Marker genes for identifying rice grain filling process and application of marker genes

Abstract

The invention belongs to the field of rice cultivation, and particularly relates to a group of marker genes for identifying a rice grain filling process and application thereof. The marker gene screened by the invention is expressed in a monotonically increasing or decreasing manner during the rice grain filling period, and can be used as the marker gene to accurately reflect the time progress of rice grain filling. By detecting the expression level of the marker genes, the rice grain filling process can be identified in a molecular manner, and the duration of the rice grain filling process can be determined.

Description

Technical Field

[0001] The invention belongs to the field of rice cultivation, and in particular relates to a group of marker genes for identifying the rice grain filling process and applications thereof. Background Art

[0002] Rice ( Oryza sativa L.) is an important staple food crop, which is the staple food of more than half of the world's population. Rice grain filling is the most important physiological process in the formation of grains, and it is also a key stage that determines grain weight, yield and rice quality. Studying the molecular mechanism of grain filling will lay the foundation for improving grain yield and quality by improving cultivation methods or breeding.

[0003] Grain filling is a complex trait that is influenced by both intrinsic and environmental factors, making it difficult to explore its underlying genetics, molecular regulation, and the application of these genes in breeding. The grain filling process involves the transport of carbohydrates produced by leaf photosynthesis to the endosperm of the seed. Here, these carbohydrates are converted from sucrose to starch by the action of various enzymes. Rice grain filling is affected by multiple factors. Some factors are involved in biological pathways that directly determine grain filling, including photosynthetic capacity (source), assimilate transport (stream), starch biosynthesis, and cell proliferation (sink). Other factors, such as plant hormone levels, nutrient levels, abiotic stresses, and grain morphology, indirectly affect grain filling through the above four biological processes.

[0004] At least 50 genes involved in rice grain filling have been cloned. These genes are involved in sugar transport, starch biosynthesis and plant hormone regulation. However, the molecular mechanism of the dynamic network of factors affecting the grain filling process has not been fully studied. With the development of biotechnology, research methods based on omics technology have provided new opportunities for rice grain filling research. Summary of the invention

[0005] The present invention provides a group of marker genes for identifying the grain filling process of rice and their application. During the grain filling process, the expression of the marker genes presents a monotonically increasing or decreasing trend, which can be used to molecularly identify the filling process. The expression level of the marker genes reflects the filling time, thereby providing assistance for studying the relationship between the dynamic process of filling and the yield and quality of rice.

[0006] The technical solution of the present invention is achieved in this way: The first aspect of the present invention is to provide a group of marker genes for identifying the grain filling process of rice, including the following genes: AGIS_Os05g001120, and / or AGIS_Os12g003890, and / or AGIS_Os03g005010, and / or AGIS_Os01g005400; wherein, The nucleotide sequence of the AGIS_Os05g001120 gene is shown in SEQ ID NO: 1; The nucleotide sequence of the AGIS_Os12g003890 gene is shown in SEQ ID NO: 2; The nucleotide sequence of the AGIS_Os03g005010 gene is shown in SEQ ID NO: 3; The nucleotide sequence of the AGIS_Os01g005400 gene is shown in SEQ ID NO:4.

[0007] Furthermore, as the rice grain filling process continued, the expression level of AGIS_Os05g001120 gene gradually decreased, the expression level of AGIS_Os12g003890 gene gradually decreased, the expression level of AGIS_Os03g005010 gene gradually increased, and the expression level of AGIS_Os01g005400 gene gradually increased.

[0008] The second aspect of the present invention is to provide a primer pair for amplifying the marker gene described in the first aspect of the present invention, comprising: Forward sequence: GAAGAAAATGTGCAAGGAGGGTG and reverse sequence: CACCACTTAAAGCACCTCCAATC; Forward sequence: GGAGGCTTGAAGTGCTATGAGAA and reverse sequence: TGAGGATTGTAGATCCTTCCACC; Forward sequence: TGGAGTTTCCTGAGATGACCAG and reverse sequence: CCATTTGTGAATGGGGGAGTCTA; Forward sequence: GAAGGGCGTAAGAAGGGAGG and reverse sequence: GGCCTCCTTGAGCATCTTGT.

