KASP primer group for identifying wheat low gluten gene LGP1 molecular marker, kit and application

Abstract

The invention relates to a KASP primer group for identifying a molecular marker of a wheat low-gluten gene LGP1, a kit and application, and in particular, a gene sequence of the wheat low-gluten gene LGP1 is obtained by cloning in common wheat, and a KASP primer Kasp-lgp1-C / T / R is designed according to the difference of different sequences. Experiments prove that the molecular marker is accurate, reliable and good in repeatability, can be used for screening the wheat low-gluten gene LGP1, provides a simple and accurate detection method for effective identification and selection of the wheat low-gluten gene LGP1 in the wheat quality improvement process, and has important significance on wheat quality improvement.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat breeding, and relates to a KASP primer set, a kit and an application thereof for identifying a molecular marker of a wheat low-gluten gene LGP1. Background Art

[0002] Common wheat (Triticum aestivum L.) is the most widely cultivated food crop in the world, providing about 20% of human food calories and protein, as well as mineral trace elements, dietary fiber, vitamins, etc. [1] . Wheat is also the second largest staple food crop in my country. Because its grains contain unique gluten protein, it can be processed into a variety of flour products such as bread, steamed buns, noodles, cakes and biscuits. Although gluten plays an important role in the processing quality of wheat, it can cause gluten disorder-related diseases in special groups of people. Gluten protein, especially alcohol-soluble protein, contains a large number of allergenic peptides. Once consumed by special groups of people, it will cause some digestive system diseases, including celiac disease, wheat allergy and non-celiac gluten sensitivity. [2,3] .

[0003] Previous studies have shown that reducing the accumulation of alcohol-soluble proteins can reduce epitopes associated with wheat gluten sensitivity without affecting the processing quality of wheat, and several methods have been explored to identify wheat genotypes with reduced gluten protein accumulation or to create low-gluten transgenic lines. One is to use RNA interference technology to inhibit the expression of all or specific types of alcohol-soluble proteins in transgenic wheat plants. [4] The second is to create wheat lines with one or more alcohol-soluble protein chromosomal loci deleted [5] The third is to create a transgenic wheat strain that can express "gluten enzymes" and target the degradation of celiac-induced epitopes in the intestine. [6] . Fourth, changing the expression of gluten genes through genome editing [7,8] . In summary, these studies have indeed reduced the content of gluten components in wheat grains to a certain extent through genetic means. However, although non-GMO gene-edited crops can be obtained by separating the CRISPR / Cas9 gene editing system from the edited plants, the current regulation of gene-edited wheat is still very strict. These low-gluten materials and strains are regulated by the Genetically Modified Organisms (GMO) Organization, and their application has been concerned by many countries, especially EU countries. [4] .

[0004] The wheat low gluten mutant lgp1 was screened from the EMS mutagenesis population of the synthetic hexaploid wheat 3672. The grain glutenin and alcohol-soluble protein contents were significantly reduced, and the wheat low gluten gene LGP1 was successfully cloned. [9], which encodes a γ-alcohol-soluble protein. Sequence analysis revealed that a single base mutation from C to T in the coding region of the LGP1 gene resulted in the substitution of Ala with Val at the conservative 19th position of the signal peptide of the mutant LGP1. In the mutant lgp1, the failure of cleavage of the LGP1 signal peptide led to abnormal protein body formation, resulting in endoplasmic reticulum stress and programmed cell death, which reduced the accumulation of wheat gluten protein. The thousand-grain weight of lgp1 grains was significantly reduced, showing a wrinkled and shriveled state, which greatly reduced the yield. It is speculated that this morphological change of starch granules may be related to the aggravation of programmed cell death of endosperm cells. Since the mutant was induced by EMS, many random mutations may have occurred in the genome, but the negative effect of the lgp1 gene on yield cannot be ruled out.

[0005] In summary, the lgp1 mutation was introduced into other excellent wheat varieties that are widely promoted in order to explore the effect of the lgp1 gene on yield and other agronomic traits in different genetic backgrounds.

