Aspergillus oryzae capable of degrading ethyl carbamate and application of aspergillus oryzae

Abstract

The invention discloses Aspergillus aureus capable of degrading ethyl carbamate and application thereof, and belongs to the field of microbial fermentation. According to the invention, Aspergillus aureus capable of degrading ethyl carbamate is obtained by screening from a five-grain liquid bag yeast, and the preservation number of the Aspergillus aureus is CCTCC (China Center For Type Culture Collection) NO: 20242109. The screened aspergillus aureus has outstanding ethyl carbamate degradation performance, the EC enzyme activity reaches 676.84 U / L, the aspergillus aureus is applied to brewing of distilled liquor, ethyl carbamate harmful to the human body can be greatly degraded, and the safety performance of distilled liquor products is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of brewed wine, and particularly relates to Aspergillus aureus capable of degrading ethyl formate and application thereof. Background Art

[0002] As people's living standards improve, their awareness of food safety is also increasing, especially in recent years, their awareness of alcohol safety has been increasing. Ethyl carbamate (EC) is a Class 2A carcinogen, which is produced more or less in yeast fermented foods. It is mainly formed by ethanol, urea and some amino acids and is common in alcoholic products. Countries stipulate that the EC in distilled spirits shall not exceed 150μg / L, otherwise there will be safety hazards. It has been reported that drinking wine with an EC content of more than 30μg / L will increase the risk of cancer. Distilled spirits are deeply loved by Chinese consumers, but they contain EC and have carcinogenic risks. Therefore, how to effectively reduce EC in distilled spirits needs to be explored. Summary of the invention

[0003] In order to solve the above technical problems, the present invention aims to further isolate a strain of Aspergillus aureus that can degrade ethyl carbamate by studying the changes of ethyl carbamate in Wuliangye Baobaoqu during the fermentation process of grain liquor, so as to provide support for controlling the safety of distilled liquor.

[0004] In order to achieve the above application purpose, the technical solution adopted in this application is as follows.

[0005] In the first aspect, the present invention provides Aspergillus aureoterreus that can degrade ethyl formate, named and numbered ZQW-02, which has been deposited in the China Center for Type Culture Collection (CCTCC) on September 29, 2024, with the deposit number: CCTCC NO: 20242109.

[0006] The ITS rDNA sequence of Aspergillus aureus is shown in SEQ ID NO:1.

[0007] SEQ ID NO:1 ITS rDNA sequence of Aspergillus aureus:

[0008] CCTGCGGAAGGATCATTACCGAGTGCGGGTCCTCGTGGCCCAACCTCCCA

[0009] CCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCCCTGCTGG

[0010] CCGCCGGGGGGCGTCTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAAC

[0011] ATGAACCCTGTTCTGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCA

[0012] GTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACG

[0013] CAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGA

[0014] GTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTC

[0015] CGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCCTCGTCC

[0016] CCCGGCTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGT

[0017] CCTCGAGCGTATGGGGCTTTGTCTTCCGCTCTGCAGGCCCGGCCGGCGCC

[0018] CGCCGGCGCAATTTTTTGCAACCTTTTATTTTTCCAGGTTGACCTCGGAT

[0019] CAGGTAGGGATACCCGCTGAACTTAAGCATAT.

[0020] Among them, the EC enzyme activity of the above-mentioned Aspergillus aureus can reach up to 676.84U / L.

[0021] Among them, the above-mentioned Aspergillus aureus can grow with EC as the only carbon source.

[0022] Among them, metal ions have an inhibitory effect on the enzyme activity of the above-mentioned Aspergillus aureus.

[0023] In a second aspect, the present invention provides use of the above-mentioned Aspergillus aureus capable of degrading ethyl carbamate in degrading ethyl carbamate.

[0024] In a third aspect, the present invention provides a microbial agent, which contains the fermentation liquid, seed liquid or bacterial body of the above-mentioned Aspergillus aureus.

[0025] In a fourth aspect, the present invention provides a product, wherein the product contains the above-mentioned Aspergillus aureus, or contains the above-mentioned microbial agent.

[0026] Among them, the above-mentioned product is koji, and the koji is Wuliangye Baobao koji.

[0027] In a fifth aspect, the present invention provides a method for degrading ethyl carbamate, wherein the Aspergillus aureus, microbial agent or product is added to an environment containing ethyl carbamate for degradation.

