genotypes is obviously higher than the pig longissimus dorsi protein content when the genotype is CC. The invention provides a new molecular marker resource for breeding of new varieties of pigs or selection of high-protein pork.

Description

Technical Field

[0001] The invention relates to the technical field of livestock molecular markers, and in particular to a SNP molecular marker related to the protein content of the longissimus dorsi muscle of Beijing black pigs and an application thereof. Background Art

[0002] my country's black pigs have a domestication history of nearly 5,000 years. With the rapid increase in people's demand for pork, fast-growing and economically efficient Western pig breeds, mainly Large White, Landrace and Duroc, have flooded into the Chinese market, and black pigs with slow marketability and low lean meat rates have gradually been eliminated. In recent years, consumers have begun to pay attention to the flavor of pork, and the black pig breeding market has begun to recover. However, most of the current black pigs are bred through multiple generations of hybridization, and the original Chinese black pigs are almost extinct. Beijing Black Pigs were bred in Shuangqiao Farm and Beijiao Farm in Beijing. They are formed by the composite hybridization of local pigs from Tongxian, Dingxian, Pinggu, Zhuoxian, Xinjin, Jilin Black Pigs, Berkshire Pigs, Yorkshire Pigs, Soviet Large White Pigs and Caucasian Pigs, combining the excellent characteristics of domestic and foreign pig breeds.

[0003] Beijing Black Pig is a meat pig breed that combines the excellent characteristics of domestic and foreign pig breeds. Its hybrid maternal line uses the excellent maternal properties of Beijing Black Pig, which are tolerant to roughness, resistant to adversity, early maturity, easy to conceive, and good at protecting young, and its excellent internal quality performance is hybridized with foreign paternal lines such as Duroc, Landrace, and Large White, which have good carcass performance and fast growth, to produce high-quality meat with high lean meat rate. Its hybrid paternal line uses Beijing Black Pig as the paternal line and hybridizes it with ancient Chinese tender high-end pig breeds such as Jinhua Pig and Wei Pig, which have good reproductive performance, thin skin without wrinkles, fine bones and tender meat, smooth and juicy, rich flavor, but thick fat, to produce high-quality pork with unique flavors.

[0004] With the development of economy and the improvement of people's living standards, people's requirements for pork quality have shifted from pursuing high lean meat rate to pork edible quality such as juiciness, color, flavor, tenderness and water holding capacity. Therefore, improving pork quality and meeting consumers' demand for good taste, high nutrition and healthy pork have become key factors affecting the research of pork quality traits, and have also become a research hotspot for pig breeding institutions and major breeding companies in various countries. The protein content of the longissimus dorsi muscle of pigs is an extremely important trait, which plays a key role in the meat quality and growth performance of pigs. The longissimus dorsi muscle is one of the main muscle parts in pork, and its protein content directly affects the taste, flavor and nutritional value of the meat. A higher protein content can improve the meat quality, bring a more tender and juicy taste, and high nutritional value, thereby meeting consumers' demand for high-quality pork. Therefore, through molecular markers and genomic selection and other technologies, the study and breeding of the longissimus dorsi muscle protein content can significantly improve the overall quality of pork.

[0005] PLA2G4B (phospholipase A2, group IVB) belongs to the cytoplasmic type of phospholipase A2, which can specifically recognize and hydrolyze the sn-2 acyl bond of glycerophospholipids, releasing free fatty acids and lysophospholipids. This hydrolysis has a wide range of effects on cell physiological processes. In cells, it participates in the remodeling of cell membrane phospholipids, affecting the fluidity and permeability of cell membranes. At the same time, the released fatty acids can be used as signal molecules or participate in other metabolic pathways. For example, in inflammatory reactions, the arachidonic acid produced by the hydrolysis of the protein can be further metabolized to produce inflammatory mediators such as prostaglandins, participating in immune regulation and inflammatory response processes. In cells related to fat metabolism, its function of hydrolyzing phospholipids also has a potential impact on the synthesis and decomposition balance of triglycerides. At present, there is no report on the correlation between PLA2G4B and the protein content of the longissimus dorsi muscle of Beijing black pigs. The present invention develops molecular markers related to the protein content of the longissimus dorsi muscle of Beijing black pigs based on this gene, which are applied to pig breed research and breeding, which is of great significance for improving the overall quality of pork. Summary of the invention

[0006] The purpose of the present invention is to provide a SNP molecular marker related to the protein content of the longissimus dorsi muscle of Beijing black pigs and its application, so as to solve the problems existing in the above-mentioned prior art. The SNP molecular marker is located on the 17th exon of the PLA2G4B gene, and there is a T / C mutation at the 501st position of the nucleotide sequence shown in SEQ ID NO:1, and the mutation site is significantly correlated with the protein content of the longissimus dorsi muscle of Beijing black pigs.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The invention provides a SNP molecular marker related to the protein content of the longissimus dorsi muscle of pigs. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and a T / C mutation exists at the 501st position of the sequence.

