Improved producing cells

Abstract

Herein is reported a modified mammalian cell in which the transcriptional activity of procollagen-lysine, 2-oxoglutarate 5-dioxygenase (PLOD) has been eliminated.

Description

[0001] The present invention belongs to the field of recombinant therapeutic peptide production. In more detail, improved mammalian (e.g., Chinese hamster ovary (CHO) or human embryonic kidney (HEK)) production cells and their use for recombinant production of therapeutic proteins are reported herein, wherein the improvement has been achieved by reducing the transcriptional activity of lysine hydroxylase, in particular lysine 5R-hydroxylase. Background Art

[0002] In recent years, recombinant polypeptides (such as antibodies and antibody-based molecules) have been widely used in the field of disease treatment.

[0003] With regard to antibodies in particular, after the first wave of antibody-based drugs containing naturally occurring IgG forms, the next generation of forms now increasingly sees molecules that have a large number of modifications and derivations to the classical IgG antibody form. The desire to target two or even more antigens in succession or simultaneously has brought about increasingly complex antibody forms. With the increase in form complexity, the number of possible antibody-related byproducts (such as, for example, chain mispairing) increases accordingly.

[0004] One step towards the market entry of therapeutic antibodies is the development of stable production cell lines characterized by high expression and high quality of the recombinant protein, i.e., low levels of antibody-related byproducts.

[0005] Xie, Q. et al. (MABS 8 (2016) 371-378) identified a previously unreported +16Da modification in the sequence of XXXXXXXXXWGQGTLVTVSSASTK (SEQ ID NO: 66) in a recombinant IgG1 monoclonal antibody expressed in Chinese hamster ovary (CHO), which was derived from the post-translational hydroxylation of lysine in the consensus sequence (XKG). Although the consensus sequence is present in multiple positions in the antibody sequence, only a single site on the heavy chain Fab was found to be modified. They outlined that the lysine hydroxylation of collagen and proteins containing collagen-like domains occurs in animals, and typically functions as a precursor for cross-linking and O-glycosylation / structural effects. The hydroxylation of these lysines occurs via lysyl hydroxylases, which recognize the consensus amino acid sequence Xaa-Lys-Gly and convert lysine into 5-hydroxylysine (Hyl). Xie et al. hypothesized that the explanation for the specific modification at position 124 in the heavy chain is that the structure of mAb1 close to this position may be a more favorable substrate for lysyl hydroxylase, while the local structure around other consensus sequence sites is not easily bound by the enzyme.

[0006] EP 1 375 510 reports the gene PLOD2 of coding telopeptide lysyl hydroxylase (TLH).Terminal peptide group Lys is converted into terminal peptide group Hyl by this enzyme, and this terminal peptide group Hyl can be converted into hydroxylysine cross-link (cross-link) subsequently.Collagen with hydroxylysine cross-linking demonstrates higher resistance to protease degradation than the cross-linked collagen with hydroxylysine being derived from.In one aspect, EP 1 375 510 provides the method and composition of preparing collagen material with different biodegradation rates by changing the ratio of hydroxylysine cross-linking and hydroxylysine cross-linking.

[0007] US 5,328,913 reports a method for inhibiting cell proliferation and lysyl hydroxylase expression by using minoxidil derivatives.

[0008] Mia, MM and Bank, RA reported that the lκB kinase inhibitor ACHP strongly attenuated TGFβ1-induced myofibroblast formation and collagen synthesis.

[0009] WO 2021 / 028350 reports in situ glycosylated MHC II / CII peptide complexes, i.e., naturally glycosylated complexes during recombinant protein expression in host cells.Host cells are genetically engineered cells that recombinantly express lysyl hydroxylase and collagen galactosyltransferase, preferably lysyl hydroxylase 1 (LH1) and / or lysyl hydroxylase 2 (LH2) and collagen galactosyltransferase GLT25D1 and / or GLT25D2.According to an overview, the CHO cells commonly used for protein production have been tested, and post-translational modifications can not be fully added to lysine residues, resulting in galactosyl hydroxylysine (Gal-Hyl) in collagen or in MHC II / CII peptide complexes as described herein.Therefore, CHO cells need to be genetically engineered to recombinantly express lysyl hydroxylase and collagen galactosyltransferase.

[0010] Guo, T. et al. (Lab. Invest. 101 (2021) 564-569) reported that PLOD is overexpressed in ovarian cancer and is associated with gap junctions via connexin 43. In particular, they reported that SKOV3 cells stably transfected with shRNA targeting PLOD3 were growing after subcutaneous injection into mice, while when PLOD3 was knocked down, CAOV3 cells showed significantly inhibited proliferation and no measurable tumors could be found. They concluded that the expression of PLOD1, PLOD2, and PLOD3 showed a mutually exclusive trend, partially indicating functional non-redundancy. Summary of the invention

[0011] The inventive subject matter disclosed herein is based, at least in part, on the discovery that knockout of the PLOD gene reduces levels of / eliminates formation of hydroxylysine in recombinantly produced heterologous proteins.

[0012] The subject matter of the invention disclosed herein is based at least in part on the discovery that knockout of the PLOD gene does not affect the overall cell culture performance of the corresponding modified cells. It has been found that the PLOD knockout cell line has a higher biomass formation capacity during culture and thus has a higher recombinant protein titer than cells of the same genotype except that the PLOD is knocked out.

[0013] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knockout of the PLOD gene does not affect other protein quality attributes. It has been found that CE-SDS and SEC evaluations show comparable or even increased levels of the main peak and comparable or even reduced levels of side products.

[0014] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knockout of the PLOD gene reduces filterability problems. Without being bound by this theory, it is hypothesized that this is due to the fact that collagen can no longer be cross-linked, especially when CHO cells express many collagen genes at high levels. It has been found that by reducing the increase in filter pressure, filterability is at least comparable or even improved.

[0015] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knockout of the PLOD gene reduces cell aggregation during culture. Without being bound by this theory, it is hypothesized that due to the reduction / absence of cross-linked collagen, trans-binding of different CHO cells via integrin α1β1 cannot be mediated.

[0016] In the present invention, the term "knockout" is used in a functional sense. That is, "knockout" means the functional inactivation of the corresponding gene. This can be, but is not limited to, for example, the deletion of the corresponding gene or part thereof, the introduction of nonsense mutations that lead to a non-functional gene product after transcription and translation, the introduction of premature stop codons that lead to the production of a non-functional gene product. Therefore, the term "knockout" encompasses different methods that lead to a reduction or elimination of the function of the corresponding gene by reducing or eliminating the production of a functional gene product or by truncating or mutating or eliminating the corresponding gene.

[0017] The present invention encompasses the following independent aspects and dependent embodiments:

[0018] 1. A modified mammalian cell in which the transcriptional activity of a gene encoding lysine hydroxylase has been reduced.

[0019] 2. The modified mammalian cell according to aspect 1, wherein further, the transcriptional activity of a gene encoding a prolyl hydroxylase has been reduced.

[0020] 3. The modified mammalian cell of any one of Aspect 1 or Embodiment 2, wherein the lysine hydroxylase is lysine 5R-hydroxylase.

[0021] 4. The modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 3, wherein the lysine hydroxylase is an oxidoreductase of enzyme class (EC) 1.14.11.

[0022] 5. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 4, wherein the lysine hydroxylase is procollagen-lysine, 2-oxoglutarate 5-dioxygenase (PLOD).

[0023] 6. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 5, wherein the lysine hydroxylase is EC 1.14.11.4.

[0024] 7. The modified mammalian cell of any one of embodiments 2 to 6, wherein the prolyl hydroxylase is prolyl 3-hydroxylase (P3H).

[0025] 8. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 7, wherein the lysine hydroxylase is one or two or all of procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 (PLOD2) and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3).

[0026] 9. The modified mammalian cell of any one of embodiments 2 to 8, wherein the prolyl hydroxylase is prolyl 3-hydroxylase 3 or prolyl 3-hydroxylase 4.

[0027] 10. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 9, wherein the transcriptional activity of one or more PLOD genes has been reduced.

[0028] 11. The modified mammalian cell of any one of embodiments 2 to 10, wherein the transcriptional activity of one or more P3H genes has been reduced.

[0029] 12. The modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 11, wherein the transcriptional activity of the PLOD1 or / and PLOD2 or / and PLOD3 gene has been reduced.

[0030] 13. The modified mammalian cell according to any one of embodiments 2 to 12, wherein the transcriptional activity of the P3H3 or / and P3H4 gene has been reduced.

[0031] 14. The modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 13, wherein the transcriptional activity of one or both or all of the PLOD1, PLOD2 and PLOD3 genes has been reduced.

[0032] 15. The modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 14, wherein the transcriptional activity of at least the PLOD2 gene has been reduced such that none of its splice variants are translated.

[0033] 16. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 15, wherein the modified mammalian cell is a modified CHO cell or a modified HEK cell.

[0034] 17. The modified mammalian cell according to any one of aspect 1 or embodiments 2 to 16, wherein the modified mammalian cell is a modified CHO K1 or a modified HEK293 cell.

[0035] 18. A modified mammalian cell according to any one of Aspect 1 or Examples 2 to 17, wherein further, the transcriptional activity of one or more or all of the MYC gene or / and the BAX gene or / and the BAK gene or / and the ICAM-1 gene or / and the SIRT-1 gene has been reduced.

[0036] 19. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 18, wherein the reduction is a permanent reduction.

[0037] 20. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 19, wherein the reduction is by inactivation.

[0038] 21. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 20, wherein the reduction is by gene knockout.

[0039] 22. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 21, wherein the reduction is by deleting all or part of a gene.

[0040] 23. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 21, wherein the reduction is by introducing a mutation into a gene that results in the production of a non-functional gene product.

[0041] 24. The modified mammalian cell according to aspect 1 or any one of embodiments 2 to 21, wherein the reduction is by introducing additional stop codons into the gene that result in the production of a non-functional gene product.

[0042] 25. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 24, wherein the reduction is mediated by CRISPR / Cas.

[0043] 26. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 25, wherein the modified mammalian cell comprises one or two or more targeted integration landing sites.

[0044] 27. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 26, wherein the modified mammalian cell comprises one or two or more targeted integration landing sites, each of the targeted integration landing sites comprising two or three recombinase recognition sequences, wherein in the case of two or more landing sites, the recombinase recognition sequences of each landing site are incompatible with each other.

[0045] 28. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 27, wherein the modified mammalian cell comprises one or two or more targeted integration landing sites, wherein one of the targeted integration landing sites comprises the recombinase recognition sequences 3L, LoxFas and L2.

[0046] 29. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 28, wherein the modified mammalian cell comprises one or two or more targeted integration landing sites, wherein one or more nucleic acids encoding heterologous proteins have been integrated into one targeted integration landing site.

[0047] 30. The modified mammalian cell of any one of aspect 1 or embodiments 2 to 29, wherein at least a reduction in the transcriptional activity of a gene encoding lysine hydroxylase has been achieved following stable introduction of one or more nucleic acids encoding heterologous proteins.

[0048] 31. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 28, wherein the modified mammalian cell comprises one or two or more targeted integration landing sites, wherein one or more nucleic acids encoding monospecific or multispecific antibodies have been integrated into one targeted integration landing site.

[0049] 32. The modified mammalian cell according to any one of aspect 1 or embodiments 2 to 28 and 31, wherein at least a reduction in the transcriptional activity of a gene encoding lysine hydroxylase has been achieved following stable introduction of one or more nucleic acids encoding a monospecific or multispecific antibody.

[0050] 33. A method for recombinant production of a heterologous protein, the method comprising the steps of:

[0051] a) culturing the modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 30 in a culture medium under conditions suitable for recombinant expression of the heterologous protein, the modified mammalian cell further comprising one or more nucleic acids encoding the heterologous protein,

[0052] b) recovering said heterologous protein from said modified mammalian cell or said culture medium,

[0053] c) optionally purifying the heterologous protein using one or more chromatography steps,

[0054] And thereby the heterologous protein is produced recombinantly.

[0055] 34. A method for recombinantly producing a monospecific or multispecific antibody, the method comprising the following steps:

[0056] a) culturing the modified mammalian cell according to any one of embodiments 31 to 32 in a culture medium under conditions suitable for recombinant expression of the monospecific or multispecific antibody,

[0057] b) recovering the monospecific or multispecific antibody from the modified mammalian cell or the culture medium,

[0058] c) optionally purifying the monospecific or multispecific antibody using one or more chromatography steps and thereby recombinantly producing the monospecific or multispecific antibody.

[0059] 35. The method of any one of aspects 33 to 34, wherein the culturing lasts for 6 to 16 days.

[0060] 36. The method of any one of Aspects 33 to 34 and Embodiment 35, wherein the culturing lasts for 12 to 15 days.

[0061] 37. The method of any one of Aspects 33 to 34 or Embodiments 35 to 36, wherein the culturing continues for about 14 days.

[0062] 38. The method of any one of aspects 33 to 34 or embodiments 35 to 37, wherein the culturing is initiated at a cell density of 3-5*10^5 cells / ml or higher.

[0063] 39. The method of any one of aspects 33 to 34 or embodiments 35 to 38, wherein the culturing is initiated at a cell density of 100*10^5 cells / ml or higher.

[0064] 40. The method of any one of aspects 33 to 34 or embodiments 35 to 39, wherein the culturing is a fed-batch culturing.

[0065] 41. The method of any one of aspects 33 to 34 or embodiments 35 to 40, wherein the culture is a fed-batch culture with feeding on at least day 1, day 4, day 7 and day 10.

[0066] 42. The method of any one of aspects 33 to 34 or embodiments 35 to 41, wherein the cultivation is a fed-batch cultivation with daily feeding.

[0067] 43. Use of the modified mammalian cell of aspect 1 or any one of embodiments 2 to 30 for reducing the amount of lysine hydroxylation in a heterologous protein recombinantly produced using the modified mammalian cell.

[0068] 44. Use of the modified mammalian cell of aspect 1 or any one of embodiments 2 to 30 for reducing the amount of hydroxylysine in a heterologous protein recombinantly produced using the modified mammalian cell.

[0069] 45. Use of the modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 30 for increasing biomass formation in a culture of the modified mammalian cell.

[0070] 46. ​​Use of the modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 30 for increasing the titer of a heterologous protein recombinantly produced using the modified mammalian cell.

[0071] 47. Use of the modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 30 for reducing the formation of heterologous protein by-products in the culture of the modified mammalian cell recombinantly expressing the heterologous protein.

[0072] 48. Use of the modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 30 for reducing filter resistance in a heterologous protein preparation recombinantly produced using the modified mammalian cell.

[0073] 49. Use of the modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 30 for reducing cell aggregation during cultivation of the modified mammalian cell.

[0074] 50. Use of the modified mammalian cell of any one of embodiments 31 to 32 for reducing the amount of lysine hydroxylation in a monospecific or multispecific antibody produced using the modified mammalian cell.

[0075] 51. Use of the modified mammalian cell of any one of embodiments 31 to 32 for reducing the amount of hydroxylysine in a monospecific or multispecific antibody produced using the modified mammalian cell.

[0076] 52. Use of the modified mammalian cell of any one of embodiments 31 to 32 for increasing biomass formation in a culture of the modified mammalian cell.

[0077] 53. Use of the modified mammalian cell of any one of embodiments 31 to 32 for increasing the titer of a monospecific or multispecific antibody produced using the modified mammalian cell.

[0078] 54. Use of the modified mammalian cell of any one of embodiments 31 to 32 for reducing the formation of monospecific or multispecific antibody by-products in the culture of the modified mammalian cell recombinantly expressing the monospecific or multispecific antibody.

[0079] 55. Use of the modified mammalian cell of any one of embodiments 31 to 32 for reducing filter resistance in a monospecific or multispecific antibody preparation produced using the modified mammalian cell.

[0080] 56. Use of the modified mammalian cell of any one of embodiments 31 to 32 for reducing cell aggregation during cultivation of the modified mammalian cell.

[0081] 57. Use of a reduction in the transcriptional activity of one or more genes encoding lysine hydroxylases in a mammalian cell for reducing the amount of lysine hydroxylation in a heterologous protein recombinantly produced using the modified mammalian cell.

[0082] 58. Use of a reduction in the transcriptional activity of one or more genes encoding lysine hydroxylases in a mammalian cell for reducing the amount of hydroxylysine in a heterologous protein recombinantly produced using the modified mammalian cell.

[0083] 59. Use of a reduction in the transcriptional activity of one or more genes encoding lysine hydroxylases in a mammalian cell for increasing biomass formation in a culture of said modified mammalian cell.

[0084] 60. Use of a reduction in the transcriptional activity of one or more genes encoding lysine hydroxylases in a mammalian cell for increasing the titer of a heterologous protein recombinantly produced using said modified mammalian cell.

[0085] 61. Use of a reduction in the transcriptional activity of one or more genes encoding lysine hydroxylases in a mammalian cell for reducing the formation of heterologous protein by-products in the culture of said modified mammalian cell recombinantly expressing said heterologous protein.

[0086] 62. Use of a reduction in the transcriptional activity of one or more genes encoding lysine hydroxylases in a mammalian cell for reducing the filtration resistance in a heterologous protein preparation recombinantly produced using said modified mammalian cell.

[0087] 63. Use of a reduction in the transcriptional activity of one or more genes encoding lysine hydroxylases in a mammalian cell for reducing cell aggregation during cultivation of the modified mammalian cell.

[0088] 64. The use according to any one of aspects 57 to 63, wherein further, the transcriptional activity of a gene encoding a prolyl hydroxylase has been reduced.

[0089] 65. The use according to any one of aspects 57 to 63 or embodiment 64, wherein the lysine hydroxylase is lysine 5R-hydroxylase.

[0090] 66. The use according to any one of aspects 57 to 63 or embodiments 64 to 65, wherein the lysine hydroxylase is an oxidoreductase of enzyme class (EC) 1.14.11.

[0091] 67. The use according to any one of aspects 57 to 63 or embodiments 64 to 66, wherein the lysine hydroxylase is procollagen-lysine, 2-oxoglutarate 5-dioxygenase (PLOD).

[0092] 68. The use according to any one of aspects 57 to 63 or embodiments 64 to 67, wherein the lysine hydroxylase is EC 1.14.11.4.

[0093] 69. The use according to any one of aspects 57 to 63 or embodiments 64 to 68, wherein the prolyl hydroxylase is prolyl 3-hydroxylase (P3H).

[0094] 70. The use according to any one of aspects 57 to 63 or embodiments 64 to 69, wherein the lysine hydroxylase is procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1) or / and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 (PLOD2) or / and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3).

[0095] 71. The use of any one of embodiments 64 to 70, wherein the prolyl hydroxylase is prolyl 3-hydroxylase 3 or prolyl 3-hydroxylase 4.

[0096] 72. The use according to any one of aspects 57 to 63 or embodiments 64 to 71, wherein the transcriptional activity of one or more PLOD genes has been reduced.

[0097] 73. The use of any one of embodiments 64 to 72, wherein the transcriptional activity of one or more P3H genes has been reduced.

[0098] 74. The use according to any one of aspects 57 to 63 or embodiments 64 to 73, wherein the transcriptional activity of the PLOD1 or / and PLOD2 or / and PLOD3 gene has been reduced.

[0099] 75. The use according to any one of embodiments 64 to 74, wherein the transcriptional activity of the P3H3 and / or P3H4 gene has been reduced.

[0100] 76. The use according to any one of aspects 57 to 63 or embodiments 64 to 75, wherein the transcriptional activity of at least the PLOD2 gene has been reduced.

[0101] 77. The use according to any one of aspects 57 to 63 or embodiments 64 to 76, wherein the transcriptional activity of the PLOD2 gene has been reduced such that none of its splice variants are translated.

[0102] 78. The method of any one of aspects 57 to 63 or embodiments 64 to 77, wherein the mammalian cell is a CHO cell or a modified HEK cell.

[0103] 79. The method of any one of aspects 57 to 63 or embodiments 64 to 78, wherein the mammalian cell is a CHO K1 or HEK293 cell.

[0104] 80. The use according to any one of aspects 57 to 63 or embodiments 64 to 79, wherein further, the transcriptional activity of one or more or all of the MYC gene or / and the BAX gene or / and the BAK gene or / and the ICAM-1 gene or / and the SIRT-1 gene has been reduced.

[0105] 81. The use according to any one of aspects 57 to 63 or embodiments 64 to 80, wherein the reduction is a permanent reduction.

[0106] 82. The use according to any one of aspects 57 to 63 or embodiments 64 to 81, wherein the reduction is inactivation.

[0107] 83. The use according to any one of aspects 57 to 63 or embodiments 64 to 81, wherein the reduction is by deleting all or part of a gene.

[0108] 84. The use according to any one of aspects 57 to 63 or embodiments 64 to 81, wherein the reduction is by introducing into the gene a mutation that results in the production of a non-functional gene product.