[0028] In a sixth aspect, the present invention provides a method for preparing brewed wine or distilled wine, comprising adding the above-mentioned Aspergillus aureus, microbial agents or products to raw materials, and fermenting to prepare brewed wine or distilled wine.

[0029] The beneficial effect of the present invention is that: the present application uses a strain of Aspergillus aureoterreus obtained by screening from Wuliangye Baobaoqu using ethyl carbamate (EC) as the sole carbon source culture medium, and the strain has outstanding performance in degrading ethyl carbamate, and the EC enzyme activity reaches 676.84U / L. When applied to the wine fermentation process, it can greatly degrade ethyl carbamate that is harmful to the human body, and improve the safety performance of distilled liquor products. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The change of EC content during the fermentation process of Example 2 of the present invention;

[0031] Figure 2 The bacterial composition changes during the fermentation process of Example 2 of the present invention;

[0032] Figure 3 The changes in fungal composition during the fermentation process of Example 2 of the present invention;

[0033] Figure 4 It is the main aroma substance in the fermentation process of Example 2 of the present invention;

[0034] Figure 5 This is the phylogenetic tree of the ITS rDNA sequence of the ZQW-02 strain. DETAILED DESCRIPTION

[0035] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clear, the present application is further described in detail below in combination with the implementation methods. Unless otherwise defined, all scientific and technological terms used herein have the same meanings as understood by ordinary technicians in the field.

[0036] The present invention provides a strain of Aspergillus aureoterreus that can degrade ethyl carbamate, named ZQW-02. The strain of the present invention has been deposited on September 29, 2024, with a deposit number of CCTCC NO: 20242109, and the deposit location is China Center for Type Culture Collection (CCTCC), No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Postal Code: 430072.

[0037] The Aspergillus aureus ZQW-02 of the present invention can degrade ethyl carbamate.

[0038] Specific examples will be listed below to explain the scheme of the present invention. It will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, the techniques or conditions described in the literature in this area or the product instructions are used. Reagents or instruments used that do not indicate manufacturers are all conventional products that can be obtained commercially.

[0039] The composition of the EC as the sole carbon source culture medium (g / L) used in the examples includes: 5 ethyl carbamate, 2.5 diammonium hydrogen phosphate, 2.5 potassium dihydrogen phosphate, 2.0 sodium acetate, 2.0 sodium chloride, 0.001 bromocresol purple, 20.0 agar, and the rest is water.

[0040] The composition of the EC as the sole nitrogen source culture medium (g / L) used in the examples includes: 5 ethyl carbamate, 2.0 glucose, 2.0 potassium dihydrogen phosphate, 2.0 sodium acetate, 2.0 sodium chloride, 0.001 bromocresol purple, 20.0 agar, and the rest is water.

[0041] Example 1 Isolation, screening and identification of Aspergillus aureus ZQW-02

[0042] (I) Separation and screening

[0043] 1. Add 5g of Baobaoqu from the brewing environment of Yibin Wuliangye Co., Ltd. to 50mL of sterile PBS solution, filter with sterile gauze, and retain the filtered solution. Centrifuge the solution at 6000r / min for 5 minutes, discard the supernatant, and resuspend the precipitate with 5mL of sterile PBS to make a bacterial suspension.

[0044] The prepared bacterial suspension was inoculated into the sole nitrogen source and carbon source liquid culture medium at an inoculation volume of 3% (v / v) and cultured at 28°C for 3 days. -3 ~10 -6, and spread on the solid culture medium with only nitrogen and carbon sources. After the colonies grow on the culture medium, they are purified and streaked multiple times to obtain obvious single colonies, and the color of the EC culture medium containing bromocresol purple can be changed from yellow to purple, indicating that the strain can degrade EC. This strain is selected for further experiments to screen excellent fungi.

[0045] (II) Screening of fungi with high degradative enzyme activity

[0046] The screened strains were inoculated into liquid culture medium with EC as the sole carbon and nitrogen source, and cultured in a shaker at 37°C for 5 days at a speed of 180 r / min. The bacterial solution was placed in a centrifuge tube and centrifuged at 5500 r / min for 10 min in a refrigerated centrifuge (4°C), and the cells were washed with 20 mmol / L phosphate buffer (pH 7.0) to prepare a suspension, which was ultrasonically disrupted at 0°C until the bacterial solution became clear, and the enzyme activity was detected.