[0009] Optionally, the mutation site of the SNP molecular marker has TT, TC and CC genotypes.

[0010] Optionally, the pig comprises a Beijing black pig.

[0011] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0012] The invention also provides a kit for detecting the protein content of the longissimus dorsi muscle of pigs, comprising the primer pair.

[0013] The present invention also provides the use of the SNP molecular marker, the primer pair or the kit in any of the following:

[0014] (1) Application in detecting protein content of longissimus dorsi muscle of pig;

[0015] (2) Application in breeding pig breeds related to the protein content of the longissimus dorsi muscle;

[0016] (3) Application in screening pork with high protein content.

[0017] The present invention also provides a method for detecting the protein content of the longissimus dorsi muscle of pig, comprising the following steps:

[0018] The SNP molecular marker is amplified using a primer pair, and the content of longissimus dorsi protein in pigs is determined according to the genotype of the SNP site of the amplified product; wherein the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

[0019] Optionally, the judgment standard is: the protein content of the longissimus dorsi muscle of pig individuals with TT and TC genotypes at the SNP site is higher than that of the longissimus dorsi muscle of pig individuals with CC genotype.

[0020] The present invention also provides a method for breeding high-protein pork, comprising: using a primer pair to amplify the SNP molecular marker, retaining the pork with mutation sites of the SNP molecular marker as TT and TC genotypes; the nucleotide sequence of the primer pair is shown in SEQ ID NO:2-3.

[0021] The present invention also provides a method for breeding pig varieties related to the protein content trait of the longissimus dorsi muscle of pigs, comprising: using a primer pair to amplify the SNP molecular marker, retaining pig individuals with TT and TC genotypes at the mutation sites of the SNP molecular marker; the nucleotide sequence of the primer pair is shown in SEQ ID NO:2-3.

[0022] The present invention discloses the following technical effects:

[0023] The present invention screened out a molecular marker associated with the protein content trait of the longissimus dorsi muscle of pigs. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1. There is a T / C mutation at the 501st position of the sequence. Experimental verification shows that the TC genotype individuals and the TT genotype individuals at the mutation site are significantly higher than the CC genotype individuals. The TC genotype and the TT genotype are favorable genotypes for the protein content of the longissimus dorsi muscle of pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 The whole genome association analysis results of the present invention;

[0026] Figure 2 The bands amplified by the polymerase chain reaction using primers of the present invention; M: DL2000DNAMarker, 1-3: the bands of the samples amplified by using specific primers, with a size of 172 bp;

[0027] Figure 3 The sequencing results of the amplified bands of the present invention; the blue mark of sequence 1 is a single peak, TT wild type, and the blue mark of sequence 2 is a double peak, TC heterozygous;

[0028] Figure 4 The results of variance analysis of the longissimus dorsi muscle protein content in different genotypes of the molecular markers of the present invention are shown. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0032] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0033] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0034] Example 1 Genetic marker mining for protein content of longissimus dorsi muscle of pig

[0035] The protein content of the longissimus dorsi muscle and the carcass weight of 1509 Beijing black pigs were measured to obtain phenotypic data. The outliers of the longissimus dorsi muscle protein content and carcass weight phenotypic traits were eliminated using the quartile test method. At the same time, the Beijing black pigs were genotyped using the SMIC No. 1 PLUS pig 50K SNP chip, and then the panel was filled based on 1kcigp. The chip data was filled to the whole genome level using shapeit5 and minimac4 software, and then quality control was performed using PLINK software. The quality control standards were:

[0036] ① Individual genotype frequency>0.95;

[0037] ②SNP call rate>0.95;

[0038] ③Minimum allele frequency (MAF)>0.05;

[0039] ④ Hardy-Weinberg equilibrium test P value>10 -6 ; The SNP site information obtained after quality control is used for subsequent whole-genome association analysis.

[0040] GEMMA software was used to perform genome-wide association analysis based on a linear mixed model. The expression of the linear mixed model is:

[0041] y=Xα+Yβ+Zγ+e;

[0042] y is the meat quality trait phenotype vector; α is the SNP marker effect vector, X is the association matrix corresponding to α, coded as 0, 1, 2; β is the non-genetic fixed effect vector, including population mean, sex, carcass weight, Y is the association matrix corresponding to β; γ is the residual polygenic effect vector, which follows a normal distribution G is the genomic kinship matrix, is the additive genetic variance, Z is the correlation matrix corresponding to γ; e is the residual vector, subject to I is the identity matrix, are random residuals.