[0009] The third aspect of the present invention is to provide a kit for amplifying the marker gene described in the first aspect of the present invention, which comprises the primer pair described in the second aspect of the present invention.

[0010] The fourth aspect of the present invention is to provide the use of the marker gene as described in the first aspect of the present invention, or the primer pair combination as described in the second aspect of the present invention, or the kit as described in the third aspect of the present invention in marking the rice grain filling process.

[0011] Furthermore, the lower the relative expression level of the AGIS_Os05g001120 gene, the longer the duration of the rice grain filling process; the lower the relative expression level of the AGIS_Os12g003890 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os03g005010 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os01g005400 gene, the longer the duration of the rice grain filling process.

[0012] A fifth aspect of the present invention is to provide a method for marking the progress of rice grain filling, comprising the following steps: At different stages of the rice grain filling process, grain samples are taken respectively, and cDNA is amplified using the primer pair described in the second aspect of the present invention to detect the expression level of the marker gene described in the first aspect of the present invention; the rice grain filling progress is determined based on the level of marker gene expression.

[0013] Further, the relative expression levels of AGIS_Os05g001120 gene, AGIS_Os12g003890 gene, AGIS_Os03g005010 gene and / or AGIS_Os01g005400 gene and the internal reference are calculated, and the rice grain filling process is determined according to the relative expression levels.

[0014] Furthermore, relative expression level=expression level of the gene / internal reference expression level, with AGIS_Os03g007920 gene as the internal reference, and the nucleotide sequence of AGIS_Os03g007920 gene is shown in SEQ ID NO:5.

[0015] Furthermore, the lower the relative expression level of the AGIS_Os05g001120 gene, the longer the duration of the rice grain filling process; the lower the relative expression level of the AGIS_Os12g003890 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os03g005010 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os01g005400 gene, the longer the duration of the rice grain filling process.

[0016] Beneficial effects of the present invention: Rice grain filling is a key physiological process that affects yield and quality. The marker genes screened out by the present invention are expressed monotonically increasing or decreasing during the rice grain filling period, and can be used as marker genes to accurately reflect the time course of rice grain filling. By detecting the expression levels of these marker genes, the rice filling process can be molecularly identified, which helps to determine the duration of the rice grain filling process. For example, if it is impossible to distinguish the time period of sample collection for samples collected at different filling periods of the same material, by detecting the changes in the expression levels of these marker genes and calculating the relative expression levels of the marker genes, the order of collection of each sample can be accurately determined by comparing the levels of gene expression, thereby determining the filling stage in which they are located, thereby providing reliable molecular markers for the study of the filling process and breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The changing trends of gene expression levels (TPM values) in the transcriptome data of selected marker genes for grain filling process at 5, 10, 15, 20 and 25 days after rice flowering.

[0018] Figure 2 The relative expression trends of the selected marker genes for grain filling process by qPCR at 5, 10, 15, 20 and 25 days after rice flowering. DETAILED DESCRIPTION

[0019] The following will be combined with the accompanying drawings of the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0020] The methods used in the following implementations are all conventional methods unless otherwise specified.

[0021] 1. Rice material The internationally recognized high-quality rice Thai Jasmine Rice (RD15) and Hainan Province's high-quality conventional rice Haixiuzhan No. 9 (HXZ9).

[0022] 2 Planting Two varieties will be planted in Hainan from August to December 2023.

[0023] 3. Grain transcriptome analysis Five periods during the filling process of the two varieties (5, 10, 15, 20, 25 days after pollination and maturity) were selected, and sufficient grain samples were taken for transcriptome (RNA-seq) sequencing.

