CD105-targeted polypeptide molecular probe and application thereof

Abstract

The invention provides a targeted CD105 polypeptide molecular probe and application thereof, and belongs to the field of biomedical detection, the amino acid sequence of polypeptide CDP is as shown in SEQ ID NO.1, and the targeted CD105 polypeptide molecular probe is composed of the polypeptide CDP and a signal unit connected with the polypeptide CDP. The invention also provides an application of the molecular probe in preparation of a molecular imaging agent for CD105 expression abnormity related diseases. The polypeptide CDP targeting CD105 and the molecular probe provided by the invention have the advantages of high purity, small molecular weight, strong specificity, no immunogenicity, safety and reliability; the method can be used for detecting tumor progression by a non-invasive imaging technology, and predicting and evaluating drug resistance response and curative effect of a treated patient. A simple, convenient, rapid, economical and accurate detection means is provided for real-time monitoring of CD105 expression in the body of a patient and correlation of tumor grading, staging, metastasis and prognosis.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical detection, and in particular relates to a CD105 targeted polypeptide molecular probe and an application thereof. Background Art

[0002] Malignant tumors are one of the diseases that seriously endanger human life. In recent decades, the incidence and mortality of tumors have been increasing worldwide. Therefore, studying new methods for early diagnosis and effective treatment of malignant tumors is a frontier topic in the development of life sciences. In order to solve this problem, in recent years, molecular imaging (MI) technology has made significant progress and has shown significant advantages in the diagnosis of diseases, especially cancer. CD105, also known as Endoglin, is a type I transmembrane glycoprotein specifically expressed in the neovascular endothelium. Its extracellular region has four active sites. It is specifically highly expressed in active angiogenesis areas and tumor tissues, but not expressed or lowly expressed in normal tissue vascular endothelial cells. The expression of Endoglin during the development of the cardiovascular system shows that it is related to cardiovascular development, and its main function is to promote the formation, development and balance of blood vessels. Recent studies have found that CD105 is a marker for neovascular endothelial cells in a variety of tumors. Its expression intensity in neovascular endothelial cells of tumors is significantly stronger than CD34 and FⅧR, and is related to tumor grade, stage, metastasis and prognosis. It can become a new target for anti-angiogenesis treatment of tumors. In solid tumors, CD105 is highly expressed in tumor parenchyma, vascular endothelial cells near the tumor, and the interstitial components of the tumor, and is involved in angiogenesis, especially in gliomas, breast cancer, liver cancer, colorectal cancer, prostate cancer, gastric cancer, and lung cancer. It can be used as an early indicator for tumor diagnosis, metastasis, recurrence, and prognosis, and is an ideal molecular target for the treatment of human malignant tumors. Tumor angiogenesis is a key pathway for solid tumor metabolism and an important basis for tumor growth and metastasis. The number of microvessels in the tumor entity is closely related to tumor growth and metastasis. Therefore, a reliable tumor microvessel marker will provide important information for clinical diagnosis, treatment, and prognosis. Targeted imaging based on CD105 can understand the angiogenesis of malignant tumors, and can be used as a reliable indicator for anti-tumor treatment observation, and provide a basis for targeted treatment of new blood vessels.

