KASP markers closely linked to wheat thousand-grain weight gene and their applications

Abstract

This invention relates to the fields of molecular biology and crop breeding technology, and particularly to KASP markers closely linked to the wheat thousand-grain weight gene and their applications. The TGW265 primer consists of a first primer or a derivative thereof, a second primer or a derivative thereof, and a third primer; the TGW57 primer consists of a fourth primer or a derivative thereof, a fifth primer or a derivative thereof, and a sixth primer; the sequences of the first, second, third, fourth, fifth, and sixth primers are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively. TGW265 and TGW57 are molecular markers closely linked to the thousand-grain weight gene and can be used for marker-assisted selection to screen for high-thousand-grain-weight wheat materials. Furthermore, the KASP markers closely linked to the thousand-grain weight gene described in this invention are molecular markers closely linked to the thousand-grain weight gene, enabling high-throughput, rapid seedling-stage marker-assisted selection and accelerating the breeding process.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and crop breeding technology, and in particular to the KASP marker closely linked to the wheat thousand-grain weight gene and its application. Background Technology

[0002] Wheat is one of my country's most important food crops. Faced with the dual pressures of a continuously growing population and decreasing arable land, cultivating high-yielding and stable-yielding wheat varieties is particularly urgent. Wheat yield is the result of multiple factors, among which thousand-grain weight, grains per spike, and spikes per acre constitute the three major factors. Among these factors, thousand-grain weight, due to its high heritability, is a relatively stable factor in improving wheat yield potential. Identifying key loci or genes related to wheat thousand-grain weight and developing tightly linked molecular markers is of great significance for improving wheat thousand-grain weight.

[0003] Currently, a series of grain weight-related genes have been identified in wheat through homologous cloning of thousand-grain weight genes from model plants such as rice and Arabidopsis thaliana. Only a few genes have been obtained through forward cloning, including Tasg-D1, KAT-2A, TaACT7-D, TaTGW-7A, TaTPP-7A, and TaGL1. Among them, KAT-2A (Chen Y et al., 2020) and TaACT7-D (Li X et al., 2023) were cloned using mutants generated by EMS mutagenesis, located on chromosomes 6B and 1DS, respectively. TaTGW-7A was the earliest cloned wheat thousand-grain weight gene. Haplotype analysis revealed that the dominant allele for high thousand-grain weight, TaTGW-7Aa, has a high frequency in core wheat germplasm (65.0%) and 501 wheat varieties (86.0%) in China, indicating that this allele has a strong positive selection effect in wheat breeding (Hu MJ, et al., 2016). TaTPP-7A, located on the short arm of chromosome 7A, encodes trehalose-6-phosphate phosphatase. This gene is specifically expressed during grain development, affecting grain filling and size. Further research revealed that TaTPP-7A is an important target gene for domestication breeding, primarily regulating the cleavage, transport, and utilization of sucrose in the endosperm through the T6P-SnRK1 pathway and sugar-abscisic acid interaction feedback (Liu H, et al., 2023). Tasg-D1 encodes a serine / threonine protein kinase glycogen synthase kinase 3 (GSK3) containing a TREE domain, exhibiting pleiotropic effects and simultaneously influencing multiple traits such as plant height, thousand-grain weight, ear length, and ear density (Cheng X, et al., 2020). TaGL1 is located on chromosome 1B, with a 97 bp insertion / deletion found in the ninth intron, co-segregating with the grain length phenotype. Overexpression of TaGL1 increased wheat grain length by 10.14% and thousand-grain weight by 12.45%. TaGL1 termination mutations resulted in a decrease in wheat grain length by 10.60-11.74% and a decrease in thousand-grain weight by 16.33-36.53%, indicating that TaGL1 positively regulates wheat grain length, thereby altering total grain weight (Niaz M, et al., 2023).