[0047] Enzyme activity unit (U): Under normal pressure, 37°C, pH 7.0, EC is decomposed to produce 1 mmol of ammonia per minute, which is one enzyme activity unit (U). Standard curve: Standard curve is drawn by preparing standard solutions of different concentrations with ammonium chloride, measuring the absorbance at 625nm, and drawing the standard curve.

[0048] Enzyme activity determination method: Determine the enzymatic activity of ethyl carbamate hydrolase by colorimetry, take 1 mL of enzyme solution, add 1 mL of 3% ethyl carbamate solution, react at 37°C for 30 min, add 1 mL of stop solution, react at 37°C for 30 min, add 1 mL of stop solution, mix well, add 1 mL of color developer I and 1 mL of color developer II, shake vigorously, keep warm at 37°C for 20 min, take out, dilute to 10 mL with ultrapure water, compare color at 625 nm, and record the OD value.

[0049] In the above experiment, a strain 1 capable of metabolizing EC was screened from a culture medium with EC as the sole carbon source, and an EC enzyme activity experiment was performed.

[0050] (III) EC enzyme activity test

[0051] 1. Effect of different culture time on enzyme activity: The strain was inoculated in liquid culture medium with EC as the only carbon source, and cultured in a shaker at 37°C for different time periods at a speed of 180r / min. The effect of different culture time on enzyme activity was measured, and the optimal culture time was determined to be 5d. The results are shown in Table 1.

[0052] Table 1 Effect of different culture time on enzyme activity

[0053]

[0054] 2. Effect of different EC concentrations on enzyme activity: The EC concentration in the liquid culture medium with EC as the sole carbon source was adjusted, cultured for 5 days, and the changes in enzyme activity of the strain under different concentrations were measured, and the optimal culture concentration was determined to be 5g / L. The results are shown in Table 2.

[0055] Table 2 Effect of different EC concentrations on enzyme activity

[0056]

[0057] 3. Effects of different pH and metal ions on enzyme activity: Under the conditions of optimal culture time and EC concentration, the effects of different pH and metal ions on the enzyme activity of the strain were measured, and it was determined that the optimal pH was 6 and that different metal ions had different effects on enzyme activity. The results are shown in Table 3 ( / : indicates no addition).

[0058] Table 3 Effects of different pH and metal ions on enzyme activity

[0059]

[0060] Based on the above experimental results, a fungus that degrades ethyl carbamate was screened out and named ZQW-02. Its optimal culture conditions and the effects of different metal ions on enzyme activity were determined. The specific results were: optimal culture time: 5d; optimal EC culture concentration: 5g / L; optimal culture pH: 6; maximum enzyme activity: 676.84U / L, an increase of 172.7% over the initial enzyme activity.

[0061] (IV) Classification and identification

[0062] Through the above experiments, ITS rDNA molecular identification was carried out on the excellent fungal strain ZQW-02 that can degrade ethyl carbamate (EC).

[0063] Genome extraction: The screened strains were inoculated into PDA liquid medium and cultured for 24 hours, then centrifuged at 5500 r / min for 10 minutes to collect the fungal cells. The fungal genome was extracted using the TSINGKE Plant DNA Extraction Kit (Universal).

[0064] ITS rDNA sequence amplification (50uL): 1×TSE101 gold mix 45uL, ITS1(10P)2uL(TCCGTAGGTGAACCTGCGG), ITS4(10P)2uL(TCCTCCGCTTATTGATATGC), DNA template 1uL. Amplification conditions are shown in Table 4.

[0065] Table 4 Amplification conditions

[0066]

[0067] The amplified PCR product was subjected to agarose gel electrophoresis (2ul sample + 6ul bromophenol blue) at 300V for 12 minutes. The bands were clear and sent to Chengdu Branch of Beijing Qingke Biotechnology Co., Ltd. for sequencing. The ITS rDNA sequence of strain ZQW-02 was obtained as shown in SEQ ID NO:1.

[0068] The ITS rDNA sequences were compared with the NCBI database by BLAST, and the bacteria with sequence similarity of 99% were selected to draw the phylogenetic tree using Mega 5.0 software (see Figure 2). Figure 5 As shown in the figure, the evolutionary tree was analyzed with Bootstrap 1000 times with confidence. The strain ZQW-02 was identified as Aspergillus aureoterreus and was deposited in the China Center for Type Culture Collection on September 29, 2024, with the deposit number CCTCC NO: 20242109.