[0003] Molecular imaging plays an increasingly important role in immunotherapy and personalized medicine. Among them, the preparation of molecular probes is the key to molecular imaging. Since CD105 is related to tumor angiogenesis, the application of CD105 in non-invasive molecular imaging technology can observe the expression level of CD105 in whole-body tumors, which has become a research hotspot in the current field of molecular imaging. The application of 89Zr and IRDye 800CW labeled CD105 antibodies in breast cancer mice, combined with near-infrared fluorescence technology and positron emission tomography (PET), can make cancer cells appear quickly and persistently. More and more studies have shown that CD105 has potential application prospects in imaging technologies such as MRI and PET, which will provide important references for the early diagnosis, treatment and efficacy evaluation of malignant tumors. However, due to the cumbersome preparation, poor in vitro stability, large molecules, difficult labeling, weak penetration, post-translational modification and high cost of antibody drugs, their further application is limited. Therefore, in order to improve the specificity and accuracy of cancer diagnosis and treatment and make up for the defects of antibodies, it is urgent to seek to design small molecule probes for new tumor markers as an effective method for detecting and treating cancer. Peptide-based targeted small molecule drugs and diagnostic probes have the characteristics of low cost, small molecular weight, good biocompatibility, strong penetration, no immunogenicity, fast blood clearance rate, and simple preparation, and have demonstrated strong advantages in tumor targeted drug delivery and cancer diagnosis. Therefore, it is urgent to develop a molecular probe targeting CD105, which is of great significance for tumor diagnosis. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a CD105 targeting polypeptide molecular probe and its application. The polypeptide CDP and molecular probe targeting CD105 have strong selectivity, high purity, small molecular weight, strong specificity, non-immunogenicity, safety and reliability; and have wide applications in tumor prevention and treatment, tumor grading, staging, metastasis and prognosis.

[0005] The present invention provides a polypeptide CDP targeting angiogenesis marker CD105, wherein the amino acid sequence of the polypeptide CDP is shown in SEQ ID NO.1.

[0006] or

[0007] An amino acid sequence obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO.1;

[0008] or

[0009] A polypeptide with the same function obtained by replacing, deleting and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.1.

[0010] The present invention provides a nucleic acid molecule encoding the polypeptide CDP, and the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO.2.

[0011] The present invention provides a biological material comprising the nucleic acid molecule, wherein the biological material comprises recombinant DNA, an expression cassette, a transposon, a recombinant vector, a recombinant bacterium or a recombinant cell line.

[0012] The present invention provides a molecular probe targeting neovascularization marker CD105, which is composed of the polypeptide CDP and a signal unit connected thereto; the signal unit is one or more of radioisotopes, fluorescent dyes, quantum dots, magnetic nanoparticles, superparamagnetic materials, and ultrasonic microbubbles.

[0013] Preferably, the polypeptide CDP and the signal unit are covalently linked via a linker molecule or chelated via a chelating agent; the linker molecule is 6-tert-butyloxycarbonylhydrazinonicotinic acid, 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide or N-hydroxysuccinimide; the chelating agent is DTPA, DOTA, NOTA or TETA.

[0014] The present invention provides a composition for targeted treatment of diseases related to abnormal CD105 expression, comprising the polypeptide CDP and an active drug for treating diseases related to abnormal CD105 expression.

[0015] The present invention provides the use of the polypeptide CDP or the composition in the preparation of a drug for preventing and / or treating a disease associated with abnormal CD105 expression, wherein the disease associated with abnormal CD105 expression includes tumors or cardiovascular system diseases.

[0016] Preferably, the tumor is breast cancer, non-small cell lung cancer, colorectal cancer, liver cancer, osteosarcoma, angiosarcoma or gastric cancer; the cardiovascular system disease is coronary atherosclerosis, myocardial fibrosis, atrial fibrillation, hypertension or heart failure.

[0017] The present invention provides the use of the polypeptide CDP or the molecular probe in preparing a molecular imaging agent for diseases related to abnormal CD105 expression.

[0018] Preferably, the molecular imaging agent is used in in vivo imaging fusion imaging technology, and the in vivo imaging fusion imaging technology includes fluorescence imaging, positron emission tomography, single photon emission tomography, magnetic resonance imaging, photoacoustic imaging, and ultrasound imaging.

[0019] Compared with the prior art, the present invention has the following beneficial effects: the polypeptide CDP targeting the neovascularization marker CD105 provided by the present invention has the characteristic of targeting CD105-positive cells in tumor blood vessels, the polypeptide CDP has strong specificity, is non-immunogenic, safe and reliable, and has a small molecular weight. It can be prepared by chemical synthesis, the preparation method is simple, and the prepared polypeptide CDP has high purity.