[0024] The data were quality controlled using fastp (Chen, S., Zhou, Y., Chen, Y., and Gu, J. (2018). Fastp: anultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34:i884-i890.10.1093 / bioinformatics / bty560.), and then hisat2 was used to align the sequences to the Nipponbare T2T genome (Shang, L., He, W., Wang, T., Yang, Y., Xu, Q., Zhao, X., Yang,L., Zhang, H., Li, X., Lv, Y., et al. (2023). A complete assembly of the riceNipponbare reference genome. Molecular Plant 16:1232-1236. 10.1016 / j.molp.2023.08.003.). FeatureCounts (Liao, Y., Smyth, GK, and Shi, W.(2014). FeatureCounts: an efficient general purpose program for assigningsequence reads to genomic features. Bioinformatics 30:923-930. 10.1093 / bioinformatics / btt656.) to count and calculate the counts matrix, and finally use the counts matrix to calculate the TPM value of gene expression.

[0025] DESeq2 (Love, MI, Huber, W., and Anders, S. (2014). Moderatedestimation of fold change and dispersion for RNA-seq data with DESeq2. GenomeBiol 15:550. 10.1186 / s13059-014-0550-8.) was used to analyze the differentially expressed genes at the same time between the two seasons in Sanya. Genes with a differential expression of 1.5 times and a corrected p-value less than 0.05 were considered significantly differentially expressed genes.

[0026] The expression patterns of genes with TPM values ​​higher than 1 in all periods were clustered using clust (Abu-Jamous, B., and Kelly, S. (2018). Clust: automatic extraction of optimal co-expressed gene clusters from gene expression data. Genome Biology 19:172. 10.1186 / s13059-018-1536-8.), and the monotonically up-regulated and monotonically decreasing expression modules were selected. In the selected modules, the filling process genes were further screened by expression curves and TPM values. This included the expression TPM value greater than 100 at at least 4 time points, and the expression trend of the gene was monotonically increasing or decreasing throughout the grain development process. The TPM value was used to select the appropriate internal reference for grain development, which required a relatively stable expression level and a TPM value of about 500 to ensure that the CT value was close to 20.

[0027] As shown in Table 1 and Figure 1 As shown, four marker genes (1-4 in Table 1) and one internal reference (5 in Table 1) were finally screened.

[0028] 2. Determination of grain filling process qPCR primers were designed for the transcripts of marker genes 1-5 in Table 1 (see Table 1), and cDNAs of RD15 and HXZ9 were amplified at different stages (95°C pre-denaturation for 30 s, 95°C for 5 s, 6°C for 15 s, 40 cycles, and 72°C extension for 30 s). The relative expression levels of the four marker genes were calculated using the internal reference (AGIS_Os03g007920 gene) as follows: Relative expression = gene expression / internal reference expression Table 1 Primer sequences for qPCR quantification serial number name Forward sequence Reverse sequence 1 AGIS_Os05g001120 GAAGAAAATGTGCAAGGAGGGTG CACCACTTAAAGCACCTCCAATC 2 AGIS_Os12g003890 GGAGGCTTGAAGTGCTATGAGA TGAGGATTGTAGATCCTTCCACC 3 AGIS_Os03g005010 TTGGAGTTTCCTGAGATGACCAG CCATTTGTGAATGGGGGAGTCTA 4 AGIS_Os01g005400 GAAGGGCGTAAGAAGGGAGG GGCCTCCTTGAGCATCTTGT 5 AGIS_Os03g007920 GCTCAATGACACAATGGAGAACC GTGTTCTGAGGACTCCCGTTAAT The results are as follows Figure 2 shown.

[0029] In the grain filling process of two rice varieties, RD15 and HXZ9, as the duration of the grain filling process prolonged, the relative expression of the AGIS_Os05g001120 gene gradually decreased, the relative expression of the AGIS_Os12g003890 gene also gradually decreased, and the relative expression of the AGIS_Os03g005010 gene and the AGIS_Os01g005400 gene gradually increased. Therefore, the duration of the rice grain filling process can be determined by detecting the expression of the above four genes.