[0043] The significance test was performed using the Wald test with a 10 -6 As a threshold for potential genome-wide significance, the Manhattan result obtained is Figure 1 The results showed that the newly discovered SNP at position 129516749 of exon 17 on chromosome 1 (located in the PLA2G4B gene) may be a regulatory site for the protein content of the longissimus dorsi muscle of pigs.

[0044] Based on large-scale Beijing black pig gene chip data and phenotypic data of protein content in longissimus dorsi muscle of pig, the present invention fills 50K genome chip data to the sequencing level, uses a linear mixed model to perform genome-wide association analysis, and finds that there is a new SNP in the PLA2G4B gene, which is significantly associated with the protein content in longissimus dorsi muscle of pig. By blasting the upstream and downstream sequences of the SNP on the NCBI website, the nucleotide polymorphism site (SNP site) is found in the amplified fragment. The SNP site is at the 501st base of the sequence described in SEQ ID NO:1, and the mutated site is named c.501T>C, and the sequence is as follows:

[0045] CGAGCTCTTTGGCTCTCAGTTCTTCATGGGGCGCCTGACAAAGCAGCTTCCTGAGTCCCGCATCTGCTTCCTGGAAGGTGAGGGTGACTGGTAGGTGGGACAATGGGACCCAGGGAGATGGTGAGCCCAGAG GTCCCAGCTCAGTCACTGGGATGTTCCCTGGTCCCCACTGGGCTGAGGGGAAAGGTCAGACTGTTCCTCCCATGTCTTCTCCTCAGGTATCTGGAGCAACCTGTACACAGCCAACCTCCAGGACAGCTTGTA TTGGTCTCCGAGCCCAGCCAGTTTTGGGACCGCTGGGCACAGGATCAGATCAGCCTGGGTAGGTTGGGATGTATTGGGGAGCTTCGGGGTAGCCCTCAGGCCTTCATGAGTCCACAGAGGCCAGAATAAAG GTCCAAGGGTCCCCGTGTCTCCTCTTCTTGATTGCAGACAAGGACCAGGTCCCCCTTCTGAAGGTAGAAGAGCCTCCCACAGTGGCCGGCAGGATAGCTGAGTTR(T / C)TTCACTGACCTTCTGACATGGC GTCCACTTGCCCAGACCACCCACAATTTCCTACGTGGCCTCTCTTTCCACAAGGACTACTACCAGCATCCTCACTTCTCTGCCTGGAAAGGTATCTGCTTTTCTCCCCCTGGTCCAGCTCTCGAAAGTCTTTCCATGGCCGTCCTGGGGTCCCTGGTCCAGACACGCACACTCTCTAGCCCCTTGGCGCCAT.

[0046] Example 2 Application of PLA2G4B molecular marker

[0047] 1. DNA extraction

[0048] The present invention uses Beijing black pig as the test material, and extracts DNA from ear tissue using a whole genome DNA kit from pig ear samples, and the steps are as follows:

[0049] (1) Add a certain amount of anhydrous ethanol to buffer GD and rinse solution PW according to the instructions.

[0050] (2) Material processing: Cut 30 mg of ear / muscle tissue into a 1.5 mL centrifuge tube and cut and grind as much as possible.

[0051] (3) Add 200 μL of buffer GA and vortex until thoroughly suspended.

[0052] (4) Add 20 μL of proteinase K and mix well, then place in a molecular hybridization oven at 56°C for overnight digestion.

[0053] (5) Add 200 μL of buffer GB to the digested tissue solution, mix thoroughly by inversion, and place in a water bath at 70°C for about 10 min. Wait for the tissue solution to clarify and then centrifuge for 10 s.

[0054] (6) Add 200 μL of anhydrous ethanol, shake for 15 seconds, and centrifuge for 10 seconds.

[0055] (7) Add the liquid and precipitate obtained in step (6) to the adsorption column a-collection tube A, centrifuge (12000 rpm, 30 s), and discard the waste liquid.

[0056] (8) Add 500 μL of buffer GD to the adsorption column a-collection tube A (12000 rpm, 30 s) and discard the waste liquid from the centrifugation.

[0057] (9) Add 600 μL PW to adsorption column a-collection tube A, centrifuge (12000 rpm, 30 s), and discard the waste liquid.

[0058] (10) Repeat the previous step to rinse again and centrifuge (12000 rpm, 30 s). After centrifugation, open the lid and let it stand to dry the alcohol-containing rinse solution.

[0059] (11) Assemble adsorption column a-collection tube B, elute the DNA on the adsorption column membrane with a certain amount of TE solution, let it stand for 5 minutes, and then centrifuge (12000 rpm, 30 seconds).