[0069] Example 2 Application of Wuliangye Baobaoqu containing Aspergillus aureus ZQW-02 in grain wine fermentation

[0070] The Baobaoqu used in the embodiment is Wuliangye Baobaoqu (does not contain Aspergillus aureus ZQW-02).

[0071] The preparation method of the Baobaoqu (containing Aspergillus aureus ZQW-02) used in the embodiment is: culture Aspergillus aureus ZQW-02 in PDA culture medium for 48 hours, add 3% culture solution and mix with Wuliangye Baobaoqu.

[0072] The commercial distiller's yeast used in the embodiments is commercially available.

[0073] The grain wine fermentation process described in the embodiment is: five kinds of grains are washed → steamed → urea is added → distiller's yeast is inoculated → canned → saccharified and fermented, which is specifically as follows:

[0074] (1) Take sorghum, rice, glutinous rice, wheat and corn in a weight ratio of 36%, 22%, 18%, 16% and 8% and mix them evenly. After washing, add them to an electric rice cooker, add an equal amount of distilled water and cook.

[0075] (2) After the cooked grains are spread out and cooled to room temperature, they are divided into 6 equal portions, weighed and recorded, and one portion is left untreated; 0.8% of Baobaoqu (containing Aspergillus aureus ZQW-02) is added to one portion and mixed evenly; 100 mg / kg of urea and 0.8% of Baobaoqu (containing Aspergillus aureus ZQW-02) are added to one portion and mixed evenly; 100 mg / kg of urea and 0.8% of Baobaoqu (not containing Aspergillus aureus ZQW-02) are added to one portion and mixed evenly; 0.8% of commercial distiller's yeast is added to one portion and mixed evenly; 100 mg / kg of urea and 0.8% of commercial distiller's yeast are added to one portion and mixed evenly, and the mixture is placed in a fermentation tank, placed at 23°C, and saccharified for 24 hours.

[0076] (3) After saccharification, add sterile water of the same weight as the grain in the fermentation tank, seal and ferment at 23°C for 30 days. During the fermentation process, samples were taken at intervals of five days, for a total of six times. The five-point sampling method was used to collect samples. The upper, middle and lower three layers of fermentation particles (25g) and 25mL of liquid from each fermentation tank were collected and mixed, and the fermentation samples from different tanks were placed in sterile centrifuge tubes and stored at -80°C for subsequent analysis.

[0077] Sampling was taken to determine the EC degradation, microbial composition, aroma substance composition, and related physical and chemical indicators. The specific results are as follows.

[0078] 1. EC degradation

[0079] The changes in EC content during the fermentation of Baobaoqu and commercial wine qu are shown in Figure 1 , Figure 1 W100 is a group of bagged koji added with 100 mg / kg urea (containing Aspergillus aureus ZQW-02); WT100 is a group of bagged koji added with 100 mg / kg urea (without Aspergillus aureus ZQW-02); P100 is a group of commercial koji added with 100 mg / kg urea.

[0080] Depend on Figure 1 It can be seen that during the fermentation process, the EC content of the Baobaoqu fermentation group (containing Aspergillus aureus ZQW-02) was always lower than the EC content of the commercial koji group and the Baobaoqu fermentation group without Aspergillus aureus ZQW-02 at the same time, and was in a downward trend. The change trend of the EC content of Baobaoqu without Aspergillus aureus ZQW-02 was similar to that of the commercial koji. The above shows that compared with commercial koji and Baobaoqu without Aspergillus aureus ZQW-02, Baobaoqu containing Aspergillus aureus ZQW-02 can degrade EC more effectively. Therefore, in subsequent studies, more emphasis will be placed on comparing the Baobaoqu fermentation group containing Aspergillus aureus ZQW-02 and the commercial koji group to highlight the application effect of Aspergillus aureus ZQW-02 in grain wine fermentation with Baobaoqu.

[0081] 2. Microbial composition

[0082] The changes in bacterial composition during the fermentation of Baobaoqu (containing Aspergillus aureus ZQW-02) and commercial wine koji are shown in Figure 2 , Figure 2 W0 is the Wuliangye packaged koji group without urea; W100 is the Wuliangye packaged koji group with 100 mg / kg urea added; P0 is the commercial koji group without urea; P100 is the commercial koji group with 100 mg / kg urea. 10d and 30d represent the 10th and 30th days of fermentation.