[0006] The commonly used method for identifying the gluten content of wheat is the polyacrylamide gel electrophoresis (SDS-PAGE) method, which is not accurate enough and has a long cycle. The workload of identifying the gluten expression is relatively large, which seriously restricts the breeding efficiency. PCR technology has the characteristics of low time and high sensitivity. It develops specific molecular markers based on the differences in gene sequences for differentiation and identification. The molecular marker method developed in recent years is considered to be a more accurate and rapid identification method. Therefore, the development of the KASP molecular marker of the wheat low gluten gene LGP1 can serve the breeding work. The molecular marker method can extract DNA for identification in the early seedling stage of the plant without having to wait until the seeds are harvested. At present, molecular markers for the efficient identification of the wheat low gluten gene LGP1 have not yet been developed, which limits the application of this method. Summary of the invention

[0007] In view of this, the object of the present invention is to provide a KASP primer set, a kit and an application for identifying the wheat low gluten gene LGP1 molecular marker.

[0008] In order to achieve the above object, the present invention provides the following technical solutions:

[0009] 1. A KASP primer set for identifying a molecular marker of a wheat low-gluten gene LGP1, comprising:

[0010] Kasp-lgp1-C: 5'-GAAGGTGACCAAGTTCATGTCAATAACCATCGGCACCGC-3', as shown in SEQ IDNO.1;

[0011] Kasp-lgp1-T: 5'-GAAGGTCGGAGTCAACGGATTCAATAACCATCGGCACCGT-3', as shown in SEQ IDNO.2;

[0012] Kasp-lgp1-R: 5′-GAATGTTTGTTGAGGTTGGGGAAA-3′, as shown in SEQ ID NO.3.

[0013] 2. Application of the aforementioned KASP primer set in the preparation of a kit for identifying the wheat low gluten gene LGP1.

[0014] 3. A kit for identifying the wheat low gluten gene LGP1, comprising the aforementioned primer set.

[0015] 4. Application of the aforementioned KASP primer set or kit in wheat breeding.

[0016] As one of the preferred technical solutions, the aforementioned KASP primer set or kit is used in the breeding of low-gluten wheat varieties.

[0017] 5. A method for identifying the low gluten gene LGP1 of wheat, using the DNA of the wheat sample to be tested as a template and the aforementioned primer set as a detection primer for PCR amplification to determine whether the amplified product contains the low gluten gene LGP1.

[0018] As one of the preferred technical solutions, the PCR amplification system is as follows:

[0019] DNA template, 50 ng;

[0020] HiGeno2×Probe MixA, 4 μL;

[0021] Kasp-lgp1-C, 10μM, 0.5μL;

[0022] Kasp-lgp1-T, 10μM, 0.5μL;

[0023] Kasp-lgp1-R, 10 μM, 1 μL;

[0024] Add double distilled water to make up to 10 μL.

[0025] As one of the preferred technical solutions, the PCR reaction conditions are as follows:

[0026] 95°C, 10 minutes;

[0027] 95°C, 20 seconds;

[0028] 65-55℃, decrease 0.6℃ each cycle, 10 cycles in total;

[0029] 95°C, 20 seconds;

[0030] 55°C, 40 seconds, 32 cycles.

[0031] As one of the preferred technical solutions, the individual strain with KASP typing of lgp1 haplotype indicates that it contains the low gluten gene LGP1.

[0032] The beneficial effects of the present invention are:

[0033] The invention provides a KASP primer set, a kit and an application thereof for identifying whether a wheat variety contains a wheat low gluten gene LGP1 molecular marker.

[0034] The invention clones the gene sequence of wheat low gluten gene LGP1 in common wheat, and designs KASP primers Kasp-lgp1-C / T / R according to the differences of different sequences. Experiments prove that the molecular marker is accurate, reliable and has good repeatability, and can be used for screening wheat low gluten gene LGP1, providing a simple and accurate detection method for the effective identification and selection of wheat low gluten gene LGP1 in the process of wheat quality improvement, which is of great significance to wheat quality improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0036] Figure 1 for LGP1 sequence differences;

[0037] Figure 2 Typing of Kasp-lgp1 markers for Zhoumai 16 (ZM16) and lgp1;

[0038] Figure 3 Typing of the F2 hybrid of ZM16 / lgp1 by Kasp-lgp1 marker;

[0039] Figure 4 This is the SDS-PAGE gel image of F2:3 seeds of ZM16 / lgp1, wherein the first lane is the maternal parent ZM16, the second lane is the paternal parent lgp1, and A87-1~8, A63-1~8, and A111-1~8 respectively represent the 8 seeds produced on the F2:3 single plant. DETAILED DESCRIPTION

[0040] The preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

[0041] 1. Acquisition and sequencing of LGP1 sequence

[0042] (1) The DNA extracted from artificial wheat 3672 (WT), mutant lgp1, and six extended wheat materials, including Zhoumai 16, Jimai 22, Liangxing 99, Nongda 3753, Zhengmai 9023, and Shannong 22, was used as template. The genomic DNA was extracted from them using the CTAB method, dissolved in ddH2O and measured the concentration, and then diluted to about 120 ng / μl.