[0020] The molecular probe targeting the neovascularization marker CD105 provided by the present invention is composed of the polypeptide CDP and a signal unit connected thereto; the molecular probe can be used for non-invasive imaging technology to detect tumor progression, predict and evaluate drug resistance and efficacy evaluation of patients receiving treatment. It provides a simple, fast, economical and accurate detection method for real-time monitoring of the correlation between CD105 expression in patients and tumor grade, stage, metastasis and prognosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The affinity and specificity verification results of the polypeptide CDP provided by the present invention, wherein A is the molecular formula of CDP, B is the affinity analysis of CDP and CD105, C is the confocal imaging analysis of CDP affinity for cells, D is the flow cytometry analysis of CDP binding to HUVEC cells, and E is the MTT analysis of CDP cytotoxicity;

[0022] Figure 2 For the present invention 68 Ga-DOTA-CDP peptide labeled radionuclides 68 Ga and stability analysis, where A is 68 Ga-DOTA-CDP labeling process, B is the purity analyzed by HPLC, C is the molecular weight determined by mass spectrometry, and D, E, and F are the stability analyzed by HPLC;

[0023] Figure 3 The results of in vivo fluorescence imaging of mice using CDP-labeled ICG fluorescent molecules in the present invention, wherein A is tumor imaging at different time periods after the mouse was injected with the probe, B is quantitative analysis of fluorescence signals in the tumor, C is in vitro imaging of major organs in vitro, and D is quantitative analysis of fluorescence signals of major organs;

[0024] Figure 4 For the present invention 68 Ga-DOTA-CDP in vivo PET-CT imaging results, where A is PET imaging of 4T1 and A549 tumors at different time points, B is a Block experiment of 4T1 tumors without CDP labeling, and C is a quantitative analysis of the Block blocking experiment;

[0025] Figure 5The molecular probe of the present invention is analyzed for correlation between tumor uptake value and CD105 expression in tumor, wherein A is CD105 immunohistochemical staining analysis in 4T1 tumor, B is CD105 immunohistochemical staining analysis in A549 tumor, C is CD105 immunohistochemical staining quantitative analysis, and D is correlation analysis between CD105 expression in tumor and probe uptake;

[0026] Figure 6 It is the biodistribution of the molecular probe in different organs of the present invention, wherein A is the quantitative analysis of the biodistribution of the probe in the main organs at different time points, and B is the quantitative analysis of the biodistribution of the probe in different organs after blocking. DETAILED DESCRIPTION

[0027] The present invention provides a polypeptide CDP targeting a neovascularization marker CD105, wherein the amino acid sequence of the polypeptide CDP is shown in SEQ ID NO.1;

[0028] or an amino acid sequence obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO.1;

[0029] Or a polypeptide with the same function obtained by replacing, deleting and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.1.

[0030] In the present invention, the amino acid sequence of the polypeptide CDP is as follows: RGDSENTWYMDQC. The present invention has no special limitation on the preparation method of the polypeptide CDP, and any conventional polypeptide preparation method in the art can be used. In the specific implementation of the present invention, the polypeptide CDP is preferably prepared by solid phase synthesis. In the present invention, amino-modified TentaGel resin is preferably used as a solid phase carrier, and the Fmoc synthesis strategy is used for mixed and evenly divided synthesis. The library capacity is 10 6 A one-bead-one-substance peptide library was prepared. A high-throughput one-bead-one-substance peptide library was screened using a microfluidic chip method, and positive peptide beads were identified by MALDI-TOF-MS to obtain the polypeptide CDP of the present invention.

[0031] The present invention provides a nucleic acid molecule encoding the polypeptide CDP, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.2, specifically as follows:

[0032] CGTGGTGATTCTGAAATACTTGGTATATGGATCAGTGT

[0033] The present invention also provides a biomaterial comprising the nucleic acid molecule, the biomaterial including but not limited to recombinant DNA, expression cassette, transposon, recombinant vector, recombinant bacteria or recombinant cell line. The present invention has no special limitation on the preparation method of the biomaterial, and the conventional preparation method in the art can be used.