[0109] 85. The use according to any one of aspects 57 to 63 or embodiments 64 to 81, wherein the reduction is by introducing additional stop codons into the gene resulting in the production of a non-functional gene product.

[0110] 86. The use according to any one of aspects 57 to 63 or embodiments 64 to 85, wherein the reduction is by gene knockout.

[0111] 87. The use according to any one of Aspects 57 to 63 or Embodiments 64 to 86, wherein the reduction is mediated by CRISPR / Cas.

[0112] 88. The use of any one of Aspects 57 to 63 or Embodiments 64 to 87, wherein the mammalian cell comprises one or two or more targeted integration landing sites.

[0113] 89. The use of any one of Aspects 57 to 63 or Embodiments 64 to 88, wherein the mammalian cell comprises one or two or more targeted integration landing sites, wherein one or more nucleic acids encoding heterologous proteins have been integrated into one targeted integration landing site.

[0114] 90. The use according to any one of aspects 57 to 63 or embodiments 64 to 89, wherein at least a reduction in the transcriptional activity of the gene encoding lysine hydroxylase has been achieved following stable introduction of one or more nucleic acids encoding heterologous proteins.

[0115] 91. The use according to any one of aspects 57 to 63 or embodiments 64 to 90, wherein the heterologous protein is a monospecific or multispecific antibody.

[0116] In addition to the various aspects and embodiments specifically described and claimed, the subject matter of the invention disclosed herein also encompasses other embodiments with other combinations of features disclosed and claimed herein. Therefore, the specific features presented herein, especially the specific features presented as aspects or embodiments, can be combined with each other in other ways within the scope of the invention disclosed herein, so that the subject matter of the invention disclosed herein includes any suitable combination of the individual features or combinations of features disclosed herein. The description of specific embodiments has been presented for the purpose of illustrating and describing the teachings of the present invention. It is not intended to be exhaustive or limit the disclosed subject matter to those disclosed embodiments.

[0117] An aspect as used herein relates to an independent subject matter of the invention, and an embodiment as used herein provides a more detailed implementation of one or more or all of the independent aspects. DETAILED DESCRIPTION

[0118] The inventive subject matter disclosed herein is based, at least in part, on the discovery that knockout of the PLOD gene reduces levels of / eliminates formation of hydroxylysine in recombinantly produced heterologous proteins.

[0119] General Definition

[0120] Useful methods and techniques for practicing the subject matter of the present invention are described in, for example, Ausubel, FM (ed.), Current Protocols in Molecular Biology, Vols. I to III (1997); Glover, ND and Hames, BD, eds., DNA Cloning: A Practical Approach, Vols. I and II (1985), Oxford University Press; Freshney, RI (ed.), Animal Cell Culture—a practical approach, IRL Press Limited (1986); Watson, JD et al., Recombinant DNA, 2nd ed., CHSLPress (1992); Winnacker, EL, From Genes to Clones; NY, VCH Publishers (1987); Celis, J., ed., Cell Biology, 2nd ed., Academic Press (1998); Freshney, RI, Culture of Animal Cells: A Manual of Basic Technique, 2nd ed., Alan R. Liss, Inc., NY (1987). Derivatives of nucleic acids can be generated using recombinant DNA technology. Such derivatives can be modified, for example, by substitution, change, exchange, deletion or insertion at one or several nucleotide positions. Modification or derivatization can be performed, for example, by means of site-directed mutagenesis. Such modifications can be easily performed by those skilled in the art (see, for example, Sambrook, J. et al., Molecular Cloning: A laboratory manual (1999) Cold Spring Harbor Laboratory Press, New York, USA; Hames, BD and Higgins, SG, Nucleic acid hybridization-apractical approach (1985) IRL Press, Oxford, England).

[0121] It must be noted that, as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth. Likewise, the terms "a", "one or more", and "at least one" may be used interchangeably herein. It should also be noted that the terms "comprising", "including", and "having" may be used interchangeably.

[0122] The term "about" means a range of + / -20% of the value that follows. In certain embodiments, the term "about" means a range of + / -10% of the value that follows. In certain embodiments, the term "about" means a range of + / -5% of the value that follows.

[0123] As used herein, the terms "comprises," "including," "having," "having," "may," "containing," and variations thereof are intended to be open-ended transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. The term "comprising" also encompasses the term "including..." The present disclosure also contemplates other embodiments "comprising," "consisting of," and "consisting essentially of" the embodiments or elements set forth herein, whether or not explicitly set forth.

[0124] As used herein, the term "recombinant mammalian cell" refers to a mammalian cell comprising an exogenous nucleotide sequence capable of expressing a polypeptide. Such recombinant mammalian cells are cells into which one or more exogenous nucleic acids have been introduced, including the offspring of such cells. Therefore, the term "mammalian cell comprising a nucleic acid encoding a heterologous polypeptide" refers to a cell comprising an exogenous nucleotide sequence integrated into the mammalian cell genome and capable of expressing a heterologous polypeptide. In certain embodiments, the mammalian cell comprising an exogenous nucleotide sequence is a cell comprising an exogenous nucleotide sequence integrated at a single site within the locus of the host cell genome, wherein the exogenous nucleotide sequence comprises a first recombination recognition sequence and a second recombination recognition sequence flanking at least one first selection marker, and a third recombination recognition sequence between the first recombination recognition sequence and the second recombination recognition sequence, and all recombination recognition sequences are different.

[0125] As used herein, the term "recombinant cell" refers to a genetically modified cell, e.g., a cell that expresses a heterologous polypeptide of interest and can be used to produce the heterologous polypeptide of interest on any scale. For example, a "recombinant mammalian cell comprising an exogenous nucleotide sequence" refers to a cell in which the coding sequence for the heterologous polypeptide of interest has been introduced into the host cell genome. For example, a "recombinant mammalian cell comprising an exogenous nucleotide sequence" that has undergone recombinase-mediated cassette exchange (RMCE) whereby the coding sequence for the polypeptide of interest has been introduced into the host cell genome is a "recombinant cell."

[0126] "Mammalian cells comprising exogenous nucleotide sequences" and "recombinant cells" are both "transformed cells". The term includes the primary transformed cell and progeny derived therefrom, without regard to the number of passages. Progeny may, for example, not be completely identical to the nucleic acid content of the parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are encompassed.

[0127] An "isolated" nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in cells that normally contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0128] An "isolated" polypeptide or antibody is one that has been separated from a component of its natural environment.

[0129] The term "integration site" refers to a nucleic acid sequence in a cell genome into which an exogenous nucleotide sequence has been inserted. In certain embodiments, the integration site is between two adjacent nucleotides in the cell genome. In certain embodiments, the integration site comprises a nucleotide sequence. In certain embodiments, the integration site is located in a specific locus of the genome of a mammalian cell. In certain embodiments, the integration site is in an endogenous gene of a mammalian cell.

[0130] As used herein, the terms "vector" or "plasmid" (used interchangeably) refer to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. The term includes vectors that are self-replicating nucleic acid structures, as well as vectors that are incorporated into the genome of a host cell into which they have been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operably linked. Such vectors are referred to herein as "expression vectors."

[0131] As used herein, the term "selection marker" refers to a gene that allows specific selection or exclusion of cells carrying the gene in the presence of a corresponding selective agent. For example, but not limited to, a selection marker can allow positive selection of host cells transformed with the selection marker gene in the presence of a corresponding selective agent (selective culture conditions); untransformed host cells will not be able to grow or survive under the selective culture conditions. Selection markers can be positive, negative or bifunctional. Positive selection markers can allow selection of cells carrying the marker, while negative selection markers can allow selective elimination of cells carrying the marker. Selection markers can confer resistance to drugs, or compensate for metabolic or catabolism defects in host cells. In prokaryotic cells, genes that confer resistance to ampicillin, tetracycline, kanamycin or chloramphenicol, as well as other genes, can be used. Resistance genes that can be used as selectable markers in eukaryotic cells include, but are not limited to, genes for aminoglycoside phosphotransferases (APHs) (e.g., hygromycin phosphotransferase (HYG), neomycin and G418 APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthetase (indole), histidinol dehydrogenase (histidinol D), and genes encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, Zeocin and mycophenolic acid. Additional marker genes are described in WO 92 / 08796 and WO 94 / 28143.

[0132] In addition to facilitating selection in the presence of a corresponding selective agent, a selectable marker may alternatively be a molecule that is not normally present in cells, such as green fluorescent protein (GFP), enhanced GFP (eGFP), synthetic GFP, yellow fluorescent protein (YFP), enhanced YFP (eYFP), cyan fluorescent protein (CFP), mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, mCFPm, Cerulean, and T-Sapphire. Cells expressing such a molecule can be distinguished from cells not containing the gene, for example, by detecting fluorescence emitted by the encoded polypeptide or the absence of such fluorescence, respectively.

[0133] As used herein, the term "operably connected" refers to the juxtaposition of two or more components, wherein the relationship of these components allows them to play a role in an expected manner. For example, if a promoter and / or an enhancer are used to regulate the transcription of a coding sequence, the promoter and / or the enhancer are operably connected to the coding sequence. In certain embodiments, the DNA sequence of "operably connected" is connected and adjacent on a single chromosome. In certain embodiments, for example, when two protein coding regions (such as a secretory leader and a polypeptide) must be joined, these sequences are connected, adjacent, and in the same reading frame. In certain embodiments, the promoter that is operably connected is located upstream of the coding sequence and can be adjacent to the coding sequence. In certain embodiments, for example, about the enhancer sequence that regulates the expression of the coding sequence, these two components can be operably connected, but are not adjacent. If an enhancer increases the transcription of a coding sequence, the enhancer is operably connected to the coding sequence. The enhancer that is operably connected can be located upstream, inside or downstream of the coding sequence, and can be located at a position quite far away from the promoter of the coding sequence. Operable linkage can be accomplished by recombinant methods known in the art, for example using PCR methods and / or by ligating at convenient restriction sites. If there are no convenient restriction sites, synthetic oligonucleotide adapters or linkers can be used according to conventional practice. An internal ribosome entry site (IRES) is operably linked to an open reading frame (ORF) if it allows translation of the ORF to be initiated at an internal position independent of the 5' end.

[0134] As used herein, the term "exogenous" refers to a nucleotide sequence that is not derived from a specific cell, but is introduced into the cell by a DNA delivery method (e.g., by a transfection method, an electroporation method, or a transformation method). Therefore, an exogenous nucleotide sequence is an artificial sequence, wherein the artificiality can be derived from, for example, a combination of subsequences from different sources (e.g., a combination of a recombinase recognition sequence with an SV40 promoter and a coding sequence for a green fluorescent protein is an artificial nucleic acid) or from a sequence (e.g., only encoding the extracellular domain of a membrane-bound receptor or a sequence of a cDNA) or a partial deletion, or a nuclear base mutation. The term "endogenous" refers to a nucleotide sequence derived from a cell. An "exogenous" nucleotide sequence can have an "endogenous" counterpart with the same base composition, but wherein the "exogenous" sequence is, for example, introduced into a cell via recombinant DNA technology.

[0135] As used herein, the term "heterologous" refers to a polypeptide that is not derived from a specific cell, but rather a corresponding encoding nucleic acid has been introduced into the cell by a DNA delivery method (e.g., by a transfection method, an electroporation method, or a transformation method). Thus, a heterologous polypeptide is a polypeptide that is artificial to the cell expressing it, irrespective of whether the polypeptide is a naturally occurring polypeptide derived from a different cell / organism or a synthetic polypeptide.

[0136] The term "procollagen-lysine, 2-oxoglutarate 5-dioxygenase" refers to an oxidoreductase that acts on a paired donor, wherein molecular oxygen is incorporated or reduced, wherein 2-oxoglutarate serves as one donor and one oxygen atom is incorporated into each donor. Procollagen-lysine 5-dioxygenase has an EC number of 1.14.11.4. Synonyms for "procollagen-lysine, 2-oxoglutarate 5-dioxygenase" are "collagen lysine hydroxylase", "lysyl procollagen dioxygenase", "lysine-2-oxoglutarate dioxygenase", "peptidyl-lysine, 2-oxoglutarate: oxygen oxidoreductase", "peptidyl-lysine, 2-oxoglutarate: oxygen 5-oxidoreductase", "lysyl hydroxylase", "lysyl 5S-hydroxylase", "oxygenase, procollagen lysine, di-", "LH", "LLH", "PLOD", "procollagen lysine" 1,2-oxoglutarate 5-dioxygenase" and "Ehlers-Danlos syndrome type VI".

[0137] Three different forms of "procollagen-lysine, 2-oxoglutarate 5-dioxygenase" are known, denoted "1", "2" and "3". Form 1 has the UniProtKB id Q02809.

[0138] "Procollagen-lysine, 2-oxoglutarate 5-dioxygenase" is encoded by the PLOD gene. For PLOD2, two splice variants (LH2a and LH2b) can be expressed, where LH2b differs from LH2a by the incorporation of a small exon 13A.

[0139] The term "prolyl oxygenase" refers to a proteoglycan that functions as a collagen prolyl hydroxylase. The prolyl hydroxylase is required for proper collagen biosynthesis, folding, and assembly. This protein, like other family members, is thought to be present in the endoplasmic reticulum.

[0140] Different forms are known, which are indicated as "1", "2", "3" and "4".

[0141] Prolyl 3-hydroxylase 3 (encoded by the P3H3 gene; RefSeq NM_014262) has the enzyme class number 1.14.11.7. Alternative names are "dandruff-like protein 2" and "protein B". The protein has prolyl 3-hydroxylase activity that catalyzes the post-translational formation of 3-hydroxyproline in the -Xaa-Pro-Gly- sequence in collagens, particularly type IV and type V collagens (by similarity). The enzymatic reaction is L-proline-[procollagen]+2-oxoglutarate+O(2)=trans-3-hydroxy-L-proline-[procollagen]+succinate+CO(2).

[0142] The term "sirtuin-1" refers to an enzyme that is part of signal transduction in mammals, namely the NAD-dependent deacetylase sirtuin-1. Sirtuin-1 is encoded by the SIRT-1 gene. Chinese hamster sirtuin-1 has the UniProtKB entry A0A3L7IF96. The effects of inactivating the SIRT-1 gene have been described in WO 2020 / 260327, which is expressly incorporated herein by reference.

[0143] The term "myc proto-oncogene protein" refers to a regulatory gene family encoding transcription factors. The family includes proteins c-myc (encoded by the MYC gene), l-myc (encoded by the MYCL gene) and n-myc (encoded by the MYCN gene). The genomic location of the Chinese hamster myc proto-oncogene protein in the CHO genome (PICR genome) (see https: / / www.ncbi.nlm.nih.gov / assembly / GCF_003668045.3 / ) is RAZU01000002.1 (8,114,040-8,118,048). The effect of MYC inactivation has been described in WO 2022 / 063877, which is expressly incorporated herein by reference.

[0144] The term "bcl-2-related X protein" refers to the pro-apoptotic Bcl-2 family member encoded by the BAX gene (also known as Bcl214).

[0145] The term "bcl-2 homologous antagonist / killer" refers to the pro-apoptotic Bcl-2 family member encoded by the BAK gene (also known as BCL2 antagonist / killer 1, Bacl, Cdnl, Bcl2l7, and Bak-like).

[0146] The effects of BAX and BAK gene inactivation have been described in WO 2009 / 151591, which is expressly incorporated herein by reference.

[0147] The term "intercellular adhesion molecule 1" denotes a cell surface glycoprotein. Its binding partner is an integrin of the CD11a / CD18 or CD11b / CD18 type. It is also known as CD54 (cluster of differentiation 54). In humans, it is encoded by the ICAM-1 gene.

[0148] "Reduction of transcriptional activity" about a gene can be achieved by genetic manipulation (e.g., substitution, deletion, insertion, duplication, frameshift or translocation in the gene), whereby one or more functions of the corresponding gene product are reduced or eliminated. In some embodiments, the reduction of transcriptional activity is achieved by introducing a loss-of-function mutation in the gene, i.e., introducing an invalid mutation (such as, for example, removing a deletion of part or all of the coding sequence) that eliminates one or more functions of the corresponding gene product.

[0149] Antibody

[0150] General information on the nucleotide sequences of human immunoglobulin light and heavy chains is given in: Kabat, EA et al., Sequences of Proteins of Immunological Interest, 5th Edition, Public Health Service, National Institutes of Health, Bethesda, MD (1991).

[0151] The term "antibody" herein is used in the broadest sense and encompasses various antibody structures, including but not limited to full length antibodies, monoclonal antibodies, multispecific antibodies (eg, bispecific antibodies), and antibody-antibody fragment fusions and combinations thereof.

[0152] The term "natural antibody" refers to naturally occurring immunoglobulin molecules with different structures. For example, a natural IgG antibody is a heterotetrameric glycoprotein of about 150,000 daltons, consisting of two identical light chains and two identical heavy chains bonded by disulfide bonds. From the N-terminus to the C-terminus, each heavy chain has a heavy chain variable region (VH), followed by three heavy chain constant domains (CH1, CH2 and CH3), whereby the hinge region is positioned between the first heavy chain constant domain and the second heavy chain constant domain. Similarly, from the N-terminus to the C-terminus, each light chain has a light chain variable region (VL), followed by a light chain constant domain (CL). The light chain of an antibody can be classified into one of two types based on the amino acid sequence of its constant domain, which are called kappa (κ) and lambda (λ).

[0153] The term "full-length antibody" refers to an antibody having a structure substantially similar to that of a natural antibody. A full-length antibody comprises two full-length antibody light chains and two full-length antibody heavy chains, each full-length antibody light chain comprising a light chain variable region and a light chain constant domain in the N-terminal to C-terminal direction, and each full-length antibody heavy chain comprising a heavy chain variable region, a first heavy chain constant domain, a hinge region, a second heavy chain constant domain, and a third heavy chain constant domain in the N-terminal to C-terminal direction. In contrast to natural antibodies, a full-length antibody may comprise additional immunoglobulin domains, such as one or more additional scFvs or heavy or light chain Fab fragments or scFabs conjugated to one or more ends of different chains of a full-length antibody, but each end is only conjugated to a single fragment. These conjugates are also covered by the term full-length antibody.

[0154] The "class" of an antibody refers to the type of constant domain or constant region (preferably Fc region) possessed by the heavy chain of the antibody. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, and some of them can be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively.

[0155] The term "heavy chain constant region" refers to the region containing constant domains in the immunoglobulin heavy chain, i.e., CH1 structure, hinge region, CH2 domain and CH3 domain. In certain embodiments, the human IgG constant region extends from Ala118 to the carboxyl terminus of the heavy chain (numbered according to the Kabat EU index). However, the C-terminal lysine (Lys447) of the constant region may be present or absent (numbered according to the Kabat EU index). The term "constant region" refers to a dimer comprising two heavy chain constant regions, which can be covalently linked to each other via hinge region cysteine ​​residues to form an interchain disulfide bond.

[0156] The term "heavy chain Fc region" refers to the C-terminal region of an immunoglobulin heavy chain, which contains at least a portion of a hinge region (middle and lower hinge region), a CH2 domain, and a CH3 domain. In certain embodiments, the human IgG heavy chain Fc region extends from Asp221 or from Cys226 or from Pro230 to the carboxyl terminus of the heavy chain (numbered according to the Kabat EU index). Therefore, the Fc region is smaller than the constant region, but is substantially the same as the C-terminal portion. However, the C-terminal lysine (Lys447) in the heavy chain Fc region may be present or absent (numbered according to the Kabat EU index). The term "Fc region" refers to a dimer comprising two heavy chain Fc regions, which may be covalently linked to each other by hinge region cysteine ​​residues to form an interchain disulfide bond.

[0157] The constant region of an antibody, more precisely the Fc region (and this is also true for the constant region), is directly involved in complement activation, C1q binding, C3 activation and Fc receptor binding. Although the effect of an antibody on the complement system depends on certain conditions, binding to C1q is caused by a defined binding site in the Fc region. Such binding sites are known in the prior art and are described, for example, by Lukas, TJ et al., J. Immunol. 127 (1981) 2555-2560; Brunhouse, R. and Cebra, JJ, Mol. Immunol. 16 (1979) 907-917; Burton, DR et al., Nature 288 (1980) 338-344; Thommesen, JE et al., Mol. Immunol. 37 (2000) 995-1004; Idusogie, EE et al., J. Immunol. 164 (2000) 4178-4184; Hezareh, M. et al., J. Virol. 75 (2001) 12161-12168; Morgan, A. et al., Immunology 86 (1995) 319-324; and EP 0 307 434. Such binding sites are, for example, L234, L235, D270, N297, E318, K320, K322, P331 and P329 (numbering according to the Kabat EU index). Antibodies of the subclasses IgG1, IgG2 and IgG3 generally exhibit complement activation, C1q binding and C3 activation, whereas IgG4 does not activate the complement system, does not bind C1q and does not activate C3.

[0158] "Fc region of an antibody" is a term well known to skilled artisans, and is defined based on papain cleavage of an antibody.

