Cryptosporidium-resistant synbiotics preparation as well as preparation method and application thereof

Abstract

The invention discloses an anti-cryptosporidium synbiotics preparation as well as a preparation method and application thereof. The invention provides a complex microbial inoculant. The complex microbial inoculant comprises bifidobacterium pseudolongum and bacteroides multiforme. In the complex microbial inoculant, the quantity ratio of the bifidobacterium pseudolongum to the bacteroides multiforme is (1-10): (1-10). The invention also provides a composition which comprises the complex microbial inoculant and guar gum. The invention further discloses application of the complex microbial inoculant or the composition in preparation of products for treating and / or preventing cryptosporidiosis and application of the complex microbial inoculant or the composition in preparation of products for improving intestinal functions. The invention has industrial value in the field of medicine.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to an anti-Cryptosporidium synbiotic preparation and a preparation method and application thereof. Background Art

[0002] Cryptosporidium Cryptosporidium spp.) is one of the main parasitic pathogens that cause diarrhea in children and a variety of young animals. For people who are immunosuppressed due to illness or organ transplantation, infection with Cryptosporidium can lead to death. Currently, Cryptosporidium has become the second largest pathogen causing diarrhea in children under 2 years old, second only to rotavirus. The prevalence of Cryptosporidium is also relatively common in other animals, especially in calves before weaning. Studies have found that almost all calves have been infected with Cryptosporidium. When infected with Cryptosporidium, calves show symptoms such as watery diarrhea, loss of appetite, and weight loss. Severe infection can lead to the death of calves, which has caused huge economic losses to the dairy farming industry.

[0003] Although cryptosporidiosis seriously threatens the health of humans and animals and causes huge economic losses, the drugs and vaccines that can be used to prevent and treat cryptosporidiosis are still very limited. So far, the only drug that can be used to treat human cryptosporidiosis is nitazoxanide, and studies have found that this drug is ineffective in immunosuppressed people. In terms of animal cryptosporidiosis prevention and control, fusinone lactate is currently the only drug that can be used to prevent cryptosporidiosis in newborn calves, but the drug is highly toxic and can cause poisoning at more than twice the therapeutic dose (therapeutic dose: 0.1 mg / Kg BW), with toxic side effects such as diarrhea, bloody stools, loss of appetite, and weight loss. In addition, fusinone lactate can only be used to prevent cryptosporidiosis and cannot be used in newborn calves with diarrhea for more than 24 hours.

[0004] Probiotics, also known as microecological regulators, are live microbial preparations made from normal microorganisms or substances that promote microbial growth. Probiotics have the function of maintaining or adjusting microecological balance, preventing and treating diseases, and promoting host health. Probiotics are divided into three categories according to their ingredients: probiotics, prebiotics, and synbiotics. They are clinically used as auxiliary drugs for diarrhea and functional gastrointestinal diseases. Probiotics are microorganisms that are beneficial to the body, including bifidobacteria, lactobacilli, and bacteroides. Prebiotics are organic substances that are not digested and absorbed by the host, but can selectively promote the metabolism and proliferation of probiotics in the body, thereby improving the health of the host. Synbiotics are a combination of probiotics and prebiotics. When the body ingests synbiotics, on the one hand, the number of probiotics is supplemented exogenously, and on the other hand, prebiotics that promote the growth of probiotics are provided. The combination of the two plays a better role.

[0005] At present, there is no synbiotic for reducing the intensity of Cryptosporidium infection. If a synbiotic that can prevent or reduce the intensity of Cryptosporidium infection can be found, it will provide a new approach and idea for the prevention and treatment of cryptosporidiosis. Summary of the invention

[0006] The purpose of the present invention is to provide an anti-cryptosporidiosis synbiotic preparation and a preparation method and application thereof.

[0007] The invention provides a composite bacterial agent, comprising Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron.

[0008] In the composite bacterial agent, the quantitative ratio of Bifidobacterium pseudolongum to Bacteroides thetaiotaomicron is 1-10:1-10.

[0009] Specifically, in the composite bacterial agent, the quantitative ratio of Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron is 1-4:1-4.

[0010] Specifically, in the composite bacterial agent, the quantitative ratio of Bifidobacterium pseudolongum to Bacteroides thetaiotaomicron is 1:1.

[0011] The quantitative ratio refers to the cfu ratio.

[0012] Specifically, the pseudo-Bifidobacterium longum is pseudo-Bifidobacterium longum Bif.

[0013] Specifically, the Bacteroides thetaiotaomicron is Bac.

[0014] The present invention also provides a composition, which comprises the composite bacterial agent and guar gum. Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron are probiotics, and guar gum is a prebiotic, so the composition provided by the present invention is a synbiotic composition.