[0004] Numerous grain weight-related QTLs have been identified in wheat, and the following chelates have been developed: GS7D (Zhang YJ, et al., 2014), TG23 (Hu MJ, et al., 2016), TaGW8-7B (Yan XF, et al., 2019), and TaSus2-2B. tgwFunctional markers such as CWI22 (Ma DY, et al., 2012), CWI21 (Ma DY, et al., 2012), and TKX3D (Lu J, et al., 2015) can be used to quickly and accurately identify the distribution of genes controlling grain weight and their variant types in different wheat varieties. Against the backdrop of continuous global population growth, the surge in food demand makes research on improving wheat yield particularly urgent. Therefore, exploring and utilizing more abundant new grain weight gene resources has become an important task in wheat breeding and research, and is of great significance for breeding high-yielding and widely adaptable new wheat varieties. Summary of the Invention

[0005] The purpose of this invention is to provide a KASP marker closely linked to the wheat thousand-grain weight gene and its application, to screen wheat materials with high thousand-grain weight, and to accelerate the breeding process.

[0006] The technical solution for which this invention seeks protection is as follows:

[0007] This invention provides KASP markers closely linked to the wheat thousand-grain weight gene, including TGW265 and TGW57; wherein, TGW265 is composed of a first primer or a derivative thereof, a second primer or a derivative thereof, and a third primer; and TGW57 is composed of a fourth primer or a derivative thereof, a fifth primer or a derivative thereof, and a sixth primer;

[0008] The sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer, and the sixth primer are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively.

[0009] The derivative of the first primer is a single-stranded DNA molecule as shown in SEQ ID NO:1 with a first fluorescent sequence attached to its 5' end; the derivative of the second primer is a single-stranded DNA molecule as shown in SEQ ID NO:2 with a second fluorescent sequence attached to its 5' end; the first fluorescent sequence is the fluorescent sequence FAM; the second fluorescent sequence is the fluorescent sequence HEX.

[0010] The derivative of the fourth primer is a single-stranded DNA molecule as shown in SEQ ID NO:4 with a third fluorescent sequence attached to its 5' end; the derivative of the fifth primer is a single-stranded DNA molecule as shown in SEQ ID NO:5 with a fourth fluorescent sequence attached to its 5' end; the third fluorescent sequence is the fluorescent sequence FAM; the fourth fluorescent sequence is the fluorescent sequence HEX.

[0011] The nucleotide sequences of the two forward primers for the TGW265 alleles with different terminal bases are as follows: 5'GAAGGTGACCAAGTTCATGCTccagaataacttccgcttccaC 3' (SEQ ID NO:7), 5'GAAGGTCGGAGTCAACGGATTccagaataacttccgcttccaT 3' (SEQ ID NO:8).

[0012] The nucleotide sequence of the universal reverse primer for TGW265 is: 5'gacgagtcctcaataattCgataC 3' (SEQ ID NO:3);

[0013] The nucleotide sequences of the two forward primers for the TGW57 alleles with different terminal bases are: 5'GAAGGTGACCAAGTTCATGCTggggtccagagagtcaccG 3' (SEQ ID NO:9) and 5'GAAGGTCGGAGTCAACGGATTggggtccagagagtcaccA3' (SEQ ID NO:10).

[0014] The nucleotide sequence of the universal reverse primer for TGW57 is: 5'accaaggctcgaaacatgcaG 3' (SEQ ID NO: 6).

[0015] The present invention also provides a PCR reagent containing the KASP marker, which is closely linked to the wheat thousand-grain weight gene.

[0016] The present invention also provides a kit containing a KASP marker or the PCR reagent that is closely linked to the wheat thousand-grain weight gene.

[0017] The application of the KASP marker closely linked to the wheat thousand-grain weight gene, or the PCR reagent, or the kit, in at least one of the following is also within the scope of protection of this invention:

[0018] (A) To identify or assist in the identification of the thousand-grain weight of wheat;

[0019] (B) Preparation of wheat thousand-grain weight products for identification or auxiliary identification;

[0020] (C) Detecting, screening, or breeding high-thousand-grain-weight wheat;

[0021] (D) Preparation, detection, screening, or breeding of high thousand-grain weight wheat products;

[0022] (E) Identify or assist in the identification of wheat thousand-grain weight genotype.