[0034] The present invention also provides a molecular probe targeting the neovascularization marker CD105, which is composed of the polypeptide CDP and a signal unit connected thereto; the signal unit is one or more of radioisotopes, fluorescent dyes, quantum dots, magnetic nanoparticles, superparamagnetic materials, and ultrasonic microbubbles. In the present invention, the fluorescent dye includes indocyanine green-maleimide.

[0035] In the present invention, the polypeptide CDP and the signal unit are covalently linked by a linker molecule or chelated by a chelating agent; the linker molecule includes but is not limited to 6-tert-butyloxycarbonylhydrazinonicotinic acid, 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide, maleimide or N-hydroxysuccinimide; in the present invention, 6-tert-butyloxycarbonylhydrazinonicotinic acid reacts with the sulfhydryl group on the Cys at the C-terminus of the polypeptide; 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide or N-hydroxysuccinimide reacts with the carboxyl group at the C-terminus of the polypeptide. In the present invention, the chelating agent is preferably DTPA, DOTA, NOTA or TETA; the chelating agent in the present invention is coupled by reacting the carboxyl group with the amino group at the N-terminus of the polypeptide.

[0036] In the specific implementation process of the present invention, the polypeptide CDP and 6-tert-butyloxycarbonyl hydrazinonicotinic acid conjugate can chelate 99m Tc for SPECT imaging; the conjugate of the polypeptide CDP and the chelating agent DTPA or DOTA chelates the paramagnetic Gd for MRI imaging; the conjugate of the polypeptide CDP and the chelating agent DTPA, DOTA, NOTA or TETA chelates 68 Ga or 64 Cu for PET imaging.

[0037] The present invention provides a composition for targeted treatment of diseases related to abnormal CD105 expression, comprising the polypeptide CDP and an active drug for treating diseases related to abnormal CD105 expression.

[0038] In the present invention, the polypeptide may optionally exist in the form of a polypeptide assembly, which refers to an assembly (such as a divalent or multivalent body) formed by mixing a polypeptide CDP and a polymer through hydrophilic and hydrophobic non-covalent bonding; the polymer is selected from at least one of polyethylene glycol (PEG), polyvinyl alcohol (PVA), polylactic acid-ethanolamine (PLGA), liposomes and micelles.

[0039] The present invention has no special limitation on the type of active drugs; including chemical drugs or biological drugs; or including nano drugs, radioactive drugs, photothermal therapy or photodynamic therapy drugs; further optional are alkylating agents, antimetabolites, anti-tumor natural drugs, anti-tumor antibiotics, anti-tumor angiogenesis drugs, metal complexes or tumor radiation targeting markers, etc.

[0040] In the present invention, the composition may optionally further include a drug carrier, which includes but is not limited to nanomaterials, liposomes and micelles.

[0041] The present invention provides the use of the polypeptide CDP or the composition in the preparation of a drug for preventing and / or treating a disease associated with abnormal CD105 expression, wherein the disease associated with abnormal CD105 expression includes tumors or cardiovascular system diseases.

[0042] In the present invention, the tumor is breast cancer, non-small cell lung cancer, colorectal cancer, liver cancer, osteosarcoma, angiosarcoma or gastric cancer; the cardiovascular system disease is coronary atherosclerosis, myocardial fibrosis, atrial fibrillation, hypertension or heart failure.

[0043] The present invention provides the use of the polypeptide CDP or the molecular probe in preparing a molecular imaging agent for diseases related to abnormal CD105 expression.

[0044] In the present invention, the molecular imaging agent is used for in vivo imaging fusion imaging technology, and the in vivo imaging fusion imaging technology includes fluorescence imaging, positron emission tomography, single photon emission tomography, magnetic resonance imaging, photoacoustic imaging, and ultrasound imaging. In the present invention, the imaging agent is any one of a radionuclide, a radionuclide marker, or a molecular imaging agent.