[0159] The term "monoclonal antibody" as used herein refers to an antibody obtained from a substantially homogeneous antibody population, that is, except for possible variant antibodies (e.g., containing naturally occurring mutations or produced during the production of monoclonal antibody preparations, such variants are usually present in small amounts), the individual antibodies constituting the population are identical and / or bind the same epitope. Contrary to polyclonal antibody preparations that typically include different antibodies for different determinants (epitopes), each monoclonal antibody in a monoclonal antibody preparation is directed to a single determinant on an antigen. Therefore, the modifier "monoclonal" indicates that the characteristic of an antibody is obtained from a substantially homogeneous antibody population, and should not be interpreted as requiring antibodies to be produced by any particular method. For example, monoclonal antibodies can be prepared by a variety of techniques, including but not limited to hybridoma methods, recombinant DNA methods, phage display methods, and methods utilizing transgenic animals comprising all or part of a human immunoglobulin locus.

[0160] The term "valency" as used in this application indicates the presence of a specified number of binding sites in an antibody. Thus, the terms "bivalent", "tetravalent", and "hexavalent" indicate the presence of two binding sites, four binding sites, and six binding sites in an antibody, respectively.

[0161] "Monospecific antibody" refers to an antibody with a single binding specificity, i.e., specifically binding to one antigen. Monospecific antibodies can be prepared as full-length antibodies or antibody fragments (e.g., F(ab')2) or combinations thereof (e.g., full-length antibodies plus additional scFv or Fab fragments). Monospecific antibodies do not need to be monovalent, i.e., monospecific antibodies may contain more than one binding site that specifically binds to one antigen. For example, natural antibodies are monospecific but bivalent.

[0162] "Multispecific antibody" means having binding specificity for at least two different epitopes or two different antigens on the same antigen. Multispecific antibodies can be prepared as full-length antibodies or antibody fragments (e.g., F(ab')2 bispecific antibodies) or combinations thereof (e.g., full-length antibodies plus additional scFv or Fab fragments). Multispecific antibodies are at least bivalent, i.e., contain two antigen binding sites. In addition, multispecific antibodies are at least bispecific. Therefore, bivalent bispecific antibodies are the simplest form of multispecific antibodies. Engineered antibodies with two, three or more (e.g., four) functional antigen binding sites have also been reported (see, e.g., US2002 / 0004587).

[0163] In certain embodiments of all aspects and embodiments of the subject matter of the invention disclosed herein, cells according to the present invention express antibodies. In certain embodiments, the antibody is a multispecific antibody, such as at least a bispecific antibody. In certain embodiments, one of the binding specificities is directed to a first antigen, and the other is directed to a different second antigen. In certain embodiments, the multispecific antibody can bind to two different epitopes of the same antigen. Multispecific antibodies can also be used to localize cytotoxic agents to cells expressing one or more antigens.

[0164] Multispecific antibodies can be prepared as full-length antibodies or antibody-antibody fragment fusions.

[0165] Techniques for making multispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy chain-light chain pairs of different specificities (see Milstein, C. and Cuello, AC, Nature 305 (1983) 537-540, WO 93 / 08829, and Traunecker, A. et al., EMBO J. 10 (1991) 3655-3659) and “knob-in-hole” engineering (see, e.g., US 5,731,168). Multispecific antibodies can also be prepared by engineering electrostatic manipulation effects for preparing antibody Fc-heterodimer molecules (see, e.g., WO 2009 / 089004); cross-linking two or more antibodies or fragments (see, e.g., US 4,676,980, and Brennan, M. et al., Science, 229 (1985) 81-83); using leucine zippers to produce bispecific antibodies (see, e.g., Kostelny, S. A. et al., J. Immunol. 148 (1992) 1547-1553); using common light chain technology to avoid light chain mispairing problems (see, e.g., WO 98 / 50431); using specific techniques for preparing bispecific antibody fragments (see, e.g., Holliger, P. et al., Proc. Natl. Acad. Sci. USA 90 (1993) 6444-6448); and trispecific antibodies were prepared as described in Tutt, A. et al., J. Immunol. 147 (1991) 60-69.

[0166] Also included herein are engineered antibodies with three or more antigen binding sites, including, for example, "octopus antibodies" or DVD-Ig (see, for example, WO 2001 / 77342 and WO 2008 / 024715). Other examples of multispecific antibodies with three or more antigen binding sites can be found in WO 2010 / 115589, WO 2010 / 112193, WO 2010 / 136172, WO 2010 / 145792 and WO 2013 / 026831. Bispecific antibodies or their antigen-binding fragments also include "double-acting Fab" or "DAF" (see, for example, US2008 / 0069820 and WO 2015 / 095539).

[0167] Multispecific antibodies can also be provided in an asymmetric format with domain crossing, i.e. by exchanging VH / VL domains (see, e.g., WO 2009 / 080252 and WO 2015 / 150447), CH1 / CL domains (see, e.g., WO 2009 / 080253) or complete Fab arms (see, e.g., WO 2009 / 080251, WO 2016 / 016299, see also Schaefer et al., Proc. Natl. Acad. Sci. USA 108 (2011) 1187-1191, and Klein et al., MAbs 8 (2016) 1010-1020) in one or more binding arms with the same antigen specificity. In certain embodiments of all aspects and embodiments of the subject matter of the invention disclosed herein, the cell according to the invention expresses a multispecific antibody comprising a Cross-Fab fragment. The term "Cross-Fab fragment" means a Fab fragment in which the variable or constant regions of the heavy and light chains are exchanged. The cross-Fab fragment contains a polypeptide chain consisting of a light chain variable region (VL) and a heavy chain constant region 1 (CH1), and a polypeptide chain consisting of a heavy chain variable region (VH) and a light chain constant region (CL). Asymmetric Fab arms can also be engineered by introducing charged or uncharged amino acid mutations into the domain interface to guide the correct pairing of Fab heavy chain fragments and cognate light chains. See, for example, WO 2016 / 172485.

[0168] The antibody or fragment may also be a multispecific antibody as described in WO 2009 / 080254, WO 2010 / 112193, WO 2010 / 115589, WO 2010 / 136172, WO 2010 / 145792, or WO 2010 / 145793.

[0169] The antibody or fragment thereof may also be a multispecific antibody as disclosed in WO 2012 / 163520.

[0170] Various additional molecular formats of multispecific antibodies are known in the art and can be produced using the cells according to the invention (see, for example, Spiess et al., Mol. Immunol. 67 (2015) 95-106).

[0171] Bispecific antibodies are generally antibody molecules that specifically bind to two different, non-overlapping epitopes on the same antigen or to two epitopes on different antigens.

[0172] In certain embodiments of all aspects and embodiments of the inventive subject matter disclosed herein, the cell according to the invention expresses a composite (multispecific) antibody selected from the group of (composite) (multispecific) antibodies consisting of:

[0173] Full-length antibodies with domain swapping

[0174] (i.e., a multispecific IgG antibody comprising a first Fab fragment and a second Fab fragment, wherein in the first Fab fragment

[0175] a) only the CH1 and CL domains are replaced with each other (i.e. the light chain of the first Fab fragment comprises the VL and CH1 domains, and the heavy chain of the first Fab fragment comprises the VH and CL domains);

[0176] b) only the VH and VL domains are replaced with each other (i.e. the light chain of the first Fab fragment comprises the VH and CL domains, and the heavy chain of the first Fab fragment comprises the VL and CH1 domains); or

[0177] c) the CH1 and CL domains are replaced with each other and the VH and VL domains are replaced with each other (i.e. the light chain of the first Fab fragment comprises the VH and CH1 domains, and the heavy chain of the first Fab fragment comprises the VL and CL domains); and

[0178] The second Fab fragment comprises a light chain and a heavy chain, the light chain comprises a VL and a CL domain, and the heavy chain comprises a VH and a CH1 domain;

[0179] The full length antibody with domain exchange may comprise a first heavy chain comprising a CH3 domain and a second heavy chain comprising a CH3 domain, wherein the two CH3 domains are engineered in a complementary manner by corresponding amino acid substitutions so as to support heterodimerization of the first heavy chain with the modified second heavy chain, e.g., as disclosed in WO 96 / 27011, WO 98 / 050431, EP1870459, WO 2007 / 110205, WO 2007 / 147901, WO 2009 / 089004, WO 2010 / 129304, WO 2011 / 90754, WO 2011 / 143545, WO 2012 / 058768, WO 2013 / 157954 or WO 2013 / 096291 (incorporated herein by reference);

[0180] Full-length antibody with domain swapping and additional heavy chain C-terminal binding site (BS)

[0181] (i.e., a multispecific IgG antibody comprising

[0182] a) a full-length antibody comprising two pairs each of a full-length antibody light chain and a full-length antibody heavy chain, wherein the binding site formed by each of the pairs of full-length heavy chain and full-length light chain specifically binds to a first antigen, and

[0183] b) an additional Fab fragment, wherein the additional Fab fragment is fused to the C-terminus of one heavy chain of the full-length antibody, wherein the binding site of the additional Fab fragment specifically binds to a second antigen,

[0184] wherein the additional Fab fragment that specifically binds to a second antigen i) comprises a domain crossover such that a) the light chain variable domain (VL) and the heavy chain variable domain (VH) are replaced with each other, or b) the light chain constant domain (CL) and the heavy chain constant domain (CH1) are replaced with each other, or ii) is a single chain Fab fragment);

[0185] One-armed single-chain antibody

[0186] (i.e., an antibody comprising a first binding site that specifically binds to a first epitope or antigen and a second binding site that specifically binds to a second epitope or antigen, wherein the individual chains are as follows

[0187] -Light chain (variable light chain domain + light chain kappa constant domain)

[0188] - Combined light chain / heavy chain (variable light chain domain + light chain constant domain + peptide linker + variable heavy chain domain + CH1 + hinge + CH2 + CH3 with knob mutation)

[0189] -Heavy chain (variable heavy chain domain + CH1 + hinge + CH2 + CH3 with hole mutation); two-armed single-chain antibody

[0190] (i.e., an antibody comprising a first binding site that specifically binds to a first epitope or antigen and a second binding site that specifically binds to a second epitope or antigen, wherein the individual chains are as follows

[0191] - Combined light chain / heavy chain 1 (variable light chain domain + light chain constant domain + peptide linker + variable heavy chain domain + CH1 + hinge + CH2 + CH3 with hole mutation)

[0192] - Combined light chain / heavy chain 2 (variable light chain domain + light chain constant domain + peptide linker + variable heavy chain domain + CH1 + hinge + CH2 + CH3 with knob mutation));

[0193] Common light chain bispecific antibodies

[0194] (i.e., an antibody comprising a first binding site that specifically binds to a first epitope or antigen and a second binding site that specifically binds to a second epitope or antigen, wherein the individual chains are as follows

[0195] -Light chain (variable light chain domain + light chain constant domain)

[0196] -Heavy chain 1 (variable heavy chain domain + CH1 + hinge + CH2 + CH3 with hole mutation)

[0197] - Heavy chain 2 (variable heavy chain domain + CH1 + hinge + CH2 + CH3 with knob mutation));

[0198] T cell bispecific antibodies (TCB)

[0199] (i.e., a full-length antibody having: an additional heavy chain N-terminal binding site with domain swapping, comprising

[0200] - a first Fab fragment and a second Fab fragment, wherein each binding site of the first Fab fragment and the second Fab fragment specifically binds to a first antigen,

[0201] - a third Fab fragment, wherein the binding site of the third Fab fragment specifically binds to the second antigen, and wherein the third Fab fragment comprises a domain crossover such that the variable light chain domain (VL) and the variable heavy chain domain (VH) are replaced with each other, and

[0202] - an Fc region comprising a first Fc region polypeptide and a second Fc region polypeptide,

[0203] wherein the first Fab fragment and the second Fab fragment each comprise a heavy chain fragment and a full-length light chain,

[0204] wherein the C-terminus of the heavy chain fragment of the first Fab fragment is fused to the N-terminus of the first Fc region polypeptide,

[0205] wherein the C-terminus of the heavy chain fragment of the second Fab fragment is fused to the N-terminus of the variable light chain domain of the third Fab fragment, and the C-terminus of the CH1 domain of the third Fab fragment is fused to the N-terminus of the second Fc region polypeptide);

[0206] Antibody-polymer fusion

[0207] (i.e., a multimeric fusion protein comprising

[0208] (a) an antibody heavy chain and an antibody light chain, and

[0209] (b) a first fusion polypeptide comprising, in the N-terminal to C-terminal direction, a first portion of a non-antibody multimeric polypeptide, an antibody heavy chain CH1 domain or an antibody light chain constant domain, an antibody hinge region, an antibody heavy chain CH2 domain, and an antibody heavy chain CH3 domain; and a second fusion polypeptide comprising, in the N-terminal to C-terminal direction, a second portion of the non-antibody multimeric polypeptide and, in the case where the first polypeptide comprises an antibody heavy chain CH1 domain, an antibody light chain constant domain, or in the case where the first polypeptide comprises an antibody light chain constant domain, an antibody heavy chain CH1 domain,

[0210] in

[0211] (i) the antibody heavy chain of (a) and the first fusion polypeptide of (b), (ii) the antibody heavy chain of (a) and the antibody light chain of (a), and (iii) the first fusion polypeptide of (b) and the second fusion polypeptide of (b) are each independently covalently linked to each other via at least one disulfide bond,

[0212] in

[0213] The variable domains of the antibody heavy chain and antibody light chain form a binding site that specifically binds to an antigen).

[0214] "Knob-in-hole" dimerization modules and their use in antibody engineering are described in Carter P., Ridgway JBB, Presta LG: Immunotechnology, Vol. 2, No. 1, February 1996, pp. 73-73(1).

[0215] The CH3 domain in the heavy chain of an antibody can be altered by the "knob-into-holes" technique, which is described in detail with several examples in, for example, WO 96 / 027011, Ridgway, JB et al., Protein Eng. 9 (1996) 617-621 and Merchant, AM et al., Nat. Biotechnol. 16 (1998) 677-681. In this method, the interaction surfaces of the two CH3 domains are altered to increase the heterodimerization of the two CH3 domains, and thereby increase the heterodimerization of the polypeptides containing them. One of the two CH3 domains (of the two heavy chains) can be a "knob" and the other a "hole". The introduction of disulfide bridges further stabilizes the heterodimers (Merchant, AM et al., Nature Biotech. 16 (1998) 677-681; Atwell, S. et al., J. Mol. Biol. 270 (1997) 26-35) and increases the yield.

[0216] The mutation T366W in the CH3 domain (of the antibody heavy chain) is denoted as a "knob mutation" or "mutated knob", while the mutations T366S, L368A, Y407V in the CH3 domain (of the antibody heavy chain) are denoted as "hole mutations" or "mutated hole" (numbering according to the Kabat EU index). Additional interchain disulfide bridges located between the CH3 domains can also be used by introducing the S354C mutation into the CH3 domain of the heavy chain with a "knob mutation" (denoted as "knob-cys-mutation" or "mutated knob-cys") or by introducing the Y349C mutation into the CH3 domain of the heavy chain with a "hole mutation" (denoted as "hole-cys-mutation" or "mutated hole-cys") (numbering according to the Kabat EU index) (Merchant, AM et al., Nature Biotech. 16 (1998) 677-681).

[0217] The term "domain crossing" as used herein means that in an antibody heavy chain VH-CH1 fragment and its corresponding cognate antibody light chain pair, i.e. in antibody Fab (fragment antigen binding), the domain sequence deviates from the sequence in the native antibody in that at least one heavy chain domain is replaced by its corresponding light chain domain, and vice versa. There are three general types of domain crossings: (i) crossings of CH1 and CL domains, which results from domain crossings in the light chain to produce a VL-CH1 domain sequence, and from domain crossings in the heavy chain fragment to produce a VH-CL domain sequence (or a full-length antibody heavy chain having a VH-CL-hinge-CH2-CH3 domain sequence); (ii) domain crossings of VH and VL domains, which results from domain crossings in the light chain to produce a VH-CL domain sequence, and from domain crossings in the heavy chain fragment to produce a VL-CH1 domain sequence; and (iii) domain crossings of a complete light chain (VL-CL) and a complete VH-CH1 heavy chain fragment ("Fab crossing"), which results from domain crossings to produce a light chain having a VH-CH1 domain sequence, and from domain crossings to produce a heavy chain fragment having a VL-CL domain sequence (all of the aforementioned domain sequences are presented in the N-terminal to C-terminal direction).

[0218] As used herein, the term "replacement of one another" with respect to the corresponding heavy chain domain and light chain domain refers to the aforementioned domain intersection. Thus, when the CH1 domain and the CL domain "replacement of one another", it refers to the domain intersection mentioned under item (i) and the resulting heavy chain and light chain domain sequences. Thus, when VH and VL "replacement of one another", it refers to the domain intersection mentioned in item (ii); and when the CH1 and CL domains "replacement of one another" and the VH and VL domains "replacement of one another", it refers to the domain intersection mentioned in item (iii). For example, bispecific antibodies comprising domain exchange are reported in WO 2009 / 080251, WO 2009 / 080252, WO 2009 / 080253, WO 2009 / 080254 and Schaefer, W. et al., Proc. Natl. Acad. Sci USA 108 (2011) 11187-11192. Such antibodies are often referred to as CrossMab.

[0219] In certain embodiments of all aspects and embodiments of the subject matter of the invention disclosed herein, a cell according to the invention expresses a multispecific antibody comprising at least one Fab fragment comprising a domain intersection of a CH1 and CL domain, or a domain intersection of a VH and VL domain, or a domain intersection of a VH-CH1 and a VL-VL domain. In a multispecific antibody having domain intersections, Fabs that specifically bind to the same antigen are constructed to have the same domain sequence. Therefore, in the case where more than one Fab having domain intersections is included in the multispecific antibody, the Fabs specifically bind to the same antigen.

[0220] A "humanized" antibody refers to an antibody comprising amino acid residues from non-human HVRs and amino acid residues from human FRs. In certain embodiments, a humanized antibody will substantially comprise at least one variable domain, typically two variable domains, wherein all or substantially all HVRs (e.g., CDRs) correspond to HVRs of non-human antibodies, and all or substantially all FRs correspond to FRs of human antibodies. A humanized antibody may optionally comprise at least a portion of an antibody constant region derived from a human antibody. An antibody in "humanized form," such as a non-human antibody, refers to an antibody that has undergone humanization.

[0221] The term "recombinant antibody" as used herein refers to all antibodies (chimeric, humanized and human antibodies) prepared, expressed, created or isolated by recombinant means, such as using cells according to the present invention. This includes antibodies isolated from recombinant cells, such as NS0, HEK, BHK, amniocytes or CHO cells modified according to the present invention.

[0222] As used herein, the term "antibody fragment" refers to a molecule other than an intact antibody, which comprises a portion of an intact antibody and binds to the same epitope on the same antigen as the intact antibody, i.e., it is a functional fragment. Examples of antibody fragments include, but are not limited to, Fv; Fab; Fab'; Fab'-SH; F(ab')2; bispecific Fab, diabody, linear antibody, single-chain antibody molecule (e.g., scFv or scFab).

[0223] Recombinant methods and compositions

[0224] One aspect of the subject matter of the invention disclosed herein is a method for preparing a heterologous polypeptide or protein using a cell according to the invention. The method comprises the steps of culturing a cell according to the invention comprising one or more nucleic acids encoding a heterologous polypeptide or protein under conditions suitable for expressing the heterologous polypeptide or protein, and recovering the heterologous polypeptide or protein from the cell (or cell culture medium), and optionally purifying the heterologous polypeptide or protein using one or more chromatography steps.

[0225] Antibodies can be produced using recombinant methods and compositions, for example, as described in US 4,816,567. For these methods, one or more isolated nucleic acids encoding the antibodies are provided.

[0226] In one aspect of the inventive subject matter disclosed herein, a method of preparing an antibody is provided, wherein the method comprises culturing a cell according to the invention comprising one or more nucleic acids encoding the antibody under conditions suitable for expression of the antibody, and optionally recovering the antibody from the cell (or cell culture medium).

[0227] For recombinant production of heterologous polypeptides or proteins, such as, for example, antibodies, nucleic acids encoding heterologous polypeptides or proteins are isolated and inserted into one or more vectors for further cloning and / or expression in cells according to the invention. Such nucleic acids can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that specifically bind to genes encoding heavy and light chains of antibodies), or produced by recombinant methods or obtained by chemical synthesis.

[0228] Generally speaking, for the recombinant large-scale production of a heterologous polypeptide or protein of interest (such as, for example, a therapeutic antibody), cells that stably express and secrete the heterologous polypeptide or protein are required. Such cells are referred to as "recombinant cells" or "recombinant production cells," and the process for generating such cells is referred to as "cell line development."

[0229] In the first step of the cell line development process, suitable host cells (such as, for example, CHO cells modified according to the present invention) are transfected with a nucleic acid sequence suitable for expressing the heterologous polypeptide or protein of interest. In the second step, cells that stably express the heterologous polypeptide or protein of interest are selected based on the co-expression of a selection marker that has been co-transfected with the nucleic acid encoding the heterologous polypeptide or protein of interest.