[0023] The present invention also provides a method for identifying or assisting in the identification of wheat thousand-grain weight, comprising the following steps: performing a KASP reaction on the wheat to be tested using the KASP marker closely linked to the wheat thousand-grain weight gene, detecting the reaction product, and the thousand-grain weight of the wheat to be tested being greater than ...

[0024] This invention also provides a method for identifying or assisting in the identification of wheat thousand-grain weight genotypes, comprising the following steps: performing a KASP reaction on the wheat to be tested using the KASP marker that is closely linked to the wheat thousand-grain weight gene, detecting the reaction product, and identifying the wheat to be tested that produces a color of fluorescent sequence linked to the 5' end of the DNA molecule as shown in SEQ ID NO:1 or SEQ ID NO:4 as a high thousand-grain weight genotype wheat.

[0025] This invention uses BSA-Seq preliminary mapping analysis to locate the thousand-grain weight gene on chromosome 4A. Using KASP molecular marker development and genetic linkage map construction, the thousand-grain weight gene is located within a 3.05 cM interval between the 4AS markers TGW265 and TGW57. TGW265 and TGW57 are tightly linked molecular markers to the thousand-grain weight gene and can be used for marker-assisted selection to screen for new wheat materials.

[0026] Beneficial effects:

[0027] This invention provides a KASP marker closely linked to the wheat thousand-grain weight gene and its application. The markers include TGW265 and TGW57, which are molecular markers closely linked to the thousand-grain weight gene and can be used for marker-assisted selection to screen for high-thousand-grain-weight wheat materials. Furthermore, the KASP markers described in this invention, being molecular markers closely linked to the thousand-grain weight gene, enable high-throughput, rapid seedling-stage marker-assisted selection, accelerating the breeding process. Attached Figure Description

[0028] Figure 1 This is a comparison of the thousand-grain weight of wild-type Jing411 and mutant je0193 in an embodiment of the present invention; wherein: in A, the left is wild-type Jing411 and the right is mutant je0193; in B, the left is wild-type Jing411 and the right is mutant je0193.

[0029] Figure 2 This is a schematic diagram of the initial localization analysis of the thousand-grain weight gene in an embodiment of the present invention.

[0030] Figure 3This is a schematic diagram of the genetic location of the thousand-grain weight gene on the 4AS chromosome in an embodiment of the present invention.

[0031] Figure 4 The results of TGW265 and TGW57 KASP marker detection in this embodiment of the invention are shown below; blue dots represent samples with wild-type Jing411 genotype, red dots represent samples with mutant je0193 genotype, and green dots represent heterozygous samples; where A is the TGW265 KASP marker detection result and B is the TGW57 KASP marker detection result. Detailed Implementation

[0032] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for explanation and illustration only and do not limit the scope of the present invention in any way.

[0033] First set of examples: KASP markers closely linked to the wheat thousand-grain weight gene.

[0034] This set of embodiments provides KASP markers closely linked to the wheat thousand-grain weight gene, including TGW265 and TGW57; wherein, TGW265 is composed of a first primer or a derivative thereof, a second primer or a derivative thereof, and a third primer; and TGW57 is composed of a fourth primer or a derivative thereof, a fifth primer or a derivative thereof, and a sixth primer;

[0035] The sequences of the first primer, second primer, third primer, fourth primer, fifth primer, and sixth primer are shown in SEQ ID NO:1 (ccagaataac ttccgcttcc ac), SEQ ID NO:2 (ccagaataac ttccgcttccat), SEQ ID NO:3 (gacgagtcct caataattCg ataC), SEQ ID NO:4 (ggggtccagagagtcaccg), SEQ ID NO:5 (ggggtccaga gagtcaccA), and SEQ ID NO:6 (accaaggctcgaaacatgca g).