[0083] The changes in fungal composition during fermentation of Baobaoqu (containing Aspergillus aureus ZQW-02) and commercial wine koji are shown in Figure 3 , Figure 3 W0 is the Wuliangye packaged koji group without urea; W100 is the Wuliangye packaged koji group with 100 mg / kg urea added; P0 is the commercial koji group without urea; P100 is the commercial koji group with 100 mg / kg urea. 10d and 30d represent the 10th and 30th days of fermentation.

[0084] Depend on Figure 2 and Figure 3 It can be seen that among the bacterial flora, Loigolactobacillus will be significantly reduced under the influence of urea, while Limosilactobacillus will increase significantly on the contrary. Among the fungal flora, Pichia, Thermoascus and Aspergillus are dominant in the fermentation process.

[0085] 3. Aroma composition

[0086] The main aroma substances of Baobaoqu (including Aspergillus aureus ZQW-02) and commercial wine koji are shown in Figure 4 , Figure 4 W0-F means fermentation with Baobaoqu for 30 days; P0-F means fermentation with commercial wine qu for 30 days.

[0087] Depend on Figure 4 It can be seen that under normal fermentation conditions, the content of aroma substances produced by Wuliangye Baobaoqu fermentation is much higher than that produced by commercial wine qu fermentation, especially in Glutamic acid gamma-methyl ester, 11a-Hydroxyprogesterone, artemisinic aldehyde and Acetaldehyde di-cis-3-hexenylacetal.

[0088] 4. Related physical and chemical indicators

[0089] The physical and chemical indices of fermented wines with Baobaoqu (containing Aspergillus aureus ZQW-02) and commercial koji under the influence of urea were compared. The results are shown in Table 5, where W0 is the Wuliangye Baobaoqu group without adding urea; W100 is the Wuliangye Baobaoqu group with adding 100 mg / kg urea; P0 is the commercial koji group without adding urea; P100 is the commercial koji group with 100 mg / kg urea.

[0090] Table 5 Comparison of physical and chemical indicators of wine fermented with Baobaoqu and commercial wine qu (mg / mL)

[0091]

[0092] As shown in Table 5, under the influence of urea, the content of some organic acids will be reduced. In Wuliangye Baobaoqu, the reduction of this organic acid will be lower than that of commercial koji. The amount of these organic acids will affect the flavor of the final distilled liquor. Therefore, Baobaoqu is better than ordinary commercial koji in reducing the impact of urea on the flavor of distilled liquor.

[0093] In summary, the EC-degradable Aspergillus aureus ZQW-02 obtained by the present invention has excellent EC-degrading ability through comparison of various experimental indicators. It is applied to the field of grain wine fermentation. During the fermentation process, the EC content of the bag koji containing Aspergillus aureus ZQW-02 is lower than that of ordinary commercial wine koji, but its fermentation flavor is better than that of ordinary commercial wine koji, and in the process of resisting the reduction of organic acid content of fermented wine by urea, the effect is better than that of ordinary wine koji.

Claims

1. Aspergillus aureoterreus capable of degrading ethyl carbamate, characterized in that: The deposit number is: CCTCC NO:20242109.

2. Use of the Aspergillus aureus described in claim 1 in degrading ethyl carbamate.

3. A microbial agent, characterized in that: The bacterial agent contains the fermentation liquid, seed liquid or bacterial cells of the Aspergillus aureus according to claim 1.

4. A product characterized by: The product contains the Aspergillus aureus described in claim 1, or contains the microbial agent described in claim 3.

5. The product according to claim 4, characterized in that: The product is distiller's yeast.

6. The product according to claim 5, characterized in that: The distiller's yeast is Wuliangye Baobaoqu.

7. A method for degrading ethyl formate, characterized in that: The Aspergillus aureus described in claim 1, the microbial agent described in claim 3 or the product described in claim 4 is added to an environment containing ethyl carbamate for degradation.

8. A method for preparing brewed wine or distilled wine, characterized in that: The Aspergillus aureus described in claim 1, the microbial agent described in claim 3 or the product described in claim 4 is added to the raw materials for fermentation to prepare brewed wine or distilled wine.

Images