[0230] Nucleic acids encoding heterologous polypeptides or proteins (i.e., coding sequences) are denoted as structural genes. Such structural genes are pure coding information. Therefore, additional regulatory elements are required for their expression. Therefore, structural genes are integrated into so-called expression cassettes. The minimum regulatory elements required for the expression cassette to function in mammalian cells are a promoter that functions in the mammalian cells, which is located upstream of the structural gene, i.e., 5', and a polyadenylation signal sequence that functions in the mammalian cells, which is located downstream of the structural gene, i.e., 3'. The promoter, structural gene, and polyadenylation signal sequence are arranged in an operably linked form.

[0231] In case the heterologous polypeptide of interest is a heteromultimeric protein composed of different (monomeric) polypeptides, such as, for example, an antibody or a composite antibody format, not only a single expression cassette is required, but rather a plurality of expression cassettes which differ from one another in the structural genes comprised, i.e. at least one expression cassette is required for each of the different (monomeric) polypeptides of the heteromultimeric protein.

[0232] For example, a full-length antibody is a heteromultimeric protein comprising two copies of a light chain and two copies of a heavy chain. Therefore, a full-length antibody is composed of two different polypeptides. Therefore, the expression of a full-length antibody requires two expression cassettes, one for the light chain and the other for the heavy chain. For example, if the full-length antibody is a bivalent bispecific antibody, i.e., the antibody comprises two different binding sites that specifically bind to two different antigens, then the two light chains and the two heavy chains are also different from each other. Therefore, such a bivalent bispecific full-length antibody is composed of four different polypeptides, and therefore requires four expression cassettes.

[0233] The expression cassettes required for expressing the heterologous polypeptide or protein of interest are in turn incorporated into one or more so-called "expression vectors". An "expression vector" is a nucleic acid that provides all the necessary elements required for amplification of the vector in prokaryotic cells and for expression of the contained structural genes in mammalian cells. Typically, an expression vector comprises a prokaryotic plasmid propagation unit, such as a prokaryotic plasmid propagation unit for E. coli, which comprises an origin of replication and a prokaryotic selection marker, as well as a eukaryotic selection marker, and additional expression cassettes required for expression of the structural gene of interest. An "expression vector" is a transport vehicle for introducing an expression cassette into a modified mammalian cell according to the invention.

[0234] As outlined in the previous paragraph, the more complex the target heterologous polypeptide or protein, the higher the number of different expression cassettes required. Inherently, as the number of expression cassettes increases, the total size (i.e., number of base pairs) of the nucleic acid integrated into the host cell genome also increases. The size of the expression vector also increases accordingly. However, the actual upper limit of the vector size is within the range of about 15 kbp, beyond which the processing and processing efficiency decreases significantly. This problem can be solved by using two or more expression vectors. Therefore, the expression cassette is divided into different expression vectors, each of which contains only some of the expression cassettes, so that the size (bp number) of each vector is reduced.

[0235] Cell line development (CLD) for generating recombinant cells expressing heterologous polypeptides or proteins (such as, for example, multispecific antibodies) employs randomly integrated (RI) or targeted integrated (TI) nucleic acids comprising the respective expression cassettes required for the expression and production of the heterologous polypeptide or protein of interest.

[0236] Using RI, generally, several vectors or fragments thereof are integrated into the genome of the cell at the same or different loci. Therefore, the number and ratio of integrated expression cassettes cannot be controlled.

[0237] Typically, using TI, a defined number of different expression cassettes are integrated at predetermined "hot spots" in the genome of the cell.

[0238] Suitable cells for expressing (glycosylation) heterologous polypeptides or proteins (such as antibodies) are generally derived from multicellular organisms (such as, for example, vertebrates).

[0239] Host cells

[0240] Any mammalian cell can be modified according to the subject matter of the invention disclosed herein. Such application of the modification according to the subject matter of the invention disclosed herein is independent of whether the cell is an adherent growing cell or a suspended growing cell and the integration method (i.e. for RI as well as TI). Any mammalian cell can be used.

[0241] Examples of mammalian cells that can be modified according to the subject matter of the invention disclosed herein are human amniocytes (e.g., CAP-T cells as described in Woelfel, J. et al., BMC Proc. 5 (2011) P133); monkey kidney cells (CV1); monkey kidney CV1 cells transformed by SV40 (COS-7); human embryonic kidney cells (such as HEK293 or HEK293T cells as described in, for example, Graham, FL et al., J. Gen Virol. 36 (1977) 59-74); miniature hamster kidney cells (BHK); mouse Sertoli cells (e.g., TM4 cells described in Mather, JP, Biol. Reprod. 23 (1980) 243-252); African green monkey kidney cells (VERO-76); human cervical carcinoma cells (HELA); canine kidney cells (MDCK); Buffalo rat hepatocytes (BRL 3A); human lung cells (W138); human liver cells (Hep G2); mouse mammary tumor cells (MMT 060562); TRI cells (as described, for example, in Mather, JP et al., Annals NY Acad. Sci. 383 (1982) 44-68); MRC 5 cells; and FS4 cells.

[0242] Particularly useful mammalian cells to be modified according to the subject matter of the invention disclosed herein include Chinese hamster ovary (CHO) cells, including DHFR-CHO cells (Urlaub, G. et al., Proc. Natl. Acad. Sci. USA 77 (1980) 4216-4220); and myeloma cells, such as Y0, NS0 and Sp2 / 0. For a review of certain mammalian host cell lines suitable for antibody production, see, e.g., Yazaki, P. and Wu, AM, Methods in Molecular Biology, Vol. 248, Lo, BKC (ed.), Humana Press, Totowa, NJ (2004), pp. 255-268.

[0243] In certain embodiments of all aspects and embodiments of the inventive subject matter disclosed herein, the mammalian cell modified according to the invention or used in the method or use according to the invention is a Chinese hamster ovary (CHO) cell (e.g., CHO K1, CHO DG44, etc.), a human embryonic kidney (HEK) cell, a lymphoid cell (e.g., Y0, NS0, Sp2 / 0 cell), or a human amniotic fluid cell (e.g., CAP-T, etc.). In a preferred embodiment of the inventive subject matter disclosed herein, the mammalian cell modified according to the invention or used in the method according to the invention is a CHO cell or a HEK cell.

[0244] In certain embodiments of the subject matter of the invention disclosed herein, the present invention relates to modified mammalian cells, such as CHO cells, in which the expression of one or more endogenous products of the mammalian cell (e.g., host cell proteins) is reduced or eliminated. For example, but not limited to, methods for reducing or eliminating the expression of endogenous products in mammalian cells include: (1) modifying genes encoding endogenous products or components thereof, such as by introducing deletions, insertions, substitutions, or a combination thereof into the gene; (2) reducing or eliminating the transcription and / or stability of mRNA encoding endogenous products or components thereof; and (3) reducing or eliminating the translation of mRNA encoding endogenous products or components thereof. In certain embodiments of the subject matter of the invention disclosed herein, the reduction or elimination of protein expression is obtained by targeted genome editing. For example, CRISPR / Cas9-based genome editing can be used to modify one or more target genes, resulting in a reduction or elimination of the expression of a gene (or multiple genes) targeted for editing.

[0245] In certain embodiments of the subject matter of the invention disclosed herein, a mammalian cell endogenous product of expression targeted for reduction or elimination is selected based on its role in promoting lysine hydroxylation. Since lysine hydroxylation may lead to the formation of unwanted by-products, reducing or eliminating the expression of such endogenous proteins can have a positive impact on culture yield and purity. For example, but not limited to, the endogenous mammalian cell protein selected based on its role in promoting lysine hydroxylation is PLOD. In certain embodiments of the subject matter of the invention disclosed herein, the mammalian cell of the subject matter of the invention disclosed herein shows reduced or eliminated expression of PLOD. In certain embodiments of the subject matter of the invention disclosed herein, the mammalian cell of the present disclosure shows reduced or eliminated expression of PLOD 1 or / and PLOD2 or / and PLOD3.

[0246] In certain embodiments of the inventive subject matter disclosed herein, the mammalian cell comprises an additional endogenous product whose expression is targeted for reduction or elimination.

[0247] In certain embodiments of the subject matter of the invention disclosed herein, one or more targeted reduced or eliminated expression of other mammalian cell endogenous products is selected based on its role in promoting apoptosis. Since apoptosis can reduce culture viability and productivity, reducing or eliminating the expression of such proteins can have a positive impact on culture viability and productivity production. For example, but not limited to, the mammalian cell protein selected based on its role in promoting apoptosis is BCL2-related X, apoptosis regulator (BAX) or BCL2 antagonist / killer factor 1 (BAK). In certain embodiments of the subject matter of the invention disclosed herein, the mammalian cells of the present invention further show reduced or eliminated expression of BAX. In certain embodiments of the subject matter of the invention disclosed herein, the mammalian cells of the present invention further show reduced or eliminated expression of BAK. In certain embodiments of the subject matter of the invention disclosed herein, the mammalian cells of the present invention further show reduced or eliminated expression of BAX and BAK.

[0248] In certain embodiments of the subject matter of the invention disclosed herein, additional mammalian cell endogenous products whose expression is targeted for reduction or elimination are selected based on their role in promoting coagulation and / or aggregation during cell culture. When mammalian cells are used to produce a recombinant product of interest, such coagulation and / or aggregation during cell culture can result in reduced product titer due to the negative effects of coagulation and / or aggregation on mammalian cell viability. For example, but not limited to, additional mammalian cell endogenous products selected based on their role in promoting coagulation and / or aggregation during cell culture are intercellular adhesion molecule 1 (ICAM-1). In certain embodiments of the subject matter of the invention disclosed herein, the mammalian cells of the present invention further exhibit reduced or eliminated expression of ICAM-1.

[0249] In certain embodiments of the subject matter of the invention disclosed herein, one or more of the additional mammalian cell endogenous products of expression that are targeted for reduction or elimination are selected based on their role in promoting inefficient cell growth. Mammalian cells express many endogenous products that are not essential for cell growth, survival and / or productivity. Since the expression of these endogenous products consumes a large amount of cellular energy and DNA / protein structural units, reducing or eliminating the expression of such endogenous products can make cell growth more efficient, and in the case where cells are used to produce the purpose recombinant product, those cell sources can be transformed to achieve the higher productivity of the purpose recombinant product. For example, but not limited to, additional mammalian cell endogenous products selected based on their role in promoting efficient cell growth and the higher productivity of the target recombinant product are BAX, BAK, ICAM-1, Sirtuin 1 (SIRT-1) or MYC proto-oncogene, BHLH transcription factor (MYC). In certain embodiments of the subject matter of the invention disclosed herein, the mammalian cells of the present invention further exhibit reduced or eliminated expression of SIRT-1. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of SIRT-1 and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAX and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAK and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of ICAM-1 and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAX and SIRT-1. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAK and SIRT-1. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of ICAM-1 and SIRT-1. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAX, SIRT-1, and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of BAK, SIRT-1, and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the invention further exhibit reduced or eliminated expression of ICAM-1, SIRT-1, and MYC.In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the present invention further exhibit reduced or eliminated expression of BAX, BAK, SIRT-1, and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the present invention further exhibit reduced or eliminated expression of BAX, ICAM-1, SIRT-1, and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the present invention further exhibit reduced or eliminated expression of BAK, ICAM-1, SIRT-1, and MYC. In certain embodiments of the inventive subject matter disclosed herein, the mammalian cells of the present invention further exhibit reduced or eliminated expression of BAX, BAK, MYC, SIRT-1, and ICAM.

[0250] In certain embodiments of the subject matter of the invention disclosed herein, the host cell of the invention is modified to reduce or eliminate the expression of one or more host cell endogenous products relative to the expression of the host cell endogenous products in an unmodified (i.e., "reference") host cell. In certain embodiments of the subject matter of the invention disclosed herein, the reference host cell is a host cell in which the expression of one or more specific endogenous products (e.g., PLOD (especially PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides) is not reduced or eliminated. That is, the reference host cell has the same genotype as the modified cell, except for the corresponding endogenous gene whose expression is reduced or eliminated. In certain embodiments of the subject matter of the invention disclosed herein, the reference host cell is a cell comprising at least one or two wild-type alleles of genes encoding PLOD (especially PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC. For example, but not limited to, the reference host cell is a host cell having two wild-type alleles of genes encoding PLOD (especially PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC. In certain embodiments of the subject matter of the invention disclosed herein, the reference host cell is a WT host cell. In certain embodiments of the subject matter of the invention disclosed herein, the modification to reduce or eliminate the expression of one or more endogenous products of the host cell is performed before the introduction of an exogenous nucleic acid encoding a recombinant product of interest (i.e., a heterologous polypeptide or protein). In certain embodiments of the subject matter of the invention disclosed herein, the modification to reduce or eliminate the expression of one or more endogenous products of the host cell is performed after the introduction of an exogenous nucleic acid encoding a recombinant product of interest (i.e., a heterologous polypeptide or protein).

[0251] In certain embodiments of the inventive subject matter disclosed herein, the expression of one or more endogenous products (e.g., PLOD (particularly PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in a cell that has been modified to reduce or eliminate expression of the endogenous product is less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2% or less than about 1% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT host cell). In certain embodiments of the inventive subject matter disclosed herein, the expression of one or more endogenous products in a cell that has been modified to reduce or eliminate expression of the endogenous product is less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT host cell).

[0252] In certain embodiments of the inventive subject matter disclosed herein, the expression of one or more endogenous products (e.g., PLOD (particularly PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in a host cell that has been modified to reduce or eliminate the expression of the endogenous product is at least about 90%, at least about 80%, at least about 70%, at least about 60%, at least about 50%, at least about 40%, at least about 30%, at least about 20%, at least about 10%, at least about 5%, at least about 4%, at least about 3%, at least about 2% or at least about 1% of the expression of the corresponding endogenous product in a reference host cell (e.g., a WT host cell). In certain embodiments of the inventive subject matter disclosed herein, the expression of one or more endogenous products in a host cell that has been modified to reduce or eliminate expression of the endogenous product is at least about 90%, at least about 80%, at least about 70%, at least about 60%, at least about 50%, at least about 40%, at least about 30%, at least about 20%, at least about 10%, at least about 5%, at least about 4%, at least about 3%, at least about 2%, or at least about 1% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT mammalian cell).

[0253] In certain embodiments of the inventive subject matter disclosed herein, the expression of one or more specific endogenous products (e.g., PLOD (particularly PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in a cell that has been modified to reduce or eliminate expression of the endogenous product is no more than about 90%, no more than about 80%, no more than about 70%, no more than about 60%, no more than about 50%, no more than about 40%, no more than about 30%, no more than about 20%, no more than about 10%, no more than about 5%, no more than about 4%, no more than about 3%, no more than about 2% or no more than about 1% of the expression of the corresponding endogenous product in a reference host cell (e.g., a WT host cell). In certain embodiments of the inventive subject matter disclosed herein, the expression of one or more endogenous products (e.g., PLOD (particularly PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in a cell that has been modified to reduce or eliminate the expression of the endogenous product is no more than about 40% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT mammalian cell). In certain embodiments of the inventive subject matter disclosed herein, the expression of one or more endogenous products in a cell that has been modified to reduce or eliminate the expression of the endogenous product is no more than about 90%, no more than about 80%, no more than about 70%, no more than about 60%, no more than about 50%, no more than about 40%, no more than about 30%, no more than about 20%, no more than about 10%, no more than about 5%, no more than about 4%, no more than about 3%, no more than about 2%, or no more than about 1% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT host cell).

[0254] In certain embodiments of the inventive subject matter disclosed herein, the expression of one or more endogenous products (e.g., PLOD (particularly PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides) in a cell that has been modified to reduce or eliminate the expression of the endogenous product is between about 1% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 100% and about 90%, between about 15 ... between about 0% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 1% and about 80%, between about 10% and about 80%, between about 20% and about 80%, between about 30% and about 80%, between about 40% and about 80%, between about 50% and about 80%, between about 60% and about 80%, between about 70% and about 80%, between about 75% and about 80%, between about 1% and about 70%, between about 10% and about 70%, between about 20% and about 70% , between about 30% and about 70%, between about 40% and about 70%, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70%, between about 1% and about 60%, between about 10% and about 60%, between about 20% and about 60%, between about 30% and about 60%, between about 40% and about 60%, between about 50% and about 60%, between about 55% and about 60%, between about 1% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50 %, between about 1% and about 40%, between about 10% and about 40%, between about 20% and about 40%, between about 30% and about 40%, between about 35% and about 40%, between about 1% and about 30%, between about 10% and about 30%, between about 20% and about 30%, between about 25% and about 30%, between about 1% and about 20%, between about 5% and about 20%, between about 10% and about 20%, between about 15% and about 20%, between about 1% and about 10%, between about 5% and about 10%, between about 5% and about 20%, between about 5% and about 30%, and between about 5% and about 40%.In certain embodiments of the inventive subject matter disclosed herein, the expression of one or more endogenous products (e.g., PLOD (particularly PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides) in a cell that has been modified to reduce or eliminate the expression of the endogenous product is between about 1% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 100% and about 90%, between about 15 ... between about 0% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 1% and about 80%, between about 10% and about 80%, between about 20% and about 80%, between about 30% and about 80%, between about 40% and about 80%, between about 50% and about 80%, between about 60% and about 80%, between about 70% and about 80%, between about 75% and about 80%, between about 1% and about 70%, between about 10% and about 70%, between about 20% and about 70% , between about 30% and about 70%, between about 40% and about 70%, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70%, between about 1% and about 60%, between about 10% and about 60%, between about 20% and about 60%, between about 30% and about 60%, between about 40% and about 60%, between about 50% and about 60%, between about 55% and about 60%, between about 1% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50 %, between about 1% and about 40%, between about 10% and about 40%, between about 20% and about 40%, between about 30% and about 40%, between about 35% and about 40%, between about 1% and about 30%, between about 10% and about 30%, between about 20% and about 30%, between about 25% and about 30%, between about 1% and about 20%, between about 5% and about 20%, between about 10% and about 20%, between about 15% and about 20%, between about 1% and about 10%, between about 5% and about 10%, between about 5% and about 20%, between about 5% and about 30%, and between about 5% and about 40%.

[0255] In certain embodiments, the expression of one or more endogenous products (e.g., PLOD (particularly PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in a cell that has been modified to reduce or eliminate the expression of the endogenous product is between about 5% and about 40% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT host cell).

[0256] In certain embodiments of the inventive subject matter disclosed herein, the expression level of one or more endogenous products (e.g., PLOD (particularly PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in different reference cells (e.g., cells comprising at least one or two wild-type alleles of the corresponding gene) can vary.

[0257] In certain embodiments of the subject matter of the invention disclosed herein, a genetic engineering system is used to reduce or eliminate one or more specific endogenous products (e.g., PLOD (especially PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC expression). Various genetic engineering systems known in the art can be used for the methods disclosed herein. Non-limiting examples of such systems include CRISPR / Cas systems, zinc finger nuclease (ZFN) systems, transcription activator-like effector nuclease (TALEN) systems, and other tools that use gene silencing to reduce or eliminate protein expression, such as small interfering RNA (siRNA), short hairpin RNA (shRNA), and microRNA (miRNA). Any CRISPR / Cas system known in the art, including traditional Cas systems, enhanced Cas systems, or modified Cas systems, as well as other bacterial-based genome excision tools (such as Cpf1), can be used with the methods disclosed herein.

[0258] In certain embodiments of the inventive subject matter disclosed herein, a portion of one or more genes (e.g., genes encoding endogenous products such as PLOD (especially PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides) is deleted to reduce or eliminate the expression of the corresponding endogenous products in the host cell. In certain embodiments of the inventive subject matter disclosed herein, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% of the gene is deleted. In certain embodiments, no more than about 2%, no more than about 5%, no more than about 10%, no more than about 15%, no more than about 20%, no more than about 25%, no more than about 30%, no more than about 35%, no more than about 40%, no more than about 45%, no more than about 50%, no more than about 55%, no more than about 60%, no more than about 65%, no more than about 70%, no more than about 75%, no more than about 80%, no more than about 85%, or no more than about 90% of the gene is deleted.In certain embodiments of the inventive subject matter disclosed herein, between about 2% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 2% and about 80%, between about 10% and about 80%, between about between about 20% and about 80%, between about 30% and about 80%, between about 40% and about 80%, between about 50% and about 80%, between about 60% and about 80%, between about 70% and about 80%, between about 75% and about 80%, between about 2% and about 70%, between about 10% and about 70%, between about 20% and about 70%, between about 30% and about 70%, between about 40% and about 70%, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70%, between about 20% and about 70%, between about 30% and about 70%, between about 40% and about 70%, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70 %, between about 2% and about 60%, between about 10% and about 60%, between about 20% and about 60%, between about 30% and about 60%, between about 40% and about 60%, between about 50% and about 60%, between about 55% and about 60%, between about 2% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50%, between about 2% and about 40%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50%, between about 2% and about 40%, between about 10% and about The gene is deleted in an amount between about 40%, between about 20% and about 40%, between about 30% and about 40%, between about 35% and about 40%, between about 2% and about 30%, between about 10% and about 30%, between about 20% and about 30%, between about 25% and about 30%, between about 2% and about 20%, between about 5% and about 20%, between about 10% and about 20%, between about 15% and about 20%, between about 2% and about 10%, between about 5% and about 10%, or between about 2% and about 5%.