[0036] The derivative of the first primer is a single-stranded DNA molecule as shown in SEQ ID NO:1 with a first fluorescent sequence attached to its 5' end; the derivative of the second primer is a single-stranded DNA molecule as shown in SEQ ID NO:2 with a second fluorescent sequence attached to its 5' end; the first fluorescent sequence is the fluorescent sequence FAM; the second fluorescent sequence is the fluorescent sequence HEX.

[0037] The derivative of the fourth primer is a single-stranded DNA molecule as shown in SEQ ID NO:4 with a third fluorescent sequence attached to its 5' end; the derivative of the fifth primer is a single-stranded DNA molecule as shown in SEQ ID NO:5 with a fourth fluorescent sequence attached to its 5' end; the third fluorescent sequence is the fluorescent sequence FAM; the fourth fluorescent sequence is the fluorescent sequence HEX.

[0038] The nucleotide sequences of the two forward primers for the TGW265 alleles with different terminal bases are as follows: 5'GAAGGTGACCAAGTTCATGCTccagaataacttccgcttccaC 3' (SEQ ID NO:7), 5'GAAGGTCGGAGTCAACGGATTccagaataacttccgcttccaT 3' (SEQ ID NO:8).

[0039] The nucleotide sequence of the universal reverse primer for TGW265 is: 5'gacgagtcctcaataattCgataC3' (SEQ ID NO:3);

[0040] The nucleotide sequences of the two forward primers for the TGW57 alleles with different terminal bases are: 5'GAAGGTGACCAAGTTCATGCTggggtccagagagtcaccG3' (SEQ ID NO:9) and 5'GAAGGTCGGAGTCAACGGATTggggtccagagagtcaccA3' (SEQ ID NO:10).

[0041] The nucleotide sequence of the TGW57 universal reverse primer is: 5'accaaggctcgaaacatgcaG3' (SEQ ID NO: 6).

[0042] Second set of examples, a PCR reagent

[0043] This set of examples provides PCR reagents containing the KASP marker, which is closely linked to the wheat thousand-grain weight gene.

[0044] Third set of embodiments, a reagent kit

[0045] This set of examples provides kits containing a KASP marker or the PCR reagent that is closely linked to the wheat thousand-grain weight gene.

[0046] Fourth set of examples, application of KASP markers or PCR reagents or kits

[0047] This set of examples provides the application of the KASP marker closely linked to the wheat thousand-grain weight gene as described in the first set of examples, or the PCR reagent as described in the second set of examples, or the kit as described in the third set of examples, in at least one of the following:

[0048] (A) To identify or assist in the identification of the thousand-grain weight of wheat;

[0049] (B) Preparation of wheat thousand-grain weight products for identification or auxiliary identification;

[0050] (C) Detecting, screening, or breeding high-thousand-grain-weight wheat;

[0051] (D) Preparation, detection, screening, or breeding of high thousand-grain weight wheat products;

[0052] (E) Identify or assist in the identification of wheat thousand-grain weight genotype.

[0053] Fifth set of examples, methods for identifying or assisting in the identification of wheat thousand-grain weight

[0054] This set of embodiments provides a method for identifying or assisting in the identification of wheat thousand-grain weight, comprising the following steps: performing a KASP reaction on the wheat to be tested using the KASP marker closely linked to the wheat thousand-grain weight gene, detecting the reaction product, and the thousand-grain weight of the wheat to be tested being greater than ...

[0055] Sixth set of examples: Methods for identifying or assisting in the identification of wheat thousand-grain weight genotype

[0056] This set of embodiments provides a method for identifying or assisting in the identification of wheat thousand-grain weight genotype, including the following steps: performing a KASP reaction on the wheat to be tested using the KASP marker that is closely linked to the wheat thousand-grain weight gene, detecting the reaction product, and identifying the wheat to be tested that produces a color of fluorescent sequence linked to the 5' end of the DNA molecule as shown in SEQ ID NO:1 or SEQ ID NO:4 as a high thousand-grain weight genotype wheat.