[0060] Use a nucleic acid quality detector to test, use elution buffer TE (the reagent for dissolving DNA at the end of genome extraction) as a blank control, and start testing the sample when the concentration is ±0.2ng / μL. Take 2μL of DNA sample each time for measurement. After each sample is measured, use TE buffer solution to wash and wipe the optical surface with lens paper. The software will automatically calculate the concentration, purity and spectral image of DNA for evaluation. According to the A given by the software 260 and A 280 The OD value at the place is used for judgment. If the measured A 260 / A 280 If the value is between 1.8 and 2.2, it meets the purity requirements of DNA. 260 / A 230 The DNA extracted between 1.5 and 2.2 has less ion contamination, otherwise it needs to be re-extracted.

[0061] 2. DNA Amplification

[0062] The conventional primers used in the present invention are designed based on the S. scrofa 11.1 version as the reference genome and the porcine PLA2G4B gene sequence published in the NCBI database. The sequence of the primer pair is as follows:

[0063] F Primer (SEQ ID NO: 2): 5'-CACTGGGATGTTCCCTGGTC-3';

[0064] R Primer (SEQ ID NO: 3): 5'-ACGCCATGTCAGAAGGTCAG-3'.

[0065] The designed primer powder should be centrifuged at 4500 rpm for 1 min before use, and then ddH2O should be added according to 10 times the OD value marked on the primer. 2 Dissolve the diluted primers in 0, vortex and mix evenly, and store at 4° C. Use the primer pair for PCR amplification (reaction system and conditions see Table 1 and Table 2), purification of PCR products, cloning and sequencing, and sequence comparison analysis.

[0066] Table 1 PCR reaction system

[0067]

[0068] Table 2 PCR reaction conditions

[0069]

[0070]

[0071] The results of electrophoresis of PCR amplification products were as follows Figure 2 The obtained PCR product was purified and cloned and then sequenced. Figure 3 As shown. Through blast comparison analysis, it was found that the SNP mutation (base substitution) existed in the amplified product, i.e., the sequence, and the mutation caused the polymorphism of the PLA2G4B gene.

[0072] 3. Perform variance analysis on the protein content of the longissimus dorsi muscle of different genotypes of this molecular marker

[0073] The results of variance analysis are as follows Figure 4 As shown, the results showed that the TC genotype individuals and TT genotype individuals at the molecular marker SNP site were significantly higher than the CC genotype individuals, and the TC genotype and TT genotype were favorable genotypes for the protein content of the longissimus dorsi muscle of pigs.

[0074] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A SNP molecular marker associated with the protein content of the longissimus dorsi muscle of pigs, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and there is a T / C mutation at position 501 of the sequence.

2. The SNP molecular marker according to claim 1, characterized in that The mutation site of the SNP molecular marker has TT, TC and CC genotypes.

3. The SNP molecular marker according to claim 1, characterized in that The pigs include Beijing black pigs.

4. A primer pair for amplifying the SNP molecular marker according to any one of claims 1 to 3, characterized in that: The nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

5. A kit for detecting the protein content of longissimus dorsi muscle of pig, characterized in that: Comprising the primer pair described in claim 4.

6. Use of the SNP molecular marker according to any one of claims 1 to 3, the primer pair according to claim 4, or the kit according to claim 5 in any of the following: (1) Application in detecting protein content of longissimus dorsi muscle of pig; (2) Application in breeding pig breeds related to the protein content of the longissimus dorsi muscle; (3) Application in screening pork with high protein content.

7. A method for detecting the protein content of longissimus dorsi muscle of pig, characterized in that: The following steps are involved: The SNP molecular marker according to any one of claims 1 to 3 is amplified using a primer pair, and the protein content of the longissimus dorsi muscle of the pig is determined according to the genotype of the SNP site of the amplified product; wherein the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

8. The method according to claim 7, characterized in that The judgment standard is: the protein content of the longissimus dorsi muscle of pig individuals with TT and TC genotypes at the SNP site is higher than the protein content of the longissimus dorsi muscle of pig individuals with CC genotype.

9. A method for breeding high-protein pork, characterized in that: include: The SNP molecular marker according to any one of claims 1 to 3 is amplified using a primer pair, and the mutation site of the SNP molecular marker is retained as pork of TT and TC genotypes; the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

10. A method for breeding pig breeds related to the protein content trait of the longissimus dorsi muscle of pigs, characterized in that: include: The SNP molecular marker according to any one of claims 1 to 3 is amplified using a primer pair, and the mutation site of the SNP molecular marker is retained in pig individuals with TT and TC genotypes; the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3.

Images