[0259] In certain embodiments of the inventive subject matter disclosed herein, at least one exon of a gene encoding a PLOD (particularly PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide is at least partially deleted in the host cell.As used herein, "partially deleted" refers to, for example, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, no more than about 2%, no more than about 5%, no more than about 10%, no more than about 15%, no more than about 20%, no more than about 25%, no more than about 30%, no more than about 35%, no more than about 40%, no more than about 45%, no more than about 50%, no more than about 55%, no more than about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, no more than about 2%, no more than about 5%, no more than about 10%, no more than about 15%, no more than about 20%, no more than about 25%, no more than about 30%, no more than about 35%, no more than about 40%, no more than about 45%, no more than about 50 ... More than about 55%, no more than about 60%, no more than about 65%, no more than about 70%, no more than about 75%, no more than about 80%, no more than about 85%, no more than about 90%, no more than about 95%, between about 2% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 2% and about 80%, between about 10% and about 80%, between about 20% and about 80%, between about 30% and about 80% , between about 40% and about 80%, between about 50% and about 80%, between about 60% and about 80%, between about 70% and about 80%, between about 75% and about 80%, between about 2% and about 70%, between about 10% and about 70%, between about 20% and about 70%, between about 30% and about 70%, between about 40% and about 70%, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70%, between about 2% and about 60%, between about 10% and about 60%, between about 20% and about 60%, between about 30% and about 60%, between about 40% and about 60%, between about 50% and about 60%, between about 55% and about 60%, between about 2% and about 50% Between about 1% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50%, between about 2% and about 40%, between about 10% and about 40%, between about 20% and about 40%, between about 30% and about 40%, between about 35% and about 40%, between about 2% and about 30%, between about 10% and about 30%, between about 20% and about 30%, between about 25% and about 30%, between about 2% and about 20%, between about 5% and about 20%, between about 10% and about 20%, between about 15% and about 20%, between about 2% and about 10%, between about 5% and about 10%, or between about 2% and about 5% of the region is missing.

[0260] In certain non-limiting embodiments of the subject matter of the invention disclosed herein, the CRISPR / Cas9 system is used to reduce or eliminate the expression of one or more endogenous products (e.g., PLOD (especially PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in host cells. The clustered regularly interspaced short palindromic repeats (CRISPR) system is a genome editing tool found in prokaryotic cells. When used for genome editing, the system includes Cas9 (a protein that can modify DNA using crRNA as its guide), CRISPR RNA (crRNA, which contains: RNA, which is used by Cas9 to guide it to the correct fragment of host DNA; and a region that binds to tracrRNA (usually in the form of a hairpin loop) to form an active complex with Cas9), and trans-activating crRNA (tracrRNA, which binds to crRNA and forms an active complex with Cas9). The terms "guide RNA" and "gRNA" refer to any nucleic acid that promotes specific association (or "targeting") of an RNA-guided nuclease (such as Cas9) with a target sequence (such as a genomic or episomal sequence in a cell). The gRNA can be unimolecular (comprising a single RNA molecule, and alternatively referred to as chimeric) or modular (comprising more than one and typically two separate RNA molecules, such as crRNA and tracrRNA, which are typically associated with each other, for example, by duplexing).

[0261] The CRISPR / Cas9 strategy can use vectors to transfect mammalian cells. Guide RNA (gRNA) can be designed for each application because this is the sequence that Cas9 uses to identify and bind directly to the target DNA in mammalian cells. Multiple crRNAs and the tracrRNA can be packaged together to form a single guide RNA (sgRNA). The sgRNA can be connected to the Cas9 gene and made into a vector for transfection into mammalian cells.

[0262] In certain embodiments of the inventive subject matter disclosed herein, a CRISPR / Cas9 system for reducing or eliminating expression of one or more endogenous products (e.g., PLOD (especially PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) comprises a Cas9 molecule and one or more gRNAs comprising a targeting domain complementary to a target sequence of a gene encoding an endogenous product or a component thereof. In certain embodiments of the inventive subject matter disclosed herein, the target gene is a region of a gene encoding an endogenous product (e.g., PLOD (especially PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide). The target sequence can be any exon or intron region within a gene.

[0263] In certain embodiments of the subject matter of the invention disclosed herein, gRNA is applied to mammalian cells in a single vector, and Cas9 molecules are applied to host cells in a second vector. In certain embodiments of the subject matter of the invention disclosed herein, gRNA and Cas9 molecules are applied to host cells in a single vector. Alternatively, each of gRNA and Cas9 molecules can be applied by an independent vector. In certain embodiments of the subject matter of the invention disclosed herein, CRISPR / Cas9 system can be delivered to host cells as a ribonucleoprotein complex (RNP) comprising Cas9 protein compounded with one or more gRNA, for example, by electroporation delivery (see, e.g., DeWitt et al., Methods 121-122: 9-15 (2017) about other methods of delivering RNP to cells). In certain embodiments of the inventive subject matter disclosed herein, administration of the CRISPR / Cas9 system to a host cell results in reduction or elimination of expression of an endogenous product (e.g., PLOD (particularly PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide).

[0264] In certain embodiments of the subject matter of the invention disclosed herein, the genetic engineering system is a ZFN system for reducing or eliminating the expression of one or more specific endogenous products (e.g., PLOD (especially PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in mammalian cells. ZFN can act as a restriction enzyme, which is produced by combining a zinc finger DNA binding domain with a DNA cleavage domain. The zinc finger domain can be engineered to target a specific DNA sequence, which allows the zinc finger nuclease to target a desired sequence within the genome. The DNA binding domain of each ZFN typically includes multiple separate zinc finger repeats, and each zinc finger repeat can recognize multiple base pairs. The most common method for generating new zinc finger domains is to combine smaller zinc finger "modules" of known specificity. The most common cleavage domain in ZFN is the non-specific cleavage domain from the type II restriction endonuclease FokI. ZFNs regulate protein expression by creating double-strand breaks (DSBs) in the target DNA sequence, which, in the absence of a homologous template, will be repaired by non-homologous end joining (NHEJ). Such repairs can result in deletions or insertions of base pairs, resulting in frameshifts and preventing the production of harmful proteins (Durai et al., Nucleic Acids Res.; 33(18): 5978–90 (2005)). Multiple pairs of ZFNs can also be used to completely remove entire large fragments of genomic sequence (Lee et al., Genome Res.; 20(1): 81–9 (2010)).

[0265] In certain embodiments of the subject matter of the invention disclosed herein, the genetic engineering system is a TALEN system for reducing or eliminating the expression of one or more specific endogenous products (e.g., PLOD (especially PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in mammalian cells. TALEN is a restriction enzyme that can be engineered to cut a specific DNA sequence. The operating principle of the TALEN system is similar to that of ZFN. TALEN is produced by combining a transcription activator-like effector DNA binding domain with a DNA cleavage domain. Transcription activator-like effector (TALE) consists of a 33 to 34 amino acid repeating motif with two variable positions and has a strong recognition ability for specific nucleotides. By assembling an array of these TALEs, the TALE DNA binding domain can be engineered to bind to the desired DNA sequence, and thereby guide the nuclease to cut at a specific position in the genome (Boch et al., Nature Biotechnology; 29(2):135-6(2011)). In certain embodiments of the inventive subject matter disclosed herein, the target gene encodes a PLOD (particularly PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide.

[0266] In certain embodiments of the inventive subject matter disclosed herein, the expression of one or more specific endogenous products (e.g., PLOD (especially PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides) can be reduced or eliminated using oligonucleotides having sequences complementary to corresponding nucleic acids (e.g., mRNAs). Non-limiting examples of such oligonucleotides include small interfering RNA (siRNA), short hairpin RNA (shRNA), and micro RNA (miRNA). In certain embodiments of the inventive subject matter disclosed herein, such oligonucleotides can be homologous to at least a portion of a PLOD (especially PLOD1 or / and PLOD2 or / and PLOD3); BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide nucleic acid sequence, wherein the portion has a homology of at least about 75% or at least about 80% or at least about 85% or at least about 90% or at least about 95% or at least about 98% relative to the corresponding nucleic acid sequence. In certain non-limiting embodiments of the inventive subject matter disclosed herein, the complementary portion can constitute at least 10 nucleotides, or at least 15 nucleotides, or at least 20 nucleotides, or at least 25 nucleotides, or at least 30 nucleotides, and the length of the antisense nucleic acid, shRNA, mRNA, or siRNA molecule can be up to 15, or up to 20, or up to 25, or up to 30, or up to 35, or up to 40, or up to 45, or up to 50, or up to 75, or up to 100 nucleotides. The antisense nucleic acid, shRNA, mRNA, or siRNA molecule can comprise DNA or atypical or non-naturally occurring residues, such as, but not limited to, phosphorothioate residues.

[0267] The genetically engineered systems disclosed herein can be delivered to mammalian cells using viral vectors (e.g., retroviral vectors such as γ-retroviral vectors and lentiviral vectors). A combination of a retroviral vector and an appropriate packaging line is suitable, wherein the capsid protein will have the function of infecting human cells. Various cell lines that produce amphoteric viruses are known, including but not limited to PA12 (Miller, et al. (1985) Mol. Cell. Biol. 5: 431-437); PA317 (Miller, et al. (1986) Mol. Cell. Biol. 6: 2895-2902); and CRIP (Danos, et al. (1988) Proc. Natl. Acad. Sci. USA 85: 6460-6464). Non-amphitropic particles are also suitable, for example, particles pseudotyped with VSVG, RD114 or GALV envelopes and any other particles known in the art. Possible transduction methods also include direct co-cultivation of cells with producer cells, for example, by the method of Bregni et al. (1992) Blood 80:1418-1422, or cultivation with viral supernatant alone or concentrated vector stocks with or without appropriate growth factors and polycations, for example, by the method of Xu et al. (1994) Exp. Hemat. 22:223-230; and Hughes, et al. (1992) J. Clin. Invest. 89:1817.

[0268] Other transduction virus vectors can be used to modify mammalian cells disclosed herein. In certain embodiments of the subject matter of the invention disclosed herein, the selected vectors exhibit efficient infection and stable integration and expression (see, e.g., Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal of Virology 71:6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. USA 94:10319, 1997). Other viral vectors that can be used include, for example, adenovirus, lentivirus, and adeno-associated virus vectors, vaccinia virus, bovine papilloma virus, or herpes virus, such as Epstein-Barr virus (see also, e.g., Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244:1275-1281, 1989; Eglitis et al., BioTechniques 6:608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1:55-61, 1990; Sharp, The Lancet 337:1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells 247:411-429, 1985). 17:407-416, 1991; Miller et al., Biotechnology 7:980-990, 1989; LeGal La Salle et al., Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995). Retroviral vectors are particularly well developed and have been used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al., U.S. Pat. No. 5,399,346).

[0269] Non-viral methods can also be used for genetic engineering of mammalian cells disclosed herein. For example, nucleic acid molecules can be introduced into mammalian cells by administering the nucleic acid in the presence of lipofection (Feigner et al. Proc. Natl. Acad. Sci. USA 84:7413, 1987; Ono et al. Neuroscience Letters 17:259, 1990; Brigham et al. Am. J. Med. Sci. 298:278, 1989; Staubinger et al. Methods in Enzymology 101:512, 1983), asialoglycomucin-polylysine conjugation (Wu et al. Journal of Biological Chemistry 263:14621, 1988; Wu et al. Journal of Biological Chemistry 264:16985, 1989), or by microinjection under surgical conditions (Wolff et al. Science 247:1465, 1990). Other non-viral methods for gene transfer include in vitro transfection using calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Liposomes may also be useful for delivering nucleic acid molecules into mammalian cells. Transplanting normal genes into affected tissues of a subject may also be accomplished by transferring normal nucleic acids ex vivo into culturable cell types (e.g., autologous or allogeneic primary cells or their progeny), followed by injection of the cells (or their progeny) into target tissues or systemic injection.

[0270] Targeted integration

[0271] Targeted integration (TI) allows the integration of exogenous nucleotide sequences into a predetermined site in the genome of mammalian cells.

[0272] In certain embodiments of the subject matter of the invention disclosed herein, the use of TI host cells to introduce exogenous nucleic acids encoding target heterologous polypeptides or proteins will provide robust, stable cell culture performance and a lower risk of unwanted secondary modifications in the resulting target recombinant product. TI host cells and strategies for their use are described in detail in US2021 / 0002669, the contents of which are incorporated by reference in their entirety.

[0273] In certain embodiments of the inventive subject matter disclosed herein, an exogenous nucleotide sequence encoding a heterologous polypeptide or protein is integrated at a site within a specific locus of the genome of a TI host cell using targeted integration. In certain embodiments of the inventive subject matter disclosed herein, the locus into which the exogenous nucleotide sequence encoding a heterologous polypeptide or protein is integrated is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to a sequence selected from the group consisting of Contig NW_006874047.1, NW_006884592.1, NW_006881296.1, NW_003616412.1, NW_003615063.1, NW_006882936.1, and NW_003615411.1.

[0274] In certain embodiments of the inventive subject matter disclosed herein, the nucleotide sequence immediately 5' to the integrated exogenous sequence encoding a heterologous polypeptide or protein is selected from the group consisting of 63590-207911, nucleotides 253831-491909 of NW_006881296.1, nucleotides 69303-79768 of NW_003616412.1, nucleotides 293481-315265 of NW_003615063.1, nucleotides 2650443-2662054 of NW_006882936.1, or nucleotides 82214-97705 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments of the inventive subject matter disclosed herein, the nucleotide sequence immediately 5' to the integrated exogenous sequence encoding the heterologous polypeptide or protein is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to nucleotides 41190-45269 of NW_006874047.1, nucleotides 635-64 of NW_006884592.1, 90-207911, nucleotides 253831-491909 of NW_006881296.1, nucleotides 69303-79768 of NW_003616412.1, nucleotides 293481-315265 of NW_003615063.1, nucleotides 2650443-2662054 of NW_006882936.1, or nucleotides 82214-97705 of NW_003615411.1.

[0275] In certain embodiments of the inventive subject matter disclosed herein, the nucleotide sequence immediately 3' to the integrated exogenous sequence encoding the heterologous polypeptide or protein is selected from the group consisting of nucleotides 45270-45490 of NW_006874047.1, nucleotides 207912-792374 of NW_006884592.1, nucleotides 491910-69197 of NW_006881296.1, 67813, nucleotides 79769-100059 of NW_003616412.1, nucleotides 315266-362442 of NW_003615063.1, nucleotides 2662055-2701768 of NW_006882936.1, or nucleotides 97706-105117 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments of the inventive subject matter disclosed herein, the nucleotide sequence immediately 3' to the integrated exogenous sequence encoding the heterologous polypeptide or protein is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to nucleotides 45270-45490 of NW_006874047.1, nucleotides 20791-20792 of NW_006884592.1, 2-792374, nucleotides 491910-667813 of NW_006881296.1, nucleotides 79769-100059 of NW_003616412.1, nucleotides 315266-362442 of NW_003615063.1, nucleotides 2662055-2701768 of NW_006882936.1, or nucleotides 97706-105117 of NW_003615411.1.

[0276] In certain embodiments of the inventive subject matter disclosed herein, the integrated exogenous sequence encoding a heterologous polypeptide or protein is flanked at the 5' end by a nucleotide sequence selected from the group consisting of nucleotides 41190-45269 of NW_006874047.1, nucleotides 63590-207911 of NW_006884592.1, nucleotides 253831 of NW_006881296.1, -491909, nucleotides 69303-79768 of NW_003616412.1, nucleotides 293481-315265 of NW_003615063.1, nucleotides 2650443-2662054 of NW_006882936.1 and nucleotides 82214-97705 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments of the inventive subject matter disclosed herein, the integrated exogenous sequence encoding a heterologous polypeptide or protein is flanked at the 3' end by a nucleotide sequence selected from the group consisting of nucleotides 45270-45490 of NW_006874047.1, nucleotides 207912-792374 of NW_006884592.1, nucleotides 491910-492375 of NW_006881296.1, 667813, nucleotides 79769-100059 of NW_003616412.1, nucleotides 315266-362442 of NW_003615063.1, nucleotides 2662055-2701768 of NW_006882936.1 and nucleotides 97706-105117 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments of the inventive subject matter disclosed herein, the nucleotide sequence flanking the 5' end of the integrated exogenous nucleotide sequence encoding the heterologous polypeptide or protein is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to nucleotides 41190-45269 of NW_006874047.1, nucleotides 63 of NW_006884592.1, 590-207911, nucleotides 253831-491909 of NW_006881296.1, nucleotides 69303-79768 of NW_003616412.1, nucleotides 293481-315265 of NW_003615063.1, nucleotides 2650443-2662054 of NW_006882936.1 and nucleotides 82214-97705 of NW_003615411.1.In certain embodiments of the inventive subject matter disclosed herein, the nucleotide sequence flanking the 3' end of the integrated exogenous nucleotide sequence encoding the heterologous polypeptide or protein is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to nucleotides 45270-45490 of NW_006874047.1, nucleotides 2079 of NW_006884592.1. 12-792374, nucleotides 491910-667813 of NW_006881296.1, nucleotides 79769-100059 of NW_003616412.1, nucleotides 315266-362442 of NW_003615063.1, nucleotides 2662055-2701768 of NW_006882936.1, and nucleotides 97706-105117 of NW_003615411.1.

[0277] In certain embodiments of the inventive subject matter disclosed herein, the integrated exogenous nucleotide sequence encoding a heterologous polypeptide or protein is operably linked to a nucleotide sequence selected from the group consisting of: Contigs NW_006874047.1, NW_006884592.1, NW_006881296.1, NW_003616412.1, NW_003615063.1, NW_006882936.1, and NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments of the inventive subject matter disclosed herein, the nucleotide sequence operably linked to the exogenous nucleotide sequence encoding the heterologous polypeptide or protein is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to a sequence selected from the group consisting of: Contig NW_006874047.1, NW_006884592.1, NW_006881296.1, NW_003616412.1, NW_003615063.1, NW_006882936.1, and NW_003615411.1.

[0278] In targeted integration, site-specific recombination is used to introduce exogenous nucleic acids into specific loci in the genome of mammalian TI host cells. This is an enzymatic process in which the sequence at the integration site in the genome is exchanged for exogenous nucleic acids. One system for achieving such nucleic acid exchange is the Cre-lox system. The enzyme that catalyzes the exchange is the Cre recombinase. The sequence to be exchanged is defined by the position of two lox (P) sites in the genome and the exogenous nucleic acid. These lox (P) sites are recognized by the Cre recombinase. No more is needed, i.e. no ATP, etc. The Cre-lox system was originally discovered in bacteriophage P1.

[0279] In certain embodiments of all aspects and embodiments of the inventive subject matter disclosed herein, a cell modified according to the inventive subject matter has been subjected to targeted integration of a nucleic acid encoding a heterologous polypeptide or protein of interest prior to modification according to the disclosed subject matter.

[0280] In certain embodiments of all aspects and embodiments of the inventive subject matter, a cell modified according to the inventive subject matter has been subjected to targeted integration of a nucleic acid encoding a heterologous polypeptide or protein of interest following modification according to the inventive subject matter.

[0281] In certain embodiments of all aspects and embodiments of the present subject matter, targeted integration is mediated by a recombinase that recognizes one or more recombination recognition sequences (RRS) present in the genome of the mammalian cell and in the exogenous nucleotide sequence encoding the heterologous polypeptide or protein to be integrated into the genome of the mammalian cell.

[0282] In certain embodiments of all aspects and embodiments of the inventive subject matter, the targeted integration is mediated by homologous recombination.

[0283] A "recombination recognition sequence" (RRS) is a nucleotide sequence that is recognized by a recombinase and is necessary and sufficient for a recombinase-mediated recombination event. An RRS can be used to define the position in a nucleotide sequence where a recombination event will occur.

[0284] In certain embodiments of all aspects and embodiments of the inventive subject matter, the RRS is recognized by the Cre recombinase.

[0285] In certain embodiments of all aspects and embodiments of the inventive subject matter, the RRS is a LoxP site and the Cre recombinase mediates targeted integration by recombination.

[0286] In certain embodiments of all aspects and embodiments of the inventive subject matter, the RRS is recognized by the FLP recombinase.

[0287] In certain embodiments of all aspects and embodiments of the inventive subject matter, the RRS is a FRT site and the FLP recombinase mediates targeted integration by recombination.