[0057] Experimental Example

[0058] Sources of biological materials:

[0059] Wild-type wheat: Jing 411, a known variety that has passed variety approval (purchased from Beijing Seed Company).

[0060] Wheat mutant je0193: It is a stable thousand-grain weight mutant material derived from Jing 411 by EMS mutagenesis. The public can obtain it from the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. The mutagenesis method is as follows: Soak the dry seeds of Jing 411 in water for 10 hours, then treat them with 1.0% EMS for 4 hours, and at the same time conduct gentle shaking at 50 rpm under dark conditions. Rinse the treated seeds under running water for 4 hours, and then plant them in the field. After continuous planting for 6 generations, the stable thousand-grain weight mutant je0193 was screened out.

[0061] Experimental Example 1. Comparison of thousand-grain weight between wild type and mutant je0193

[0062] 1. Experimental materials and methods

[0063] Plant wild type Jing 411 and mutant je0193 in the experimental field of the Zhongpu Field of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. Plant 15 plants in each row, with a row length of 2 meters. After the wheat matures and is harvested in June, use the Wanshen SC-G type automatic full grain seed examination and thousand-grain weight meter (Hangzhou Wanshen Detection Technology Co., Ltd.) to measure the thousand-grain weight. Measure the thousand-grain weight continuously for three years from 2022 to 2024, with at least 5 replicates each time.

[0064] 2. Experimental results

[0065] Identify the thousand-grain weight of wild type Jing 411 and mutant je0193. After continuous measurement for three years, the results show that the thousand-grain weights of wild type Jing 411 and mutant je0193 are 44.7 - 58.7 g and 29.1 - 45.4 g respectively. Through statistical comparison, it is found that the thousand-grain weight of mutant je0193 is significantly lower than that of wild type Jing 411 (P < 0.0001); compared with the wild type, the thousand-grain weight of mutant je0193 is reduced by 30% ( Figure 1 in B).

[0066] Experimental Example 2. Initial localization of thousand-grain weight gene based on exon capture resequencing

[0067] 1. Genetic population construction and experimental methods

[0068] Reciprocally cross mutant je0193 with wild type parent Jing 411 to obtain an F2 population with 524 individual plants for subsequent gene mapping analysis. Take leaf samples from individual plants of the two F2 populations, extract DNA for subsequent mapping analysis. Under normal field cultivation conditions, harvest the seeds after the wheat matures, and measure the thousand-grain weight of each individual plant.

[0069] Based on the thousand-grain weight phenotypic data, 15-25 individuals with high and low thousand-grain weights were selected from two F2 populations, and their DNA was mixed in equal amounts to construct extreme high and low thousand-grain weight pools. Whole-exome capture resequencing was used to re-sequencing the pooled DNA and the DNA from both parents. Based on the genotype data obtained from the resequencing, the QTLseqr algorithm was used to filter and analyze differential loci in the pooled DNA and parents to determine the chromosomal segments of the thousand-grain weight gene.

[0070] 2. Experimental Results

[0071] Using BSA set separation analysis, the QTLseqr algorithm was employed to filter and screen exon capture sequencing data from the constructed high-thousand-grain-weight and low-thousand-grain-weight F2 single-plant pools. Based on the genotypes and sequencing depth of the identified differentially expressed loci, combined with pool phenotypic information, ED association analysis was performed. The ED value reflected the linkage strength between the SNP locus and the thousand-grain-weight gene. A QTL controlling thousand-grain-weight was identified on chromosome 4A. Figure 2 ).

[0072] Experiment Example 3: Genetic linkage mapping and verification of the thousand-grain weight gene

[0073] 1. Experimental Methods

[0074] Based on the polymorphic sites on chromosome 4A of the two parents, Jing411 and je0193, obtained by exon capture resequencing, two forward primers with different terminal bases and one reverse primer were designed based on known flanking sequences. Sequences with different fluorescent probes were ligated to the 5' ends of the two forward primers. Using KASP Master mix (LGC), the genotype of the sample could be determined based on the fluorescence signal detected after PCR amplification. Based on the SNP sites of Jing411 and je0193 on chromosome 4A, a total of 67 pairs of KASP marker primers were designed. By detecting the genotypes of the parents and individual plants in some populations, 14 pairs of KASP markers with good genotyping were screened and used for genetic linkage map construction.