[0043] (2) Using the resequencing information of various varieties obtained by the applicant in the early stage, multiple sets of primers were designed in the 2000bp upstream and downstream of the LGP1 gene, and the high-fidelity enzyme Tks Gflex was used to TM DNA Polymerase (TaKaRa, R060Q) PCR amplification products, and specific primers 1200F2 / R1 were obtained according to the sequencing results (Table 1);

[0044] Table 1 Igp1 amplification specific primers development

[0045] Primer name Primer sequences 1200F2 GACTGGAGCAACACTCTGGG 1200R1 GAGAGGAAAGAGTTCGCCGG

[0046] (3) The amplified products were sent to the company for sequencing. Except for the mutant lgp1, a single base mutation CT occurred at position 56 in the coding region of the LGP1 gene (TraesCS1D02G001200) Figure 1 ), and the rest of the varieties were consistent with the wild type.

[0047] 2. Development of LGP1 molecular marker

[0048] (1) Based on the full-length sequence alignment, specific KASP primers were designed at the differential sites, and a set of primers Kasp-lgp1-C / T / R was developed (Table 2);

[0049] Table 2 Kasp-lgp1 molecular marker development

[0050] Primer name Primer sequences Kasp-lgp1-C GAAGGTGACCAAGTTCATGCTCAATAACCATCGGCACCGC Kasp-lgp1-T GAAGGTCGGAGTCAACGGATTCAATAACCATCGGCACCGT Kasp-lgp1-R GAATGTTTGTTGAGGTTGGGGAAA

[0051] (2) To verify the accuracy of the marker, KASP marker typing was performed on synthetic wheat 3672, mutant lgp1, and six extended wheat materials. The fluorescence signal was read using a CFX96 real-time quantitative PCR instrument (Bio-Rad, Hercules, California, USA). The results showed that the KASP typing was consistent with the sequencing results, indicating that the marker can distinguish LGP1 from lgp1 ( Figure 2 ). The results showed that KASP typing was consistent with the sequencing results, so Kasp-lgp1 can be used for molecular marker-assisted selection in subsequent quality breeding.

[0052] 3. Application of LGP1 molecular marker

[0053] The six promoted varieties were hybridized with mutant lgp1, and the hybrid F2 was verified by KASP marker typing. The KASP typing results were found ( Figure 3 ) and SDS-PAGE methods to identify the phenotype of HMW-GSs ( Figure 4 ), which once again verified that Kasp-lgp1 can be used for molecular marker-assisted selection in subsequent low-gluten wheat breeding.

[0054] 4. Materials and Methods

[0055] (1) Genomic DNA extraction

[0056] CTAB method to extract DNA:

[0057] 1. Take 2 cm fresh leaves, put them into a 2.0 mL centrifuge tube, add small steel balls, and grind them into powder using liquid nitrogen.

[0058] 2. Add 650 μL of CTAB, mix by inversion, and bake in an oven at 65°C for 40 min, mixing by inversion every 10 min.

[0059] 3. Cool to room temperature, add 650 μL of chloroform, shake well and let stand for 2 minutes.

[0060] 4. Centrifuge at 12000rpm for 10 minutes at room temperature.

[0061] 5. Pipette 500 μL of supernatant into a new centrifuge tube, add 500 μL of isopropanol, and precipitate at -20°C for 1 hour.

[0062] 6. Centrifuge, discard the supernatant, add 800 μL of 75% ethanol, and rinse twice.

[0063] 7. Discard the supernatant, dry, and add water to dissolve.

[0064] (2) Gene cloning and sequence analysis

[0065] Chromosome 1D specific primers were designed based on the sequence of the reference genome (Table 1), and then the full length of the lgp1 gene was amplified using the DNA of the wild-type WT and mutant lgp1 as templates. The specific primer design and amplification procedures are shown in Tables 3-6.