[0288] In certain embodiments of all aspects and embodiments of the inventive subject matter, the RRS is recognized by the Bxb1 integrase.

[0289] In certain embodiments of all aspects and embodiments of the inventive subject matter, the RRS is a Bxb1 attP or Bxb1attB site and the Bxb1 integrase mediates targeted integration by recombination.

[0290] In certain embodiments of all aspects and embodiments of the inventive subject matter, the RRS is comprised of Integrase recognition.

[0291] In certain embodiments of all aspects and embodiments of the present subject matter, the RRS is attP or attB site and Integrases mediate targeted integration via recombination.

[0292] Recombinant enzymes can be introduced into cells using expression vectors containing the coding sequence or mRNA for the enzyme either as a protein.

[0293] With regard to TI, any known or future mammalian cell comprising a landing site as described herein integrated at a single site within a locus of the genome (including those modified according to the subject matter of the present invention) can be used for the subject matter of the present invention. Such cells are denoted mammalian TI host cells.

[0294] In certain embodiments of all aspects and embodiments of the subject matter of the present invention, the mammalian TI host cell is a hamster cell, a human cell, a rat cell, or a mouse cell comprising a landing site as described herein. In a preferred embodiment of the subject matter of the present invention disclosed herein, the mammalian TI host cell is a CHO cell. In certain embodiments of the subject matter of the present invention disclosed herein, the mammalian TI CHO host cell is a CHO K1 cell, a CHO K1SV cell, a CHO DG44 cell, a CHO DUKXB-11 cell, a CHO K1S cell, or a CHO K1M cell comprising a landing site as described herein integrated at a single site within a locus of the genome.

[0295] In certain embodiments of all aspects and embodiments of the subject matter of the invention, the mammalian TI host cell comprises an integration landing site, wherein the landing site comprises one or more recombination recognition sequences (RRS). The RRS can be expressed by a recombinase (e.g., Cre recombinase, FLP recombinase, Bxb1 integrase, or The one or more RRSs can be independently selected from the group consisting of: LoxP sequence, LoxP L3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence and attB sequence. If multiple RRSs must be present, the selection of each of these sequences depends on the other sequence within the limits of selecting a different RRS.

[0296] In certain embodiments of all aspects and embodiments of the subject matter of the present invention, the landing site includes one or more recombination recognition sequences (RRS), wherein the RRS can be recognized by a recombinase. In certain embodiments of the subject matter of the invention disclosed herein, the integrated landing site includes at least two RRS. In certain embodiments of the subject matter of the invention disclosed herein, the integrated landing site includes three RRS, wherein the third RRS is located between the first RRS and the second RRS. In certain preferred embodiments of the subject matter of the invention disclosed herein, all three RRS are different. In certain embodiments of the subject matter of the invention disclosed herein, the landing site includes the first RRS, the second RRS and the third RRS, and at least one selection marker between the first RRS and the second RRS, and the third RRS is different from the first RRS and / or the second RRS. In certain embodiments of the subject matter of the invention disclosed herein, the landing site further includes a second selection marker, and the first selection marker and the second selection marker are different. In certain embodiments of the subject matter of the invention disclosed herein, the landing site further includes a third selection marker and an internal ribosome entry site (IRES), wherein IRES is operably connected to the third selection marker. The third selection marker may be different from the first selection marker or the second selection marker.

[0297] An exemplary mammalian TI host cell suitable for modification according to the subject matter of the present invention and for use in the methods according to the subject matter of the present invention is a CHO cell, which carries a landing site integrated at a single site within a locus in its genome, wherein the landing site contains three heterologous-specific loxP sites for Cre recombinase-mediated DNA recombination.

[0298] In this example, the heterologous specific loxP sites are L3, LoxFas and 2L (see, e.g., Lanza et al., Biotechnol. J. 7 (2012) 898-908; Wong et al., Nucleic Acids Res. 33 (2005) e147), whereby L3 and 2L flank the landing site at the 5' and 3' ends, respectively, and LoxFas is located between the L3 site and the 2L site. The landing site also comprises a bicistronic unit that links the expression of the selection marker to the expression of the fluorescent GFP protein via an IRES, thereby allowing for the stabilization of the landing site by positive selection, as well as selection for the absence of the site after transfection and Cre recombination (negative selection). Green fluorescent protein (GFP) is used to monitor the RMCE reaction.

[0299] This configuration of the landing site as outlined in the previous paragraph allows the simultaneous integration of two vectors, for example a so-called front vector carrying L3 and LoxFas sites, and a back vector comprising LoxFas and 2L sites. The functional elements of a selectable marker gene different from the one present in the landing site can be distributed between the two vectors: the promoter and the start codon can be located on the front vector, while the coding region and the poly A signal are located on the back vector. Only the correct recombinase-mediated integration of the nucleic acids from both vectors induces resistance to the corresponding selection agent.

[0300] Generally speaking, a mammalian TI host cell is a mammalian cell that comprises a landing site integrated at a single site within a locus of the mammalian cell genome, wherein the landing site comprises a first recombination recognition sequence and a second recombination recognition sequence flanked by at least one first selection marker, and a third recombination recognition sequence located between the first recombination recognition sequence and the second recombination recognition sequence, and all recombination recognition sequences are different.

[0301] The selectable marker can be selected from the group comprising aminoglycoside phosphotransferase (APH) (e.g., hygromycin phosphotransferase (HYG), neomycin and G418 APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthetase (indole), histidinol dehydrogenase (histidinol D), and genes encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, Zeocin and mycophenolic acid. The selection marker can also be a fluorescent protein selected from the group comprising green fluorescent protein (GFP), enhanced GFP (eGFP), synthetic GFP, yellow fluorescent protein (YFP), enhanced YFP (eYFP), cyan fluorescent protein (CFP), mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald6, CyPet, mCFPm, Cerulean and T-Sapphire.

[0302] An exogenous nucleotide sequence is a nucleotide sequence that is not derived from a specific cell, but can be introduced into the cell by a DNA delivery method (such as, by a transfection method, an electroporation method, or a transformation method). In certain embodiments of the subject matter of the invention disclosed herein, the mammalian TI host cell comprises at least one landing site integrated at one or more integration sites in the genome of the mammalian cell. In certain embodiments of the subject matter of the invention disclosed herein, the landing site is integrated at one or more integration sites within a specific locus of the genome of the mammalian cell.

[0303] In certain embodiments of all aspects and embodiments of the subject matter of the present invention, the integrated landing site includes at least one selection marker. In certain embodiments of the subject matter of the invention disclosed herein, the integrated landing site includes the first RRS, the second RRS and the third RRS, and at least one selection marker. In certain embodiments, the selection marker is located between the first RRS and the second RRS. In certain embodiments of the subject matter of the invention disclosed herein, two RRSs are flanked by at least one selection marker, that is, the first RRS is located at the 5' (upstream) of the selection marker and the second RRS is located at the 3' (downstream) of the selection marker. In certain embodiments of the subject matter of the invention disclosed herein, the first RRS is adjacent to the 5' end of the selection marker, and the second RRS is adjacent to the 3' end of the selection marker. In certain embodiments, the landing site includes the first RRS, the second RRS and the third RRS, and at least one selection marker between the first RRS and the third RRS.

[0304] In certain embodiments according to all aspects and embodiments of the subject matter of the present invention, the selection marker is located between the first RRS and the second RRS, and the two flanking RRS are different. In certain preferred embodiments of the subject matter of the invention disclosed herein, the first flanking RRS is a LoxP L3 sequence and the second flanking RRS is a LoxP 2L sequence. In certain embodiments of the subject matter of the invention disclosed herein, the LoxP L3 sequence is located at the 5' end of the selection marker and the LoxP 2L sequence is located at the 3' end of the selection marker. In certain embodiments of the subject matter of the invention disclosed herein, the first flanking RRS is a wild-type FRT sequence and the second flanking RRS is a mutant FRT sequence. In certain embodiments of the subject matter of the invention disclosed herein, the first flanking RRS is a Bxb1 attP sequence and the second flanking RRS is a Bxb1attB sequence.

[0305] In certain embodiments of the inventive subject matter disclosed herein, the first flanking RRS is attP sequence, and the second flanking RRS is attB sequence. In certain embodiments of the subject matter of the invention disclosed herein, the two RRS are positioned in the same direction. In certain embodiments of the subject matter of the invention disclosed herein, the two RRS are both in the forward direction or the reverse direction. In certain embodiments of the subject matter of the invention disclosed herein, the two RRS are positioned in opposite directions.

[0306] In certain embodiments according to all aspects and embodiments of the subject matter of the present invention, the integrated landing site comprises a first selection marker and a second selection marker flanked by two RRS, wherein the first selection marker is different from the second selection marker. In certain embodiments of the subject matter of the invention disclosed herein, both selection markers are independently selected from the group consisting of: glutamine synthetase selection marker, thymidine kinase selection marker, HYG selection marker and puromycin resistance selection marker. In certain embodiments of the subject matter of the invention disclosed herein, the integrated landing site comprises a thymidine kinase selection marker and a HYG selection marker. In certain embodiments of the inventive subject matter disclosed herein, the first selection marker is selected from the group consisting of aminoglycoside phosphotransferase (APH) (e.g., hygromycin phosphotransferase (HYG), neomycin and G418 APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthetase (indole), histidinol dehydrogenase (histidinol D), and genes encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, Zeocin and mycophenolic acid, and the second selection marker is selected from the group consisting of GFP, eGFP, synthetic GFP, YFP, eYFP, CFP, mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, mCFPm, Cerulean and T-Sapphire fluorescent protein. In certain embodiments of the inventive subject matter disclosed herein, the first selection marker is a glutamine synthetase selection marker and the second selection marker is a GFP fluorescent protein. In certain embodiments of the inventive subject matter disclosed herein, the two RRS flanking the two selection markers are different.

[0307] In certain embodiments of the subject matter of the invention disclosed herein, the selection marker is operably linked to a promoter sequence. In certain embodiments of the subject matter of the invention disclosed herein, the selection marker is operably linked to an SV40 promoter. In certain embodiments of the subject matter of the invention disclosed herein, the selection marker is operably linked to a human cytomegalovirus (CMV) promoter.

[0308] The Cre-lox system operates in different cell types, such as mammals, plants, bacteria, and yeast.

[0309] In certain embodiments according to all aspects and embodiments of the subject matter of the present invention, the exogenous nucleic acid encoding the heterologous polypeptide or protein has been integrated into the mammalian TI host cell by single or double recombinase-mediated cassette exchange (RMCE), thereby obtaining a recombinant mammalian cell, such as a recombinant CHO cell, in which the defined and specific expression cassette sequence has been integrated into a single locus of the genome, thereby resulting in the efficient expression and production of the heterologous polypeptide.

[0310] The Cre-LoxP site-specific recombination system has been widely used in many biological experimental systems. Cre recombinase is a 38-kDa site-specific DNA recombinase that recognizes a 34bp LoxP sequence. Cre recombinase is derived from bacteriophage P1 and belongs to the tyrosine family site-specific recombinase. Cre recombinase can mediate intramolecular and intermolecular recombination between LoxP sequences. The LoxP sequence consists of an 8bp non-palindromic core region and two 13bp inverted repeat sequences flanked by it. Cre recombinase binds to the 13bp repeat sequence, thereby mediating the recombination within the 8bp core region. Cre-LoxP-mediated recombination occurs with high efficiency and does not require any other host factors. If two LoxP sequences are placed in the same nucleotide sequence in the same orientation, the Cre recombinase-mediated recombination will excise the DNA sequence between the two LoxP sequences to form a covalent closed loop. If two LoxP sequences are placed in the same nucleotide sequence in an inverted position, the Cre recombinase-mediated recombination will reverse the orientation of the DNA sequence between the two sequences. If the two LoxP sequences are on two different DNA molecules, and if one DNA molecule is a circular molecule, Cre recombinase-mediated recombination will result in the integration of the circular DNA sequence.

[0311] The term "matching RRS" means that recombination has occurred between the two RRSs. In certain embodiments of the inventive subject matter disclosed herein, the two matching RRSs are identical. In certain embodiments of the inventive subject matter disclosed herein, both RRSs are wild-type LoxP sequences. In certain embodiments of the inventive subject matter disclosed herein, both RRSs are mutated LoxP sequences. In certain embodiments of the inventive subject matter disclosed herein, both RRSs are wild-type FRT sequences. In certain embodiments of the inventive subject matter disclosed herein, both RRSs are mutated FRT sequences. In certain embodiments of the inventive subject matter disclosed herein, the two matching RRSs are different sequences but can be recognized by the same recombinase. In certain embodiments of the inventive subject matter disclosed herein, the first matching RRS is a Bxb1 attP sequence, and the second matching RRS is a Bxb1 attB sequence. In certain embodiments of the inventive subject matter disclosed herein, the first matching RRS is attB sequence, and the second matching RRS is attB sequence.

[0312] When a dual vector combination is used, a "dual plasmid RMCE" strategy or "dual RMCE" is adopted in the method according to the subject matter of the present invention. For example, but not by way of limitation, the landing site of integration can contain three RRSs, such as the following arrangement: wherein the third RRS ("RRS3") is present between the first RRS ("RRS1") and the second RRS ("RRS2"), and the first vector contains two RRSs that match the first RRS and the third RRS on the integrated exogenous nucleotide sequence, and the second vector contains two RRSs that match the third RRS and the second RRS on the integrated exogenous nucleotide sequence.

[0313] The dual-plasmid RMCE strategy involves the use of three RRS sites to implement two independent RMCEs simultaneously. Therefore, the landing site in mammalian TI host cells using the dual-plasmid RMCE strategy includes a third RRS site (RRS3) that has no cross-activity with the first RRS site (RRS1) or the second RRS site (RRS2). The two plasmids to be targeted require the same flanking RRS sites for efficient targeting, with one plasmid (front) flanked by RRS1 and RRS3, and the other expression plasmid (rear) flanked by RRS3 and RRS2. Two selection markers are also required in this dual-plasmid RMCE. A selection marker expression cassette is divided into two parts. The front plasmid will contain a promoter, followed by a start codon and an RRS3 sequence. The rear plasmid will have an RRS3 sequence fused to the N-terminus of the selection marker coding region minus the start codon (ATG). It may be necessary to insert additional nucleotides between the RRS3 site and the selection marker sequence to ensure that the fusion protein undergoes in-frame translation (i.e., an operable connection). Only if both plasmids have been correctly inserted, will the complete expression cassette for the selection marker be assembled and thus render the cells resistant to the corresponding selection agent.

[0314] Double plasmid RMCE involves a double recombination crossover event between two heterologous specific RRSs within the target genomic locus and a donor DNA molecule, which is catalyzed by a recombinase. Double plasmid RMCE is designed to introduce copies of DNA sequences from the combined front vector and back vector into a predetermined locus of the mammalian TI host cell genome. RMCE can be implemented so that the prokaryotic vector sequence is not introduced into the genome of the mammalian TI host cell, thereby reducing and / or preventing unnecessary triggering of host immune or defense mechanisms. The RMCE procedure can be repeated with multiple DNA sequences.

[0315] In certain embodiments according to all aspects and embodiments of the present invention, targeted integration is achieved by two RMCEs, wherein two different DNA sequences are integrated into a predetermined site of the genome of a mammalian TI host cell that matches the RRS, each DNA sequence comprising at least one expression cassette encoding a portion of a heterologous multimeric polypeptide and / or at least one selection marker or portion thereof flanking two heterospecific RRSs. In certain embodiments of the subject matter of the invention disclosed herein, targeted integration is achieved by multiple RMCEs, wherein DNA sequences from multiple vectors are all integrated into a predetermined site of the genome of a mammalian TI host cell, each DNA sequence comprising at least one expression cassette encoding a portion of a heterologous multimeric polypeptide and / or at least one selection marker or portion thereof flanking two heterospecific RRSs. In certain embodiments of the subject matter of the invention disclosed herein, the selection marker may be partially encoded on a first vector and partially encoded on a second vector, such that only the correct integration of both by double RMCE allows the expression of the selection marker.

[0316] It must be noted that in certain embodiments of the inventive subject matter disclosed herein, the reduction of transcriptional activity (e.g., by knockout) can be performed in stably transfected clones or a pool of stably transfected clones before the introduction of exogenous nucleic acids encoding heterologous polypeptides or proteins, and also afterwards.

[0317] Specific embodiments of the compositions and methods according to the present invention

[0318] The presence of hydroxylated lysine residues in recombinantly produced heterologous product proteins requires laborious and time-consuming evaluation and monitoring of biological activity, pharmacokinetics, immunogenicity, and safety.

[0319] It has been found that in recombinantly produced antibodies the modification of lysine to hydroxylysine occurs to varying degrees at different lysine residues, ie also at lysine residues that are not part of the Xaa-Lys-Gly consensus sequence.

[0320] This has been demonstrated for three trivalent bispecific antibodies (TCB format) with different binding specificities. The corresponding results are shown in the table below.

[0321]

[0322]

[0323] It has now been discovered that the formation of hydroxylysine is based on the action of procollagen-lysine, 2-oxoglutarate 5-dioxygenase.

[0324] The term "procollagen-lysine, 2-oxoglutarate 5-dioxygenase" means a protein with enzymatic activity, which is encoded by the nucleic acid sequence of the PLOD gene or a nucleic acid sequence homologous thereto. The term also encompasses proteins derived from the complete mRNA sequence of PLOD or its splice variants, such as, for example, for PLOD2 LH2a and LH2b. The present invention also encompasses knockouts of PLOD2 variants, which differ, for example, in the nucleotide sequence or even amino acid sequence of the encoded protein, as long as the protein catalyzes the hydroxylation of lysine residues. Due to the degeneracy of the genetic code, a variety of different polynucleotide sequences can encode "procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2". However, only a single one of them is present in the genome.

[0325] PLOD is located in the rough ER. These enzymes are responsible for lysine hydroxylation. These enzymes require the cofactor Fe 2+ , ascorbic acid, and α-ketoglutarate (αKG). Oxidative decomposition of αKG forms CO2 plus succinate and leads to the generation of Fe(IV)-oxo or other reactive oxygen species, which hydroxylate the primary substrate. The complex composed of PLOD1, P3H3, and P3H4 catalyzes the hydroxylation of lysine residues in the α-chain of collagen and is required for the normal assembly and cross-linking of collagen fibrils.

[0326] PLOD2 has been reported by Ruotsalainen, H. et al. (Matrix Biol. 18 (1999) 325-329 and 20 (2001) 137-146) and Valtavaara, M. et al. (J. Biol. Chem. 272 ​​(1997) 6831-6834). The existence of splice variants was reported by Yeowell and Walker in particular (Matrix Biol. 18 (1999) 179-187).

[0327] Three genes encoding "procollagen-lysine, 2-oxoglutarate 5-dioxygenase" (PLOD) have been identified: PLOD1, PLOD2, and PLOD3. The protein shows enzymatic activity against synthetic peptides ARGIKGIRGFS (SEQ ID NO: 51), GIKGIKGIKGIK (SEQ ID NO: 52), and IKGIKGIKG (SEQ ID NO: 53) (Scietti, L. et al., Nat. Comm. 9 (2018) 3136). The detailed substrate specificity is still unclear. See further Valtavaara, M. et al., J. Biol. Chem. 272 ​​(1997) 6831-6834 and 273 (1998) 12881-12886; Passoja, K. et al., Proc. Natl. Acad. Sci. USA 95 (1998) 10482-10486; and Scietti, L. et al., Nat. Comm. 9 (2018) 3136.

[0328] PLOD1 and PLOD3 genes contain 19 exons, in which the intron / exon boundaries are identical. The PLOD2 gene is highly homologous to PLOD1 and PLOD3. However, compared to PLOD1 and PLOD3, it contains an extra exon between exon 13 and exon 14, which is represented as exon 13A. For PLOD2, two splice variants (LH2a and LH2b) can be expressed, in which LH2b differs from LH2a in that exon 13A is incorporated.

[0329] The inventive subject matter disclosed herein is based, at least in part, on the discovery that knockout of the PLOD gene reduces levels of / eliminates formation of hydroxylysine in recombinantly produced heterologous proteins.

[0330] The subject matter of the invention disclosed herein is based at least in part on the discovery that knockout of the PLOD gene does not affect the overall cell culture performance of the corresponding modified cells. It has been found that the PLOD knockout cell line has a higher biomass formation capacity during culture and thus has a higher recombinant protein titer than cells of the same genotype except that the PLOD is knocked out.

[0331] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knockout of the PLOD gene does not affect other protein quality attributes. It has been found that CE-SDS and SEC evaluations show comparable or even increased levels of the main peak and comparable or even reduced levels of side products.

[0332] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knockout of the PLOD gene reduces filterability problems. Without being bound by this theory, it is hypothesized that this is due to the fact that collagen can no longer be cross-linked, especially when CHO cells express many collagen genes at high levels. It has been found that by reducing the increase in filter pressure, filterability is at least comparable or even improved.