[0075] 524 individual plants in the Jing 411 / je0193 F2 population were analyzed. The genotype of each individual plant was determined by KASP marker detection. Combined with genotype and thousand-grain weight phenotype data, genetic linkage analysis of the thousand-grain weight gene was performed using QTL IciMapping 4.0 software.

[0076] The above method was used to obtain a pair of KASP markers, TGW265 and TGW57, which are closely linked to the wheat thousand-grain weight gene. The nucleotide sequences of the two forward primers for TGW265 with different terminal alleles are: 5'GAAGGTGACCAAGTTCATGCTccagaataacttccgcttccaC 3' (SEQ ID NO:7) and 5'GAAGGTCGGAGTCAACGGATTccagaataacttccgcttccaT 3' (SEQ ID NO:8). The nucleotide sequence of the universal reverse primer for TGW265 is: 5'gacgagtcctcaataattCgataC 3' (SEQ ID NO:3), and the amplified band length is 54bp. The nucleotide sequences of the two forward primers for TGW57 with different terminal alleles are: 5'GAAGGTGACCAAGTTCATGCTggggtccagagagtcaccG 3' (SEQ ID NO:9) and 5'GAAGGTCGGAGTCAACGGATTggggtccagagagtcaccA 3' (SEQ ID NO:8). The nucleotide sequence of the universal reverse primer for TGW57 (SEQ ID NO: 10) is 5'accaaggctcgaaacatgcaG 3' (SEQ ID NO: 6), and the amplified band length is 29bp.

[0077] The fluorescent tag sequences attached to the 5' end of the forward primers of TGW265 and TGW57 are FAM and HEX, respectively; the sequences of FAM and HEX are shown in SEQ ID NO:11 (5'GAAGGTGACCAAGTTCATGCT) and SEQ ID NO:12 (5'GAAGGTCGGAGTCAACGGATT).

[0078] The TGW265 and TGW57 KASP reaction system consisted of: 2.5 μL of 2×KASP Master mix, 0.07 μL of primer mix (12 μL each of the two forward primers, 36 μL of universal primers, and 40 μL of ultrapure water to a final volume of 100 μL), 0.04 μL of 50 mM MgCl2, 30 ng of genomic DNA, and 5 μL of ultrapure water to a final volume of 5 μL. The PCR amplification program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃ annealing for 1 min, for a total of 9 cycles, with each cycle decreasing by 0.6℃; 94℃ denaturation for 20 s, 57℃ annealing for 1 min, for a total of 30 cycles.

[0079] The results of the PCR products were obtained by detecting the fluorescence signals with a FLUOstar Omega microplate reader. The amplified products with FAM sequence tags were labeled blue, and the amplified products with HEX sequence tags were labeled red. The primers for the FAM sequence tags were at locus C (TGW265) or locus G (TGW57), and the primers for the HEX sequence tags were at locus T (TGW265) or locus A (TGW57).

[0080] 2. Experimental results

[0081] Using the KASP markers, the F2 segregating population was genotyped to obtain the population genotypes. Combining with the phenotypes, a genetic linkage map was constructed. The results showed that the thousand-grain weight gene was located in the interval of about 3.05 cM between the markers TGW265 and TGW57 on the short arm of chromosome 4A (calculated by QTL IciMapping 4.0 software)( Figure 3 ), the LOD value was 4.12, and the phenotypic contribution rate was 3.95% (the calculation methods of the LOD value and the phenotypic contribution rate are shown in the following non-patent literature: Meng et al. 2015, QTL IciMapping: Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop Journal 3, 269 - 283.).