[0066] Table 3 PCR reaction system

[0067] Tks Gflex DNA Polymerase 1μL 2×Gflex PCR Buffer 25μL 1200F2 2μL(10μM) 1200R1 2μL(10μM) DNA 500ng Double distilled water Make up to 50 μL

[0068] Table 4 PCR amplification program

[0069]

[0070] Table 5 PCR reaction system

[0071] DNA template 50ng HiGeno2×Probe MixA 4μL Kasp-lgp1-C 0.5μL(10μM) Kasp-lgp1-T 0.5μL(10μM) Kasp-lgp1-R 1μL(10μM) Double distilled water Make up to 10 μL

[0072] Table 6 PCR amplification program

[0073] 95℃ 10 minutes 95℃ 20 seconds 65-55℃ Each cycle decreases by 0.6℃, for a total of 10 cycles 95℃ 20 seconds 55℃ 40 seconds, 32 cycles

[0074] The fluorescence signal was read by CFX96 real-time quantitative PCR instrument (Bio-Rad, Hercules, California, USA), and the fluorescence signal was converted into genotype by BIO-RAD CFX Maestro original.

[0075] (4) Wheat grain glutenin extraction

[0076] (4-1) Reagent preparation

[0077] 1. Gluten extract A: 75 mL isopropanol, 44.967 g NaI, dilute to 1 L with deionized water;

[0078] 2. Gluten extract B: 50 mL isopropanol, 8 mL 1 M Tris-HCl (pH = 8.0), 20 g SDS, 4 g dithiothreitol (DTT), dilute to 200 mL with deionized water;

[0079] 3. Gluten extract C: 50 mL isopropanol, 8 mL 1 M Tris-HCl (pH = 8.0), 20 g SDS (sodium dodecyl sulfate), 2.8 mL 4-vinylpyridine (VP), dilute to 200 mL with deionized water;

[0080] 4. Gluten extract D: 625 mL of 1 M Tris-HCl (pH = 6.8), 5 mL of mercaptoethanol, 200 mL of glycerol, 20 g of SDS, 2 mL of bromophenol blue, dilute to 1 L with deionized water;

[0081] (4-2) Gluten extraction

[0082] 1. Take a wheat seed, grind it into powder with a grinder, transfer it to a 2mL centrifuge tube, add 800μL of extraction solution A, vortex thoroughly to mix, and then place it in a 65℃ oven for extraction for 1h, shaking it every 10min;

[0083] 2. Centrifuge at 12000rpm for 5min at room temperature and discard the supernatant;

[0084] 3. Repeat step 2 twice;

[0085] 4. Add 200 μL of extraction solution B, vortex to mix thoroughly, and then place in a 65°C oven for extraction for 1 hour, shaking once every 10 minutes;

[0086] 5. Centrifuge at 12000 rpm for 5 min at room temperature;

[0087] 6. Add 200 μL of extraction solution C and vortex thoroughly to mix, then place in a 65°C oven for extraction for 30 min, shaking every 10 min;

[0088] 7. Centrifuge at 12000 rpm for 5 min at room temperature;

[0089] 8. Transfer 200 μL of supernatant to a new 2 mL centrifuge tube, add 200 μL of extract D, invert to mix, let stand for 30 min, boil at 100°C for 5 min, and cool to room temperature. This is the wheat grain glutenin extract.

[0090] (5) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)

[0091] 1. Gel preparation: Grain glutenin subunits were separated by SDS-PAGE. The discontinuous buffer system of the system was 10% (w / v) separation gel (Table 7) and 5% (w / v) stacking gel (Table 8); 5% stacking gel: 500 μL 10% ammonium persulfate and 50 μL tetramethylethylenediamine were added to 50 mL of 5% stacking gel.

[0092] Table 7 10% separation gel (0.75 mm plate)

[0093]

[0094] Table 8 5% stacking gel:

[0095]

[0096] 2. Sample loading: After the gel is completely polymerized, slowly pull out the sample well comb, rinse the gel plate with distilled water and carefully install it in the electrophoresis tank, add the pre-prepared 1× Tris-Glycine electrode buffer, and add the pre-prepared gluten sample to the sample well. The sample loading volume is 10μL;

[0097] 3. Electrophoresis: 80V constant voltage, electrophoresis for 30 minutes until the gel is separated, adjust to 120V constant voltage and electrophoresis for 3h 30min.