[0333] The subject matter of the invention disclosed herein is based, at least in part, on the discovery that knockout of the PLOD gene reduces cell aggregation during culture. Without being bound by this theory, it is hypothesized that due to the reduction / absence of cross-linked collagen, trans-binding of different CHO cells via integrin α1β1 cannot be mediated.

[0334] The absence of PLOD enzymatic activity can be achieved by inactivation of specific gene products, for example via CRISPR / Cas-based gene knockout, zinc finger nuclease-based knockout, etc. The inactivation / absence of enzymatic activity introduced into the host cell allows for subsequent use in different projects. However, unexpectedly, no off-target effects and possible interference with other important cell performances (e.g., cell growth and productivity) or quality attributes were found.

[0335] This has shown that for the same three trivalent bispecific antibodies with different binding specificities, the formation of hydroxylated lysine can be reduced by applying the method according to the invention. At the same time, the titers obtained are also increased. The corresponding results are shown in the table below.

[0336]

[0337]

[0338]

[0339] Antibody PLOD knockout Titer [μg / mL] 1 no 5691 yes 5856 2 no 3990 yes 4796 3 no 4396 yes 4587

[0340] As the titer increased, the viable cell density also increased after the introduction of the PLOD knockout. Figures 1 to 3 The integral of the viable cell density over time (IVCD) for antibodies 1 to 3 shows this increase.

[0341] As the titer and viable cell density increase, filterability also improves, i.e. the final pressure in the filtration decreases. This is shown in the following table and Figure 4 The data presented in Figure 2 are shown (data are normalized to the corresponding produced biomass (IVCD)).

[0342]

[0343] As titer and viable cell density increased and filterability improved, as determined by size exclusion chromatography (SEC), product content also improved. This is shown in the table below.

[0344] Antibody PLOD knockout Monomer (SEC) [%] LMW (SEC) [%] HMW(SEC)[%] 1 no 80 14 6 yes 83 12.5 4.5 2 no 86 10 4 yes 86 9 5 3 no 75 20 5 yes 77 19 4

[0345] ***LMW: low molecular weight substance content; HMW: high molecular weight substance content

[0346] The following examples, sequences and figures are provided to aid the understanding of the present invention, the true scope of which is set forth in the appended claims. It should be understood that modifications may be made to the procedures set forth without departing from the spirit of the present invention.

[0347] Sequence Description

[0348] SEQ ID NO:01: Exemplary sequence of L3 recombinase recognition sequence: AAGTCTCC

[0349] SEQ ID NO:02: Exemplary sequence of 2L recombinase recognition sequence: GCATACAT

[0350] SEQ ID NO: 03: Exemplary sequence of LoxFas recombinase recognition sequence: TACCTTTC

[0351] SEQ ID NO:04-06: Exemplary variants of the human CMV promoter:

[0352] SEQ ID NO:04:

[0353] GTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAGCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCCGTTTAGTGAACGTCAGATC

[0354] SEQ ID NO:05:

[0355] GTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAGCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCCGTTTAGTGAACGTCAGATCTAGCTCTGGGAGAGGAGCCCAGCACTAGAAGTCGGCGGTGTTTCCATTCGGTGATCAGCACTGAACACAGAGGAAGCTTGCCGCCACC

[0356] SEQ ID NO:06:

[0357]

[0358] SEQ ID NO:07: Exemplary SV40 polyadenylation signal sequence:

[0359] AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCAAAATAAAGCATTTTTTTCACCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTG

[0360] SEQ ID NO:08: Exemplary bGH polyadenylation signal sequence:

[0361] TTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG

[0362] SEQ ID NO:09: Exemplary hGT terminator sequence:

[0363] CAGGATAATATATGGTAGGGTTCATAGCCAGAGTAACCTTTTTTTTTAATTTTTATTTTATTTTATTTTT GAG

[0364] SEQ ID NO: 10: Exemplary SV40 promoter sequence:

[0365] AGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCG

[0366] SEQ ID NO:11: Exemplary GFP nucleic acid sequence:

[0367] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCCACCGGATCTAGATGA

[0368] SEQ ID NO:12-14: SIRT-1 guide RNA

[0369] SEQ ID NO:12 : gRNA_SIRT1_1: TATCATCCAACTCAGGTGGA

[0370] SEQ ID NO:13 : gRNA_SIRT1_2: GCAGCATCTCATGATTGGCA

[0371] SEQ ID NO:14 :gRNA_SIRT1_3:GCATTCTTGAAGTAACTTCA

[0372] SEQ ID NO:15-16: SIRT-1 PCR primers

[0373] SEQ ID NO:15 :SIRT1_Forward:ATGGCAGTTTTAGACACC

[0374] SEQ ID NO:16 :SIRT1_Reverse: CTTGGAACTCAGACAAGG

[0375] SEQ ID NO: 17-19: MYC guide RNA

[0376] SEQ ID NO:17 :gRNA_MYC_1:CTATGACCTCGACTACGACT

[0377] SEQ ID NO:18 :gRNA_MYC_2:GGACGCAGCGACCGTCACAT

[0378] SEQ ID NO:19 :gRNA_MYC_3:CACCATCTCCAGCTGATCCG

[0379] SEQ ID NO:20-21: MYC PCR primers

[0380] SEQ ID NO:20 :MYC_Forward:CACACACACACTTGGAAG

[0381] SEQ ID NO:21 :MYC_Reverse:CTTGATGAAGGTCTCGTC

[0382] SEQ ID NO:22-25: ICAM-1 guide RNA

[0383] SEQ ID NO:22 :gRNA_ICAM1_1:ACCTGCATGGATGCACCCCG

[0384] SEQ ID NO:23 :gRNA_ICAM1_2:GCACCGTGCCCACCTCCAGG

[0385] SEQ ID NO:24 :gRNA_ICAM1_3:TAACCGCCAGAGAAAGATC

[0386] SEQ ID NO:25 :gRNA_ICAM1_4:ACCTGCATGGATGCACCCCG

[0387] SEQ ID NO:26-27: ICAM-1 PCR primers

[0388] SEQ ID NO:26 :ICAM1_Forward:CCAAGCTAGATGATGTGAG

[0389] SEQ ID NO:27 :ICAM1_Reverse:GCCCTACCCTTTTAATAC

[0390] SEQ ID NO:28-32: BAK guide RNA

[0391] SEQ ID NO:28 :gRNA_BAK_1:TACAGCATCTTGGGTCAGGT

[0392] SEQ ID NO:29 :gRNA_BAK_2:GTCCATCTCGGGGTTGGCAG

[0393] SEQ ID NO:30 :gRNA_BAK_3:AATCTTGGTGAAGAGTTCGT

[0394] SEQ ID NO:31 :gRNA_BAK_4:TCATCACAGTCCTGCCTAGG

[0395] SEQ ID NO:32 :gRNA_BAK_5:ATGGCGTCTGGACAAGGACC

[0396] SEQ ID NO:33-34: BAK PCR Primers

[0397] SEQ ID NO:33 :BAK_Forward:CGTATCTGAGTTCACGAAC

[0398] SEQ ID NO:34 :BAK_Reverse:CCATCAGGAACAAGAGAC

[0399] SEQ ID NO:35-39: BAX guide RNA

[0400] SEQ ID NO:35 :gRNA_BAX_1:ACAGGGGCCTTTTTGCTACA

[0401] SEQ ID NO:36: gRNA_BAX_2: GCTCATCTCCAATTCGCCTG

[0402] SEQ ID NO:37 : gRNA_BAX_3: ACGAGAGGTCTTCTTCCGTG

[0403] SEQ ID NO:38 : gRNA_BAX_4: GGGTCGGGGGAGCAGCTCGG

[0404] SEQ ID NO:39 : gRNA_BAX_5: GGGTCCCGAAGTATGAGAGG

[0405] SEQ ID NO:40 - 41: BAX PCR primers

[0406] SEQ ID NO:40 : BAX_Forward: ATCTTGTCTCCCTCGTAG

[0407] SEQ ID NO:41 : BAX_Reverse: TCCTGGACTTCTCTAACC

[0408] SEQ ID NO:42 - 44: PLOD1 guide RNA

[0409] SEQ ID NO:42 : gRNA_PLOD1_1: TAAGAGTTCCCGGGGCCCCG

[0410] SEQ ID NO:43 : gRNA_PLOD1_2: AACTCATCTACCCCGACCGG

[0411] SEQ ID NO:44 : gRNA_PLOD1_3: CGCTTGCCATCAGACACCGT

[0412] SEQ ID NO:45 - 47: PLOD2 guide RNA

[0413] SEQ ID NO:45 : gRNA_PLOD2_1: GTGGCCGGATAAGCGACTCG

[0414] SEQ ID NO:46 : gRNA_PLOD2_2: GTTTACCAATGTGCACTACA

[0415] SEQ ID NO:47 : gRNA_PLOD2_3: AAACGCTACCTGAATTCTGG

[0416] SEQ ID NO:48-50: PLOD3 guide RNA

[0417] SEQ ID NO:48 :gRNA_PLOD3_1:GATGTTGCTCGAACAGTTGG

[0418] SEQ ID NO:49 :gRNA_PLOD3_2:GGAGAAATATGCAAACCGGG

[0419] SEQ ID NO:50 :gRNA_PLOD3_3:CAAATTGCTGGTGATCACCG

[0420] SEQ ID NO:51-53: PLOD artificial substrate

[0421] SEQ ID NO:51 :ARGIKGIRGFS

[0422] SEQ ID NO:52 :GIKGIKGIKGIK

[0423] SEQ ID NO:53 :IKGIKGIKG

[0424] SEQ ID NO:54: HC(1) hydroxylation site-LTVLSSASTK(G)

[0425] SEQ ID NO:55: HC(2) Hydroxylation Site-LTVLSSASTKGPSVFPLAPSSK(S)

[0426] SEQ ID NO:56: HC(3) hydroxylation site-VTVSSASTK(G)

[0427] SEQ ID NO:57: HC(4) Hydroxylation Site-VTVSSASTKGPSVFPLAPSSK(S)

[0428] SEQ ID NO:58: HC(5) hydroxylation site-SSASTK(G)

[0429] SEQ ID NO:59: HC(6) Hydroxylation Site-SSASTKGPSVFPLAPSSK(S)

[0430] SEQ ID NO:60: HC-H Hydroxylation Site-NQVSLSCAVK(G)

[0431] SEQ ID NO:61: LC(2) Hydroxylation Site-LKSGTASVVCLLNNFYPR

[0432] SEQ ID NO:62: LC(3) Hydroxylation Site-DSTYSLSSTLTLSKADYEK(H)

[0433] SEQ ID NO:63: LC (3') Hydroxylation Site-DSTYSLSSTLTLSK (A)

[0434] SEQ ID NO:64: HC-K(1) hydroxylation site-SSASTK(G)

[0435] SEQ ID NO:65: HC-K(2) Hydroxylation Site-SSASTKGPSVFPLAPSSK(S)

[0436] SEQ ID NO:66: Background technology-WGQGTLVTVSSASTK BRIEF DESCRIPTION OF THE DRAWINGS

[0437] Figure 1 Integrated viable cell density over time (IVCD) of cells expressing Antibody 1 with (dark green) and without (light green) PLOD1-3 knockdown.

[0438] Figure 2 Integrated viable cell density over time (IVCD) of cells expressing Antibody 2 with (dark blue) and without (light blue) PLOD1-3 knockdown.

[0439] Figure 3 Integrated viable cell density over time (IVCD) of cells expressing Antibody 3 with (orange) and without (red) PLOD1-3 knockdown.

[0440] Figure 4 Variation of the final pressure in the filtration of preparations of antibodies 1 to 3 obtained with cells with or without PLOD1-3 inactivation (data normalized to the corresponding produced biomass (IVCD)).

[0441] Examples

[0442] Example 1 - General Technology

[0443] 1) Recombinant DNA technology

[0444] Standard methods were used to manipulate DNA, such as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, New York, (1989). Molecular biology reagents were used according to the manufacturers' instructions.

[0445] 2) DNA sequence determination

[0446] DNA sequencing was performed at SequiServe GmbH (Vaterstetten, Germany) or Eurofins Genomics GmbH (Ebersberg, Germany) or Microsynth AG (Balgach, Switzerland).

[0447] 3) DNA and protein sequence analysis and sequence data management

[0448] The EMBOSS (European Molecular Biology Open Software Suite) software package and Geneious prime 2021 (Auckland, New Zealand) were used for sequence creation, mapping, analysis, annotation, and illustration.

[0449] 4) Gene and oligonucleotide synthesis

[0450] The required gene fragments were prepared by chemical synthesis at Geneart GmbH (Regensburg, Germany) or Twist Bioscience (San Francisco, the United States). The synthesized gene fragments were cloned into E. coli plasmids for propagation / amplification. The DNA sequence of the subcloned gene fragments was verified by DNA sequencing. Alternatively, short synthetic DNA fragments were assembled by annealing chemically synthesized oligonucleotides or via PCR. Each oligonucleotide was prepared by metabion GmbH (Planegg-Martinsried, Germany).

[0451] 5) Reagents

[0452] If not stated otherwise, all commercial chemicals, antibodies, and kits were used according to the manufacturers' protocols.

[0453] 6) Cultivation of TI host cell lines

[0454] TI CHO host cells were cultured at 37°C in a humidified incubator with 85% humidity and 5% CO2. They were cultured in a proprietary DMEM / F12 medium containing 300 μg / ml hygromycin B and 4 μg / ml of a second selection marker. The cells were split every 3 or 4 days at a concentration of 0.3x10^6 cells / ml in a total volume of 30 ml. For the culture, a 125 ml unbaffled conical shake flask was used. The cells were shaken at a speed of 150 rpm with an oscillation amplitude of 5 cm. Cell counts were determined using a Cedex HiRes CellCounter (Roche). The cells were kept in culture until they reached 60 days of age.

[0455] 7) Cloning

[0456] a) General:

[0457] Cloning using the R site depends on a DNA sequence next to the target gene (GOI) that is equivalent to the sequence located in the following fragment. Similarly, the assembly of fragments is possible by overlapping of equivalent sequences and subsequent sealing of the nicks in the assembled DNA by DNA ligase. Therefore, it is necessary to clone individual genes, especially preliminary vectors containing the correct R site. After successful cloning of these preliminary vectors, the target gene flanked by the R site is excised by restriction digestion by an enzyme that cuts directly next to the R site. The last step is to assemble all DNA fragments at once. In more detail, 5'-nuclease removes the 5' end of the overlapping region (R-site). Afterwards, annealing of the R site can be performed, and DNA polymerase extends the 3' end to fill the gap in the sequence. Finally, DNA ligase seals the gap between nucleotides. Add an assembly master mix containing different enzymes (such as exonucleases, DNA polymerases and ligases), and then incubate the reaction mixture at 50°C to assemble the individual fragments into a plasmid. Afterwards, the plasmid is used to transform competent E. coli cells.

[0458] For some vectors, a cloning strategy by restriction enzymes is used. By selecting a suitable restriction endonuclease, the target gene can be cut and then inserted into different vectors by connection. Therefore, it is preferred to use an enzyme that cuts at the multiple cloning site (MCS) and select it in a clever way so that the connection of the fragments can be carried out in the correct array. If the vector and the fragment are cut with the same restriction enzyme before, the sticky ends of the fragment and the vector fit together perfectly and can be connected by DNA ligase subsequently. After connection, the competent E. coli cells are transformed with the newly generated plasmid.

[0459] b) Cloning via restriction digestion:

[0460] To digest the plasmid with restriction enzymes, pipette the following components together onto ice:

[0461] Table: Restriction digestion reaction mixture

[0462]

[0463] If more enzymes were used in one digestion, 1 μl of each was used and the volume was adjusted by adding more or less PCR grade water. All enzymes were chosen on the basis that they were qualified for use with CutSmart buffer (100% activity) from New England Biolabs and had the same incubation temperature (37°C for all).

[0464] The incubation was performed using a thermomixer or thermal cycler, allowing the samples to incubate at a constant temperature (37°C). During the incubation, the samples were not agitated. The incubation time was set to 60 minutes. The samples were then mixed directly with the loading dye and loaded onto an agarose electrophoresis gel or stored at 4°C / ice for further use.

[0465] 1% agarose gel was prepared for gel electrophoresis. Therefore, 1.5 g of multi-purpose agarose was weighed into a 125 conical shake flask and filled with 150 ml of TAE buffer. The mixture was heated in a microwave oven until the agarose was completely dissolved. 0.5 μg / ml ethidium bromide was added to the agarose solution. Thereafter, the gel was cast in a mold. After the agarose was shaped, the mold was placed in the electrophoresis chamber and the electrophoresis chamber was filled with TAE buffer. The sample was then loaded. In the first pocket (starting from the left), the appropriate DNA molecular weight marker was loaded, followed by the sample. The gel was run at <130V for approximately 60 minutes. After electrophoresis, the gel was removed from the chamber and analyzed in a UV-Imager.

[0466] The target band was excised and transferred to a 1.5 ml Eppendorf tube. For gel purification, the QIAquick Gel Extraction Kit from Qiagen was used according to the manufacturer's instructions. The DNA fragments were stored at -20 °C for further use.

[0467] The fragments for ligation are pipetted together in a vector-insert molar ratio of 1:2, 1:3 or 1:5, depending on the length of the insert and vector fragments and their relationship to each other. If the fragment that should be inserted into the vector is short, a ratio of 1:5 is used. If the insert is longer, a smaller amount of insert is used in relation to the vector. An amount of 50 ng of vector is used in each ligation, and the specific amount of a specific insert is calculated using the NEBioCalculator. For ligation, the T4 DNA Ligation Kit from NEB is used. The table below describes an example of a ligation mix.

[0468] Table: Ligation Reaction Mixture

[0469]

[0470] All components were pipetted together onto ice, starting with mixing the DNA and water, adding the buffer, and finally the enzyme. The reaction was gently mixed by pipetting up and down, microcentrifuged briefly, and then incubated at room temperature for 10 minutes. After incubation, the T4 ligase was heat-inactivated at 65°C for 10 minutes. The samples were cooled on ice. In the final step, 10-β competent E. coli cells were transformed with 2 μl of the ligated plasmid (see below).

[0471] c) Cloning via R site assembly:

[0472] In order to assemble, all DNA fragments with R sites at the ends are pipetted on ice. When assembling more than 4 fragments, according to the manufacturer's advice, the equimolar ratio (0.05ng) ​​of all fragments is used. Half of the reaction mixture is presented by NEBuilderHiFi DNA assembly master mix. The total reaction volume is 40 μl, and is reached by being filled with PCR clean water. Exemplary pipetting schemes are described in the following table.

[0473] Table: Assembly reaction mixture

[0474]

[0475] After setting up the reaction mixture, the tubes were incubated in a thermocycler at a constant 50° C. for 60 minutes. After successful assembly, 2 μl of the assembled plasmid DNA was used to transform 10-beta competent E. coli (see below).

[0476] d) Transformation of 10-β competent E. coli cells:

[0477] For transformation, 10-β competent E. coli cells were thawed on ice. Afterwards, 2 μl of plasmid DNA was directly transferred into the cell suspension. The tube was flicked and placed on ice for 30 minutes. Thereafter, the cells were placed in a warm heat block at 42°C and heat-shocked for exactly 30 seconds. Next, the cells were cooled on ice for 2 minutes. 950 μl of NEB 10-β growth medium was added to the cell suspension. The cells were incubated at 37°C with shaking for one hour. Then, 50-100 μl was pipetted onto a preheated (37°C) LB-Amp agar plate and smeared with a disposable spatula. The plates were incubated at 37°C overnight. Only bacteria that successfully incorporated a plasmid carrying the ampicillin resistance gene could grow on these plates. Single colonies were picked the next day and cultured in LB-Amp medium for subsequent plasmid preparation.

[0478] e) Bacterial culture:

[0479] E. coli was cultured in LB medium (abbreviation of Luria Bertani) spiked with 1 ml / L of 100 mg / ml ampicillin to give an ampicillin concentration of 0.1 mg / ml. For different amounts of plasmid preparation, the following amounts were inoculated with a single bacterial colony.

[0480] Table: E. coli culture volume

[0481] Quantitative plasmid preparation Volume LB-Amp medium [ml] Incubation time [h] Miniprep 96-well (EpMotion) 1.5 23 Miniprep 15 ml tube 3.6 23 Large-scale preparation 200 16

[0482] For small-scale preparation, fill each well of a 96-well 2 ml deep-well plate with 1.5 ml of LB-Amp medium. Pick colonies and insert toothpicks into the medium. When all colonies are picked, seal the plate with a sticky air porous membrane. Incubate the plate in a 37°C incubator at 200 rpm shaking speed for 23 hours.

[0483] For small-scale preparation, 3.6 ml of LB-Amp medium was filled in a 15 ml tube (with vented cap) and inoculated with bacterial colonies. During incubation, the toothpick was not removed but left in the tube. As with the 96-well plate, the tube was incubated at 37°C, 200 rpm for 23 hours.