[0082] Through fluorescence signal detection (FLUOstar Omega microplate reader), the genotypes of the mutant je0193 (red dots) and Jing 411 (blue dots) could be clearly separated by the TGW265( Figure 4 A in) and TGW57 markers( Figure 4 B in). The genotype information obtained by using these two markers would predict the presence of this thousand-grain weight gene.

Claims

1. Primers for amplifying a KASP marker closely linked to the wheat thousand-grain weight gene, characterized in that, The KASPs are labeled TGW265 and TGW57; The amplification primers for TGW265 consist of a first primer, a second primer, and a third primer; The amplification primers for TGW57 consist of a fourth primer, a fifth primer, and a sixth primer; The sequences of the first primer, the second primer, the third primer, the fourth primer, the fifth primer, and the sixth primer are shown as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively.

2. The amplification primers for the KASP marker closely linked to the wheat thousand-grain weight gene according to claim 1, characterized in that, The first primer has a first fluorescent sequence attached to the 5' end of its single-stranded DNA molecule; the second primer has a second fluorescent sequence attached to the 5' end of its single-stranded DNA molecule.

3. The amplification primers for the KASP marker closely linked to the wheat thousand-grain weight gene according to claim 2, characterized in that, The first fluorescent sequence is the fluorescent sequence FAM; the second fluorescent sequence is the fluorescent sequence HEX.

4. The amplification primers for the KASP marker closely linked to the wheat thousand-grain weight gene according to claim 1, characterized in that, The 5' end of the single-stranded DNA molecule of the fourth primer is linked to a third fluorescent sequence; the 5' end of the single-stranded DNA molecule of the fifth primer is linked to a fourth fluorescent sequence.

5. The amplification primers for the KASP marker closely linked to the wheat thousand-grain weight gene according to claim 4, characterized in that, The third fluorescent sequence is the fluorescent sequence FAM; the fourth fluorescent sequence is the fluorescent sequence HEX.

6. A PCR reagent, characterized in that, The PCR reagent comprises the amplification primers of the KASP marker, which is closely linked to the wheat thousand-grain weight gene, as described in any one of claims 1-5.

7. A reagent kit, characterized in that, The kit contains the PCR reagent of claim 6 or the amplification primers of the KASP marker closely linked to the wheat thousand-grain weight gene as described in any one of claims 1-5.

8. The use of the KASP marker amplification primers closely linked to the wheat thousand-grain weight gene as described in any one of claims 1-5, or the PCR reagent as described in claim 6, or the kit as described in claim 7, in at least one of the following: (A) Determining the thousand-grain weight of wheat; (B) Preparation and identification of wheat thousand-grain weight products; (C) Detecting, screening, or breeding high-thousand-grain-weight wheat; (D) Prepare, test, screen or breed high thousand-grain weight wheat products.

9. A method for determining the thousand-grain weight of wheat, characterized in that, The procedure includes the following steps: performing a KASP reaction on the wheat to be tested using the amplification primers of the KASP marker closely linked to the wheat thousand-grain weight gene as described in any one of claims 2-5; detecting the reaction products; and determining the thousand-grain weight of the wheat to be tested when the reaction products produce a color of fluorescent sequence attached to the 5' end of the DNA molecule as shown in SEQ ID NO:1 and SEQ ID NO:4, which is greater than the thousand-grain weight of the wheat to be tested when the reaction products produce a color of fluorescent sequence attached to the 5' end of the DNA molecule as shown in SEQ ID NO:2 and SEQ ID NO:

5.

10. A method for identifying the genotype of wheat thousand-grain weight, characterized in that, The process includes the following steps: performing a KASP reaction on the wheat to be tested using the amplification primers of the KASP marker closely linked to the wheat thousand-grain weight gene as described in any of claims 2-5, detecting the reaction product, and identifying the wheat to be tested as having a high thousand-grain weight genotype wheat whose reaction product produces a color of fluorescent sequence linked to the 5' end of the DNA molecule as shown in SEQ ID NO:1 and SEQ ID NO:4.

Images