[0098] 4. Coomassie staining: After electrophoresis, place the gel in Coomassie brilliant blue staining solution, slowly shake and stain for 20 minutes in a fume hood, and decolorize with distilled water until the bands are clear. Figure 4Since HMW-GSs are easier to detect and more representative than other gluten proteins, 8 seeds were randomly selected from each plant after harvest at maturity and HMW-GSs were identified by SDS-PAGE. The phenotype of the plant was determined by the phenotypic separation of the 8 seeds. The HMW-GS bands of the 8 seeds of A87-1 to 8 all showed the normal type of the parent Zhoumai 16, so A87-1 was determined to be WT type; the HMW-GS bands of the 8 seeds of A63-1 to 8 were separated, so A63-1 was determined to be heterozygous; the HMW-GS bands of the 8 seeds of A111-1 to 8 all showed the low expression type of the parent lgp1, so A111-1 was determined to be lgp1 type.

[0099] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

[0100] References

[0101] 1.Shewry PR,Hey SJ.2015.The contribution of wheat to human diet and health.Food Energy Secur 4:178-202

[0102] 2. Sapone A, Bai JC, Ciacci C, Dolinsek J, Green PH, et al. 2012. Spectrum of gluten-related disorders: consensus on new nomenclature and classification. BMCmedicine 10:13

[0103] 3.Pietzak M.2012.Celiac Disease,Wheat Allergy,and Gluten Sensitivity:When Gluten Free Is Not a Fad.Journal of Parenteral&Enteral Nutrition 36:68S-75S

[0104] 4.Garcia-Molina MD,Gimenez MJ,Sanchez-Leon S,Barro F.2019.Gluten FreeWheat:Are We There?Nutrients 11:4

[0105] 5.Waga J,Zientarski J,Szaleniec M, K,Dyga W,SkoczowskiA.2013.Null alleles in gliadin coding loci and wheat allergenic properties.American Journal of Plant Sciences 4:160-68

[0106] 6.Osorio CE,Wen N,Mejias JH,Liu B,Reinbothe S,et al.2019.Development of wheat genotypes expressing a glutamine-specific endoprotease from barleyand a prolyl endopeptidase from Flavobacterium meningosepticum or Pyrococcusfuriosus 19:123-3

[0107] Science 361:866-69 7.Knott GJ,Doudna JA.2018

[0108] 8. Sanchez-Leon S, Gil-Humanes J, Ozuna CV, Gimenez MJ, Sousa C, et al

[0109] 9.Chen Q,Yang C,Zhang Z,Wang Z,Chen Y,et al.2022.Unprocessed wheatγ-gliadin reduces gluten accumulation associated with the endoplasmic reticulumstress and elevated cell death.New Phytol 236:146-64。

Claims

1. A KASP primer set for identifying the molecular marker of wheat low gluten gene LGP1, characterized in that: include: Kasp-lgp1-C: 5′-GAAGGTGACCAAGTTCATGCTCAATAACCATCGGCACCGC-3′, as shown in SEQ ID NO. 1; Kasp-lgp1-T: 5′-GAAGGTCGGAGTCAACGGATTCAATAACCATCGGCACCGT-3′, as shown in SEQ ID NO. 2; Kasp-lgp1-R: 5′-GAATGTTTGTTGAGGTTGGGGAAA-3′, as shown in SEQ ID NO.

3.

2. Use of the KASP primer set according to claim 1 in preparing a kit for identifying the wheat low gluten gene LGP1.

3. A kit for identifying the wheat low gluten gene LGP1, characterized in that: Comprising the primer set of claim 1.

4. Use of the KASP primer set according to claim 1 or the kit according to claim 3 in wheat breeding.

5. Use of the KASP primer set according to claim 1 or the kit according to claim 3 in breeding low-gluten wheat varieties.

6. A method for identifying wheat low gluten gene LGP1, characterized in that: The DNA of the wheat sample to be tested is used as a template and the above primer set is used as a detection primer to perform PCR amplification to determine whether the amplified product contains the low gluten gene LGP1.

7. The method according to claim 6, characterized in that The PCR amplification system is as follows: DNA template, 50 ng; HiGeno2×Probe MixA, 4 μL; Kasp-lgp1-C, 10μM, 0.5μL; Kasp-lgp1-T, 10μM, 0.5μL; Kasp-lgp1-R, 10 μM, 1 μL; Add double distilled water to make up to 10 μL.

8. The method according to claim 6, characterized in that The PCR reaction conditions are as follows: 95°C, 10 minutes; 95°C, 20 seconds; 65-55℃, decrease 0.6℃ each cycle, 10 cycles in total; 95°C, 20 seconds; 55°C, 40 sec, 32 cycles.

9. The method according to claim 6, characterized in that Individual strains classified as lgp1 haplotype by KASP contain the low gluten gene LGP1.

Images