[0484] For large-scale preparation, 200 ml of LB-Amp medium was filled into an autoclaved 1 L conical glass Erlenmeyer flask and inoculated with 1 ml of bacterial day culture approximately 5 hours later. The flask was closed with a paper stopper and incubated at 37°C, 200 rpm for 16 hours.

[0485] f) Plasmid preparation:

[0486] For miniprep, 50 μl of bacterial suspension is transferred to a 1 ml deep well plate. Afterwards, the bacterial cells are centrifuged in the plate at 3000 rpm, 4°C for 5 minutes. The supernatant is removed and the plate with the bacterial pellet is placed in the EpMotion. After approximately 90 minutes, the run is complete and the eluted plasmid DNA can be taken out of the EpMotion for further use.

[0487] For the miniprep, remove the 15 ml tube from the incubator and divide 3.6 ml of the bacterial culture into two 2 ml Eppendorf tubes. Centrifuge the tubes at 6,800 x g for 3 minutes at room temperature in a benchtop microcentrifuge. Afterwards, perform the miniprep using the Qiagen QIAprep Spin Miniprep Kit according to the manufacturer's instructions. Measure the plasmid DNA concentration using a Nanodrop.

[0488] Large quantities were prepared using the Macherey-Nagel method according to the manufacturer's instructions. Xtra MaxiEF kit was used. DNA concentration was measured with Nanodrop.

[0489] g) Ethanol precipitation:

[0490] Mix a certain volume of DNA solution with 2.5 times the volume of 100% ethanol. Incubate the mixture at -20°C for 10 minutes. Then, centrifuge the DNA at 14,000rpm, 4°C for 30 minutes. Carefully remove the supernatant and wash the precipitate with 70% ethanol. Centrifuge the tube again at 14,000 rpm, 4°C for 5 minutes. Carefully remove the supernatant by pipetting and dry the precipitate. After the ethanol has evaporated, add an appropriate amount of endotoxin-free water. Give the DNA time to re-dissolve in water at 4°C overnight. Take a small portion and measure the DNA concentration with a Nanodrop device.

[0491] h) Protein analysis

[0492] CE-SDS

[0493] To determine product fragmentation and mismatches, purified samples were analyzed using capillary electrophoresis (CE). On-chip CE was performed using a LabChip GXII system (PerkinElmer) and the corresponding protein kit used according to the manufacturer's instructions. Samples were analyzed in a reduced state.

[0494] SEC

[0495] To determine the content of aggregated, fragmented and mismatched species, purified samples were analyzed using size exclusion chromatography (SEC).

[0496] LC-MS Peptide Mapping Program

[0497] The expressed and protein A affinity chromatography purified antibodies were denatured and reduced with 6M guanidine and 16mM DTT at pH 7, 37°C for 1 hour. The denatured and reduced antibody samples were carboxymethylated using 73mM IAA-C12 (Fluka), then the buffer was exchanged to 50mM TRIS, 2mM CaCl2 pH 7.5 on a NAP-5 column (GE Healthcare Life Sciences) and the antibodies were digested with trypsin (Promega) at 37°C for 1 hour. The digested samples were analyzed by LC-MS / MS. The HPLC was carried out on a reverse phase column Acquity CSH C18, 1.7μm, Liquid chromatography was performed on a Waters Acquity UPLC (Waters) of 2.1x 150 mm (Waters). The aqueous mobile phase (mobile phase A) contained 0.1% (v / v) formic acid (FA) in HPLC grade water. The organic mobile phase (mobile phase B) contained 0.1% (v / v) FA in acetonitrile. The gradient utilized in this experiment used a 2-step linear gradient of 1% to 30% mobile phase B from 2 minutes to 33 minutes, and then to 60% until 42 minutes, then increased to 90% between 42.5 minutes and 44.5 minutes, dropped back to 50% between 44.6 minutes and 50 minutes, then re-equilibrated with 1% eluent B from 50 minutes to 56 minutes. The column temperature was set to 65°C.

[0498] UPLC and Orbitrap Fusion TM The MS1 spectra were acquired using an Orbitrap mass analyzer with a resolution of 120,000, while the MS / MS data were acquired in the Orbitrap with a resolution of 50,000. The MS / MS events on the Orbitrap were repeated for the topN precursor ions with a dynamic exclusion of 4.5 seconds enabled.

[0499] The MS data were obtained by Byos TM and Byonic TM (Protein Metrics Inc.). TM (Protein Metrics Inc.) performed manual data interpretation. MS / MS Byos TM Search settings included a precursor mass tolerance of 5 ppm and a fragment mass tolerance of 20 ppm. Enzyme specificity was set to full specificity with one allowed missed cleavage.

[0500] Example 2 - Plasmid Generation

[0501] Expression cassette composition

[0502] For the expression of antibody chains, a transcription unit containing the following functional elements was used:

[0503] - The immediate early enhancer and promoter from human cytomegalovirus, including intron A,

[0504] - human heavy chain immunoglobulin 5'-untranslated region (5'UTR),

[0505] - mouse immunoglobulin heavy chain signal sequence,

[0506] - a nucleic acid encoding the corresponding antibody chain,

[0507] - bovine growth hormone polyadenylation sequence (BGH pA), and

[0508] - Optionally, human gastrin terminator (hGT).

[0509] In addition to the expression unit / cassette comprising the desired gene to be expressed, a basic / standard mammalian expression plasmid also contains:

[0510] - an origin of replication from the vector pUC18, which allows replication of this plasmid in E. coli, and

[0511] -β-lactamase gene, which confers ampicillin resistance in Escherichia coli.

[0512] Pre-vector cloning and post-vector cloning

[0513] To construct a double plasmid antibody construct, the antibody HC and LC fragments were cloned into the front vector backbone containing L3 and LoxFas sequences and the rear vector containing LoxFas and 2L sequences and the pac selection marker. The Cre recombinase plasmid pOG231 (Wong, ET, et al., Nucl. Acids Res. 33 (2005) e147; O'Gorman, S., et al., Proc. Natl. Acad. Sci. USA 94 (1997) 14602-14607) was used for all RMCE processes.

[0514] cDNA encoding each antibody chain is produced by gene synthesis (Geneart, Life Technologies Inc.). At 37°C, gene synthesis vector and backbone vector are digested for 1h with HindIII-HF and EcoRI-HF (NEB), and separated by agarose gel electrophoresis. DNA fragments of insert and backbone are cut from agarose gel, and extracted by QIAquick gel extraction kit (Qiagen). Purified insert and backbone fragments are connected with an insert / backbone ratio of 3:1 via a quick ligation kit (Roche) according to the manufacturer's scheme. Then the ligation method is transformed into competent Escherichia coli DH5α via heat shock at 42°C for 30 seconds, and incubated at 37°C for 1 hour, and then they are plated on agar plates containing ampicillin for selection. At 37°C, the plates are incubated overnight.

[0515] The next day, colonies were picked and incubated overnight at 37°C with shaking for either miniprep or maxiprep, which were prepared using 5075 (Eppendorf) or QIAprep Spin Miniprep Kit (Qiagen) / NucleoBond Xtra Maxi EF Kit (Macherey & Nagel). All constructs were sequenced to ensure the absence of any unwanted mutations (SequiServe GmbH).

[0516] In the second cloning step, the previously cloned vector was digested with KpnI-HF / SalI-HF and SalI-HF / MfeI-HF, the conditions being the same as for the first cloning. The TI backbone vector was digested with KpnI-HF and MfeI-HF. Isolation and extraction were performed as described above. The purified insert and backbone were ligated using T4 DNA ligase (NEB) at a ratio of 1:1:1 insert / insert / backbone at 4°C overnight and inactivated at 65°C for 10 minutes, as per the manufacturer's protocol. The following cloning steps were performed as above.

[0517] The cloned plasmids were used for TI transfection and pool generation.

[0518] Example 3 - Cultivation, transfection, selection and single cell cloning

[0519] TI host cells were propagated in a disposable 125 ml ventilated shake flask in a proprietary culture medium based on DMEM / F12 at a constant agitation rate of 150 rpm under standard humidified conditions (95% rH, 37°C and 5% CO2). Every 3-4 days, cells were inoculated in a chemically defined medium containing effective concentrations of selection marker 1 and selection marker 2 at a concentration of 3x10^5 cells / ml. The density and viability of the culture were measured using a Cedex HiRes cell counter (F. Hoffmann-La Roche Ltd, Basel, Switzerland).

[0520] For stable transfection, equimolar amounts of forward and reverse vectors were mixed. The total DNA used for each transfection was 30 μg, and the plasmid ratio was 2.5:2.5:1 (forward, reverse, Cre plasmid).

[0521] Two days before transfection, TI host cells were inoculated in fresh culture medium at a density of 4x10^5 cells / ml. According to the manufacturer's protocol, an OC-400 electroporation box was used and a MaxCyte STX electroporation device (MaxCyte Inc., Gaithersburg) was used for transfection. 3x10^7 cells were transfected with a total of 30 μg of nucleic acid, i.e., 30 μg of plasmid (forward: reverse: Cre plasmid at a molar ratio of 2.5:2.5:1) or transfected with 5 μg of Cre mRNA and 25 μg of a mixture of front vectors and rear vectors. After transfection, cells were inoculated in 30 ml of culture medium without a selection agent.

[0522] On the 5th day after inoculation, the cells were centrifuged and transferred to 80 mL of a chemically defined medium containing effective concentrations of puromycin (selection agent 1) and 1-(2'-deoxy-2'-fluoro-1-β-D-arabinofuranosyl-5-iodo) uracil (FIAU; selection agent 2), 6x10^5 cells / ml, for selection of recombinant cells. From this day on, the cells were incubated at 37°C, 150rpm, 5% CO2 and 85% humidity without splitting. The cell density and viability of the culture were monitored regularly. When the viability of the culture began to increase again, the concentrations of selection agents 1 and 2 were reduced to about half of the amount previously used.

[0523] In more detail, to facilitate the recovery of cells, if the viability is> 40% and the viable cell density (VCD) is> 0.5x10^6 cells / mL, the selection pressure is reduced. Therefore, 4x10^5 cells / ml are centrifuged and resuspended in 40ml selective medium II (chemically defined medium, 1 / 2 selection markers 1 and 2). The cells are incubated under the same conditions as before and are not split.

[0524] Ten days after the start of selection, the expression of intracellular GFP and extracellular heterologous polypeptides bound to the cell surface was measured by flow cytometry to check whether the cassette exchange mediated by Cre was successful. APC antibodies (F(ab')2 fragment goat anti-human IgG labeled with allophycocyanin) for human antibody light and heavy chains were used for FACS staining. Flow cytometry was performed using a BD FACS Canto II flow cytometer (BD, Heidelberg, Germany). Ten thousand events for each sample were measured. Live cells were gated in the forward scatter (FSC) to side scatter (SSC) graph. The live cell gate was defined by untransfected TI host cells and applied to all samples using FlowJo 10.8.1EN software (TreeStar, Olten, Switzerland). The fluorescence of GFP was quantified in the FITC channel (488nm excitation, 530nm detection). Heterologous polypeptides were measured in the APC channel (645nm excitation, 660nm detection). Parental CHO cells, those used for the production of TI host cells, were used as negative controls for GFP and heterologous polypeptide expression. Fourteen to twenty-one days after the start of selection, the viability exceeded 90% and selection was considered complete.

[0525] After selection, single cell cloning can be performed on the stably transfected cell pool by limiting dilution. For this purpose, cells are stained with Cell Tracker GreenTM (Thermo Fisher Scientific, Waltham, MA) and seeded in 384-well plates at 0.6 cells / well. For single cell cloning and all further culture steps, selection agent 2 is omitted from the culture medium. Wells containing only one cell are identified by flat plate imaging based on bright field and fluorescence. Only wells containing one cell are further considered. About three weeks after inoculation, colonies are picked from confluent wells and further cultured in 96-well plates.

[0526] Example 4 - FACS Screening

[0527] FACS analysis was performed to check transfection efficiency and RMCE efficiency of transfection. 4x10^5 cells of the transfected method were centrifuged (1200rpm, 4 minutes) and washed twice with 1mL PBS. After the washing step with PBS, the pellet was resuspended in 400μL PBS and transferred to a FACS tube (with a cell strainer cap). The FACS Canto II was used for measurement, and the data were analyzed by FlowJo software.

[0528] Example 5 - Fed-batch culture

[0529] In shake flask or Ambr 15 container (Sartorius Stedim), feed batch production culture is carried out using the culture medium determined by proprietary chemical composition.At day 0, with 2x10^6 cells / ml inoculation cells.At day 3, 7 and 10, proprietary feed matrix is ​​added to culture.At day 0, 3, 7, 10 and 14, Cedex HiRes instrument (Roche Diagnostics GmbH, Mannheim, Germany) is used to measure the viable cell count (VCC) and cell viability percentage in culture.Use Cobas analyzer (Roche Diagnostics GmbH, Mannheim, Germany) at day 3, 5, 7, 10, 12 and 14 to measure glucose, lactic acid and product titer concentration.At fed batch culture start 14 days later, by centrifugation (10 minutes, 1000rpm, and 10 minutes, 4000rpm) harvest supernatant, and by filtering (0.22 μm) make it clear. Titers on day 14 were determined using protein A affinity chromatography with UV detection. Product quality was determined by Caliper's LabChip (Caliper LifeSciences).

[0530] Example 6 - RNP-based CRISPR-Cas9 gene knockout

[0531] Materials / Resources:

[0532] -Geneious 2021.2.211.1.5 software for guidance and primer design

[0533] - Monoclonal based on CHO TI host cell lines expressing Antibodies 1, 2 or 3

[0534] -Gibco TrueCut Cas9 protein, A45220P, Thermo Fisher TrueCut TM Cas9 protein v2 (Invitrogen TM )

[0535] -sgRNA (custom designed for target gene, 3nm chemically modified sgRNA, Synthego)

[0536] - Chemically defined medium (2.5 μg / ml selection agent 2)

[0537] -DPBS-Dulbecco's Phosphate Buffered Saline without Ca and Mg (Thermo Fisher)

[0538] -Microplate 24 deep well plate with lid (Agilent Technologies, Porvoir Science) (homemade)

[0539] - Thin, long RNase, DNase, non-pyrogen filter tips for loading OC-100 cartridges (Biozyme)

[0540] -Hera safety cover (Thermo Fisher)

[0541] -Cedex HiRes analyzer (Roche Innovatis AG, Bielefeld, Germany)

[0542] -Liconic Incubator Storex IC

[0543] -HyClone electroporation buffer

[0544] -MaxCyte OC-100 Box

[0545] -MaxCyte STX Electroporation System

[0546] CRISPR-Cas9 RNP delivery

[0547] RNPs were preassembled by mixing 30pmol Cas9 per target gene with 30pmol μg gRNA mixture (equal ratios for each gRNA – see the exemplary gene-specific gRNA sequences in the table below) and incubated for 20 minutes at RT. Cells with a concentration between 2-4x10^6 cells / mL were centrifuged (3 minutes, 300g) and washed with 500 μL PBS. Afterwards, the cells were centrifuged again (3 minutes, 300g) and resuspended in 90 μL HyClone electroporation buffer. The pre-incubated RNP mixture was added to the cells and incubated for 5 minutes. The cell / RNP solution was then transferred to an OC-100 cuvette and electroporated by program "CHO2" using the MaxCyte electroporation system. Immediately after electroporation, the cell suspension was transferred to a 24-well and incubated at 37°C for 30 minutes. Fresh and preheated culture medium is added to cause final cell concentration to be 1x10^6 cells / mL, and incubated with 350rpm shaking at 37°C to carry out cell amplification. For genomic DNA preparation (the 6th day or the 8th day), QuickExtract kit (Lucigen) is added to cells and used as PCR template. Specific gene amplicon is carried out PCR amplification (for the sequence used, see sequence table) using standard Q5 hot start polymerase scheme (NEB) and gene specific primers across gRNA target site. The corresponding amplicon is purified using QIAquick PCR purification kit (Qiagen), and analyzed by Sanger sequencing of Eurofins Genomics GmbH, to verify gene inactivation by knocking out.

[0548] Example 7 - Cell Culture

[0549] Cells are thawed and cultured three to four weeks in the pre-culture medium of the selective pressure included in the shake flask.Cells are passaged once every three to four days, and amplified in the pre-culture medium, to reach the volume required for inoculation into the non-selective production culture medium.Cell culture is continued in Multitron Cell incubator (Infors AG) seed and inoculation training phase.Small-scale fermentation is carried out in the fully controlled robot ambr250 fermentation system from Sartorius Stedim Biotech AG respectively.All fermentations are controlled under constant dissolved oxygen (DO), temperature and pH.External pH and pCO2 measured values ​​are monitored using blood gas analyzer system (pHOx, IUL instrument) or corresponding pH and DO ambr analysis module.Cedex HiRes system (Roche) is used to assess viable cells and total cell density and vigor. The concentrations of products, substrates and metabolites / process parameters (glucose, glutamine, glutamate, lactate, ammonium, lactate dehydrogenase, potassium ions and sodium ions) in the cell culture supernatant were determined using Cedex BioHT (Roche Innovatis GmbH, Bielefeld, Germany). Amino acids were analyzed by LC-MS system (HILIC-QQQ MS) using Agilent 1290 HPLC and Ultivo QQQ MS equipment and MassHunter software (Agilent) to observe possible amino acid and substrate limitations and by-product formation.

Claims

1. A modified CHO or HEK cell, wherein the transcriptional activity of genes encoding procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 (PLOD2) and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3) has been permanently reduced.

2. The modified CHO or HEK cell according to claim 1, wherein further, the transcriptional activity of the gene encoding prolyl hydroxylase has been permanently reduced.

3. The modified CHO or HEK cell according to claim 2, wherein the prolyl hydroxylase is prolyl 3-hydroxylase (P3H).

4. The modified CHO or HEK cell according to any one of claims 2 to 3, wherein the prolyl hydroxylase is prolyl 3-hydroxylase 3 or prolyl 3-hydroxylase 4. 5 . The modified CHO or HEK cell according to any one of claims 1 to 4 , wherein the modified CHO or HEK cell is a modified CHO K1 cell or a modified HEK293 cell.

6. The modified CHO or HEK cell according to any one of claims 1 to 5, wherein further, the transcriptional activity of one or more or all of the MYC gene or / and the BAX gene or / and the BAK gene or / and the ICAM-1 gene or / and the SIRT-1 gene has been permanently reduced.

7. The modified CHO or HEK cell according to any one of claims 1 to 6, wherein the modified CHO or HEK cell comprises one or two or more targeted integration landing sites, each of the targeted integration landing sites comprising two or three recombinase recognition sequences, wherein in the case of two or more landing sites, the recombinase recognition sequences of each landing site are incompatible with each other.

8. The modified CHO or HEK cell of claim 7, wherein one of the targeted integration landing sites comprises the recombinase recognition sequences 3L, LoxFas, and L2.

9. The modified CHO or HEK cell according to any one of claims 1 to 8, wherein at least a reduction in the transcriptional activity of the gene encoding PLOD has been achieved after stable introduction of one or more nucleic acids encoding heterologous proteins.

10. A method for recombinantly producing a heterologous protein, the method comprising the steps of: a) culturing the modified CHO or HEK cell according to any one of claims 1 to 9 in a culture medium under conditions suitable for recombinant expression of the heterologous protein, the modified CHO or HEK cell further comprising one or more nucleic acids encoding the heterologous protein, b) recovering the heterologous protein from the modified CHO or HEK cells or the culture medium, c) optionally purifying the heterologous protein using one or more chromatography steps, And thereby the heterologous protein is produced recombinantly.

11. Use of permanent reduction of the transcriptional activity of genes encoding procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 (PLOD2) and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3) in CHO or HEK cells for reducing the amount of lysine hydroxylation in heterologous proteins recombinantly produced using the modified CHO or HEK cells.

12. Use of a permanent reduction in the transcriptional activity of genes encoding procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 (PLOD2) and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3) in CHO or HEK cells for reducing the amount of hydroxylysine in heterologous proteins recombinantly produced using the modified CHO or HEK cells.

13. Use of a permanent reduction in the transcriptional activity of genes encoding procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 (PLOD2) and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3) in CHO or HEK cells for increasing biomass formation in the culture of the modified CHO or HEK cells.

14. Use of a permanent reduction in the transcriptional activity of genes encoding procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 (PLOD2) and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3) in CHO or HEK cells for increasing the titer of heterologous proteins recombinantly produced using the modified CHO or HEK cells.

15. Use of permanent reduction of the transcriptional activity of genes encoding procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (PLOD1), procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 (PLOD2) and procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 (PLOD3) in CHO or HEK cells for reducing the formation of heterologous protein by-products in the culture of the modified CHO or HEK cells recombinantly expressing the heterologous protein.

Images