[0030] Since genes AGIS_Os05g001120, AGIS_Os12g003890, AGIS_Os03g005010 and AGIS_Os01g005400 monotonically increase or decrease during the grain filling process, if the sampling order of grain samples of the same rice variety and different filling periods cannot be determined, the expression level of at least one gene among genes AGIS_Os05g001120, AGIS_Os12g003890, AGIS_Os03g005010 or AGIS_Os01g005400 and the expression level of the internal reference AGIS_Os03g007920 can be detected, and then the relative expression levels of the genes can be calculated. By comparing the relative expression levels of each marker gene in different samples, the sampling order of each grain sample can be finally determined.

[0031] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A group of marker genes for identifying the grain filling process of rice, characterized in that: The following genes are included: AGIS_Os05g001120, and / or AGIS_Os12g003890, and / or AGIS_Os03g005010, and / or AGIS_Os01g005400; wherein, The nucleotide sequence of the AGIS_Os05g001120 gene is shown in SEQ ID NO: 1; The nucleotide sequence of the AGIS_Os12g003890 gene is shown in SEQ ID NO: 2; The nucleotide sequence of the AGIS_Os03g005010 gene is shown in SEQ ID NO: 3; The nucleotide sequence of the AGIS_Os01g005400 gene is shown in SEQ ID NO:

4.

2. The marker gene according to claim 1, characterized in that As the rice grain filling process continued, the expression level of AGIS_Os05g001120 gene gradually decreased, the expression level of AGIS_Os12g003890 gene gradually decreased, the expression level of AGIS_Os03g005010 gene gradually increased, and the expression level of AGIS_Os01g005400 gene gradually increased.

3. A primer pair for amplifying the marker gene according to claim 1, characterized in that: include: Forward sequence: GAAGAAAATGTGCAAGGAGGGTG and reverse sequence: CACCACTTAAAGCACCTCCAATC; Forward sequence: GGAGGCTTGAAGTGCTATGAGAA and reverse sequence: TGAGGATTGTAGATCCTTCCACC; Forward sequence: TGGAGTTTCCTGAGATGACCAG and reverse sequence: CCATTTGTGAATGGGGGAGTCTA; Forward sequence: GAAGGGCGTAAGAAGGGAGG and reverse sequence: GGCCTCCTTGAGCATCTTGT.

4. A kit for amplifying the marker gene according to claim 1, characterized in that: Comprising the primer pair described in claim 3.

5. Use of the marker gene according to claim 1, or the primer pair according to claim 3, or the kit according to claim 4 in marking the grain filling process of rice.

6. The use according to claim 5, characterized in that The lower the relative expression level of the AGIS_Os05g001120 gene, the longer the duration of the rice grain filling process; the lower the relative expression level of the AGIS_Os12g003890 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os03g005010 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os01g005400 gene, the longer the duration of the rice grain filling process.

7. A method for marking the progress of rice grain filling, characterized in that: The following steps are involved: At different stages of the rice grain filling process, grain samples are taken respectively, cDNA is amplified using the primer pair described in claim 3, and the expression level of the marker gene described in claim 1 is detected; the rice grain filling progress is determined based on the level of marker gene expression.

8. The method according to claim 7, characterized in that The relative expression levels of AGIS_Os05g001120 gene, AGIS_Os12g003890 gene, AGIS_Os03g005010 gene and / or AGIS_Os01g005400 gene and the internal reference were calculated, and the rice grain filling process was determined according to the relative expression levels.

9. The method according to claim 8, characterized in that Relative expression level=expression level of the gene / internal reference expression level, with AGIS_Os03g007920 gene as the internal reference, and the nucleotide sequence of AGIS_Os03g007920 gene is shown in SEQ ID NO:

5.

10. The method according to claim 9, characterized in that The lower the relative expression level of the AGIS_Os05g001120 gene, the longer the duration of the rice grain filling process; the lower the relative expression level of the AGIS_Os12g003890 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os03g005010 gene, the longer the duration of the rice grain filling process; the higher the relative expression level of the AGIS_Os01g005400 gene, the longer the duration of the rice grain filling process.

Images