[0045] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0046] Example 1

[0047] Affinity and specificity analysis of CDP targeting peptides

[0048] The peptide CDP sequence is: RGDSENTWYMDQC, and the peptide was synthesized by solid phase synthesis using the standard Fmoc protocol.

[0049] Human umbilical vein endothelial cells HUVEC are CD105(+), and human embryonic kidney cells 293T are CD105(-) purchased from China Union Medical College Cell Bank. HUVEC cells were selected as the experimental group, and 293T cells were selected as the control group for immunofluorescence binding experiments to detect the specificity of the peptide binding to cells expressing CD105.

[0050] FITC-labeled peptide CDP: After the last amino acid of the peptide CDP synthesized by solid phase synthesis is deprotected, an excess of FITC is weighed and dissolved in a mixed solution of pyridine / DMF / DCM (12:7:5, v:v), and a small amount of DIEA (N,N-diisopropylethylamine) is added to adjust the pH to alkaline and react overnight in the dark to complete the labeling.

[0051] Add 5 × 10 4 Human umbilical vein endothelial cells HUVEC or human embryonic kidney cells 293T were cultured overnight to allow the cells to adhere to the wall. The density of the cells after adhesion was observed. When the requirements were met, the culture medium was replaced. 100 μL of 20 μM FITC-labeled peptide CDP was added to the culture medium. After incubation at 37°C for 20 minutes, each well was washed 3 times with 0.5 mL of frozen PBS, and the culture medium was replaced. An appropriate amount of Hoechst 33342 live cell staining solution was evenly added to the culture medium and gently mixed. Incubate at a temperature suitable for cell culture for 10 minutes. The culture medium containing the dye was removed, and the cells were washed 3 times with PBS and observed under a fluorescence microscope.

[0052] Meanwhile, HUVEC cells were digested, incubated with 100 μL of 20 μM FITC-labeled peptide CDP on ice for 20 min, washed with ice-cold PBS, resuspended in 300 μL PBS, and analyzed using FACS (BD Biosciences).

[0053] 1mg / mL peptide CDP was spotted onto the SPR chip, incubated overnight at 4℃ humidified conditions, then washed with 10×PBS for 10min, then washed with 1×PBS for 10min, finally washed with deionized water and blocked with 5% milk overnight, then washed with deionized water and dried with nitrogen, and loaded on the chip. The mobile phase passed through 1×PBS, 2×PBS, 0.625μg / mL, 1.25μg / mL, 2.5μg / mL, 5μg / mL and 10μg / mL of human CD105 purified protein in sequence, and the SPRi signal was recorded and analyzed.

[0054] Depend on Figure 1 As shown, the KD of polypeptide CDP and CD105 is 13.5nM, indicating that polypeptide CDP has a high affinity for CD105. In vitro cell immunofluorescence staining showed that FITC-labeled polypeptide CDP had a strong binding to CD105(+) human umbilical vein endothelial cells HUVEC, and obvious green fluorescence was visible on the cell membrane. In contrast, no binding was observed in the control cells 293T. In addition, flow cytometry further confirmed the above results. In addition, MTT showed that the polypeptide CDP probe has good biocompatibility and almost no toxicity to cells. These results show that the CDP targeting probe has good specificity and affinity.

[0055] Example 2

[0056] 68 Radiolabeling and stability testing of Ga-DOTA-CDP

[0057] The peptide CDP was commissioned to be synthesized by a biological company and DOTA was connected to the end.

[0058] Take 50 μg of DOTA-linked peptide CDP and add it to the reaction bottle, then add 100 μL of 1.25 mol / L sodium acetate buffer to dissolve it, and then add 5 mL of 0.1 mol / L 68 Add GaCl3 eluent to the reaction bottle, and finally mix the solution evenly; measure the pH value of the mixed solution, and adjust it appropriately to make the pH value between 3.5-4.5; place the reaction bottle containing the mixed solution on a 100℃ heater for 10 minutes; after the product is naturally cooled to room temperature, the peptide probe can be obtained 68 Ga-DOTA-CDP. Then take 20 μL (about 2.03 MBq) 68 The Ga-DOTA-CDP solution was placed in 0.5 mL of PBS buffer (pH = 7.4, 0.01 mol / L), and 100 μL was taken out to measure its RCP after incubation at room temperature for 30 min, 60 min and 120 min to observe its stability in PBS buffer. This was repeated three times. 68 The stability of Ga-DOTA-CDP solution in fetal bovine serum was also determined by incubating the solution at room temperature for 120 min, then diluting the fetal bovine serum with an equal volume of PBS, sealing the solution, vortexing it at room temperature for 2 min, and centrifuging it at 1000 rpm for 5 min. The supernatant was analyzed using a radio-TLC imaging scanner.

[0059] like Figure 2 As shown, the results of Radio-TLC analysis showed that the radiolabeled peptide 68 Ga-DOTA-CDP stays at the origin, 68 GaCl3 moves to the leading edge (Rf is about 1.0). 68 Ga-DOTA-CD and 68 GaCl3 can be completely separated in a system with physiological saline as the developing solvent and iTLC-SG as the stationary phase. 68 The radiochemical purity of Ga-DOTA-CDP after separation and purification by HLB solid phase extraction column is greater than 98%. In vitro stability studies show that after standing in 0.01mol / L pH 7.4 PBS solution and calf serum for 2 hours, the radiochemical purity is still >95%. The above experiments show that 68 Ga-DOTA-CDP has good in vitro stability.

[0060] Example 3

[0061] 68 PET-CT imaging of Ga-DOTA-CDP peptide probe

[0062] 4T1 mouse breast cancer and A549 human non-small cell lung cancer bearing mice were selected as animal models for in vivo studies. 4T1 and A549 tumor cells were expressed at 1×10 6 Subcutaneously inject into the right hind limb of Balb / c nude mice and wait until the tumor grows to 80 mm. 3 . Using mediso PET / CT was used for PET scanning and imaging analysis of mice. Under anesthesia, 7.4 MBq (200 μCi) was injected into each tumor-bearing mouse through the tail vein. 68 Ga-DOTA-CDP was injected, and 10-min whole-body static images were collected at 15min, 30min, and 60min after injection (n=3). Images were spatially reconstructed using the ordered subset expectation maximization (OSEM) method. In the closed experiment, mice bearing 4T1 tumors were injected simultaneously with 200μg of peptide CDP and 7.4MBq of 68 Ga-DOTA-CDP, 15 minutes after injection, a 10-min static PET scan was performed under the same conditions. The regions of interest (ROI) of tumors, normal tissues, and organs were circled in the decay-corrected coronal images using InterView FUSION 3.10 software. The uptake of the imaging agent in the tumor was obtained by analyzing the region of interest (ROI). The maximum radioactive uptake in the tumor or normal tissue was obtained by the average pixel value in the ROI region and converted to MBq / mL / min using the conversion factor. Assuming a tissue density of 1 g / mL, the ROI was converted to MBq / g / min and then divided by the injected dose to obtain the %ID / g for PET quantification.

[0063] 4T1 tumor mice were injected with 7.4 MBq 68 After Ga-DOTA-CDP, images were collected at different time points. Figure 4As shown in the figure, at 15, 30 and 60 minutes after injection, the SUVmax of the 4T1 tumor was 1.78±0.15%ID / g, 1.35±0.06%ID / g and 0.81±0.11%ID / g, respectively. From 15 to 30 minutes, the 4T1 tumor was clearly visible and had a good contrast with the normal muscle tissue on the opposite side. In addition, after the cold peptide was blocked, the SUVmax of the tumor site before and after the blockade was 1.78±0.15%ID / g and 1.44±0.37%ID / g, respectively (P<0.05), indicating that 68 The accumulation of Ga-DOTA-CDP at tumor sites is specific.

[0064] Example 4

[0065] 68 Correlation analysis between the biodistribution of Ga-DOTA-CDP peptide probe and CD105 expression in vivo

[0066] Twelve mice bearing 4T1 tumors were randomly divided into four groups, with three mice in each group. 0.74 MBq (20 μCi) of 68 Ga-DOTA-CDP was injected into the tumor-bearing mice of groups 1, 2, and 3 through the tail vein, and the tumor-bearing mice were killed by cervical dislocation 15 minutes, 30 minutes, and 60 minutes after injection, respectively. In the closed experiment, the tumor-bearing mice of group 4 were treated with an overdose of cold peptide and 0.74 MBq (20 μCi). 68 Ga-DOTA-CDP were injected at the same time, and the tumor-bearing mice were killed by cervical dislocation 15 minutes after injection; all the killed mice were dissected, and a small amount of samples of important tissues and organs such as heart, liver, spleen, lung, kidney, stomach, intestine, bone, blood, muscle, tumor, etc. were taken, and their radioactivity counts were measured with a γ counter after weighing on a precision balance; another 0.74MBq (20μCi) 68 Ga-DOTA-CDP was placed in 3 test tubes, and one tube was taken at each time point to measure the radioactive count simultaneously with the tissue as the attenuation correction standard. According to the formula: percentage injection dose rate per gram of tissue = selected tissue radioactive count / (injected drug radioactive count (i.e., count of the correction tube) × selected tissue mass) × 100%, the percentage injection dose rate per gram of tissue of each organ (%ID / g) was calculated. The results were expressed as mean ± standard deviation (mean ± SD).

[0067] In addition, tumor tissue was taken and fixed with 4% paraformaldehyde to make paraffin sections, which were then dewaxed and dehydrated. Antigen retrieval and peroxidase blocking were then performed. After serum blocking, CD105 primary antibody and secondary antibody were added, respectively, and then DAB color development and hematoxylin counterstaining were performed. Finally, after neutral gum sealing, the sections were scanned and photographed for analysis. Image J software was used to analyze the immunohistochemical photos.

[0068] like Figure 5 As shown, the radioactivity uptake distribution of the radiolabeled peptide in tumor-bearing mice is generally: kidney>blood>tumor>liver. 68 Ga-DOTA-CDP had a high uptake in the kidney and blood, which may be due to the high binding of peptide drugs to plasma proteins and their clearance by glomerular filtration. From 15 to 60 minutes, the uptake of imaging agent in 4T1 tumors and organs showed a downward trend. The uptake value of imaging agent in the tumor decreased from 1.81±0.28%ID / g at 15 minutes to 0.46±0.09%ID / g at 60 minutes, while the uptake value in the kidney decreased from 16.04±4.18%ID / g at 15 minutes to 7.27±1.23%ID / g at 60 minutes. 68 The uptake of Ga-DOTA-CDP in tumors was significantly higher than that in other normal organs such as liver, spleen, bone and muscle (P<0.05).

[0069] like Figure 6 As shown in the figure, immunohistochemical analysis showed that in 4T1 tumors, some tumor cells and neovascular endothelial cells expressed CD105. However, in A549 tumor tissues, only neovascular endothelial cells were stained dark brown. Quantitative analysis of the immunohistochemical results of the two tumor tissues showed that the expression of CD105 in 4T1 tumors was significantly higher than that in A549 tumors (P<0.05). After in-depth analysis of Micro-PET imaging data, the study found that there was a significant positive correlation between tumor SUVmax value and CD105 expression, which provides a strong basis for a deeper understanding of the performance of tumor neovascularization in Micro-PET imaging.

[0070] Example 5

[0071] CDP probe labeled ICG fluorescent molecules for in vivo fluorescence imaging

[0072] Weigh 1 mg of the previously synthesized peptide CDP and dissolve it in 1×PBS, weigh 0.5 mg of indocyanine green-maleimide (ICG-MAL) and dissolve it in 500 μL of deionized water, mix the two and adjust the pH to 7.4, shake at room temperature for 24 hours, freeze-dry and perform mass spectrometry detection and HPLC purification. The obtained product was dialyzed and freeze-dried to obtain the ICG-CDP peptide probe for mouse fluorescence imaging. The breast cancer cell line 4T1 was cultured in DMEM medium containing 10% fetal bovine serum at 1×10 6 Subcutaneously inject into the right hind limb of Balb / c nude mice and wait until the tumor grows to 80 mm. 3 Half an hour after the tail vein injection of 150 μL ICG-CDP, the IVISSpectrum small animal in vivo optical three-dimensional imaging system was used for signal acquisition. After 12 hours of dissection, the main organs were taken for in vitro fluorescence distribution imaging.

[0073] The results are as follows Figure 3 As shown in the figure, the ICG-CDP peptide probe was injected into the tumor-bearing mice with high expression of CD105 through the tail vein. The signal reached its peak at 2 hours and then gradually weakened, indicating that the peptide probe has good targeting. However, the free dye ICG alone is mainly concentrated in the liver and is rarely enriched in the tumor site. This shows that the ICG-CDP peptide probe can target CD105 for tumor imaging.

[0074] In summary, the polypeptide CDP provided by the present invention has the characteristic of targeting CD105-positive tumor vascular tissue, and provides a simple, fast, economical and accurate detection method for the correlation of tumor grading, staging, metastasis and prognosis in clinical practice.

[0075] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A polypeptide CDP targeting angiogenesis marker CD105, characterized in that: The amino acid sequence of the polypeptide CDP is shown in SEQ ID NO.1, or An amino acid sequence obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO.1; or A polypeptide with the same function obtained by replacing, deleting and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.

1.

2. A nucleic acid molecule encoding the polypeptide CDP according to claim 1, characterized in that: The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

2.

3. A biological material comprising the nucleic acid molecule according to claim 2, characterized in that: The biological material includes recombinant DNA, expression cassette, transposon, recombinant vector, recombinant bacteria or recombinant cell line.

4. A molecular probe targeting the neovascularization marker CD105, characterized in that: It consists of the polypeptide CDP according to claim 1 and a signal unit connected thereto; the signal unit is one or more of radioactive isotopes, fluorescent dyes, quantum dots, magnetic nanoparticles, superparamagnetic materials, and ultrasonic microbubbles.

5. The molecular probe according to claim 4, characterized in that The polypeptide CDP and the signal unit are connected through a connecting molecule or a chelating agent; the connecting molecule is 6-tert-butyloxycarbonylhydrazinonicotinic acid, 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide or N-hydroxysuccinimide; the chelating agent is DTPA, DOTA, NOTA or TETA.

6. A composition for targeted treatment of diseases related to abnormal CD105 expression, characterized in that: The invention comprises the polypeptide CDP according to claim 1 and an active drug for treating diseases related to abnormal CD105 expression.

7. Use of the polypeptide CDP according to claim 1 or the composition according to claim 6 in the preparation of a drug for preventing and / or treating diseases related to abnormal CD105 expression, characterized in that: The diseases associated with abnormal CD105 expression include tumors or cardiovascular system diseases.

8. The use according to claim 7, characterized in that: The tumor is breast cancer, non-small cell lung cancer, colorectal cancer, liver cancer, osteosarcoma, angiosarcoma or gastric cancer; the cardiovascular system disease is coronary atherosclerosis, myocardial fibrosis, atrial fibrillation, hypertension or heart failure.

9. Use of the polypeptide CDP according to claim 1 or the molecular probe according to claim 4 or 5 in the preparation of a molecular imaging agent for diseases associated with abnormal CD105 expression.

10. The use according to claim 9, characterized in that: The molecular imaging agent is used for in vivo imaging fusion imaging technology, and the in vivo imaging fusion imaging technology includes fluorescence imaging, positron emission tomography, single photon emission tomography, magnetic resonance imaging, photoacoustic imaging, and ultrasound imaging.

Images