[0015] The composition is as follows: 0.5×10 8 -5×10 8 cfu: Bacteroides thetaiotaomicron 0.5×10 8 -5×10 8 cfu: guar gum 0.1-10 g. The composition is as follows: Bifidobacterium pseudolongum 0.5×10 8 -5×10 8 cfu: Bacteroides thetaiotaomicron 0.5×10 8 -5×10 8 cfu: guar gum 0.2-3.2 g. The composition is as follows: Bifidobacterium pseudolongum 1×10 8 -4×10 8 cfu: Bacteroides thetaiotaomicron 1×10 8 -4×10 8cfu: guar gum 0.2-3.2 g. The composition is as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.2-0.8 g. The composition is as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.2 g. The composition is as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.3g. The composition is as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.4g. The composition is as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.5g. The composition is as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.6g. The composition is as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.7g. The composition is as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.8g.

[0016] Specifically, the CAS number of the guar gum is: 9000-30-0.

[0017] Specifically, the viscosity of the guar gum is 5000-5500 cps.

[0018] Specifically, the specification of the guar gum is 200 meshes.

[0019] The present invention also protects Bifidobacterium pseudolongum Bif.

[0020] The present invention also protects Bacillus thetaiotaomicron Bac.

[0021] The present invention also protects the use of any of the above composite bacterial agents or any of the above compositions or Bifidobacterium pseudolongum Bif or Bacteroides thetaiotaomicron Bac in the preparation of a product for inhibiting Cryptosporidium.

[0022] The present invention also protects the use of any of the above composite bacterial agents or any of the above compositions or Bifidobacterium pseudolongum Bif or Bacteroides thetaiotaomicron Bac in the preparation of products for treating and / or preventing cryptosporidiosis.

[0023] The present invention also protects the use of any of the above composite bacterial agents or any of the above compositions or Bifidobacterium pseudolongum Bif or Bacteroides thetaiotaomicron Bac in the preparation of products for improving intestinal function.

[0024] The present invention also provides a product for inhibiting Cryptosporidium, which contains any of the above composite bacterial agents or any of the above compositions.

[0025] The present invention also provides a product for treating and / or preventing cryptosporidiosis, which contains any of the above composite bacterial agents or any of the above compositions.

[0026] The present invention also provides a product for improving intestinal function, which contains any of the above composite bacterial agents or any of the above compositions.

[0027] The improvement of intestinal function is manifested in: increasing the content of acetic acid and / or propionic acid and / or butyric acid in the intestinal contents. The improvement of intestinal function is manifested in: increasing the content of acetic acid and / or propionic acid and / or butyric acid in the intestinal contents of Cryptosporidium infected persons. The improvement of intestinal function is manifested in: increasing the content of acetic acid and / or propionic acid and / or butyric acid in the jejunal contents. The improvement of intestinal function is manifested in: increasing the content of acetic acid and / or propionic acid and / or butyric acid in the jejunal contents of Cryptosporidium infected persons. The improvement of intestinal function is manifested in: increasing the content of acetic acid and / or propionic acid in the colon contents. The improvement of intestinal function is manifested in: increasing the content of acetic acid and / or propionic acid in the colon contents of Cryptosporidium infected persons.

[0028] The improvement of intestinal function is manifested in: enhancing the intestinal mucus barrier function. The improvement of intestinal function is manifested in: enhancing the intestinal mucus barrier function of Cryptosporidium-infected patients. The enhancement of intestinal mucus barrier function is manifested in: increasing the thickness of the ileal mucus layer. The enhancement of intestinal mucus barrier function is manifested in: increasing the thickness of the ileal mucus layer of Cryptosporidium-infected patients. The enhancement of intestinal mucus barrier function is manifested in: increasing the number of Muc2-positive goblet cells in the ileum. The enhancement of intestinal mucus barrier function is manifested in: increasing the number of Muc2-positive goblet cells in the ileum of Cryptosporidium-infected patients.

[0029] The cryptosporidiosis refers to a disease caused by infection with Cryptosporidium.

[0030] Specifically, the Cryptosporidium is Cryptosporidium tyzeri.

[0031] Any of the above products can be food or medicine.

[0032] Bifidobacterium pseudolongum ( Bifidobacterium pseudolongum)Bif, was deposited on October 9, 2024 in the General Microbiology Center of China Microorganism Culture Collection (referred to as CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with the deposit registration number CGMCC No.32159.

[0033] Bacteroides thetaiotaomicron ( Bacteroides thetaiotaomicron )Bac, was deposited on October 9, 2024 in the General Microbiology Center of China Microorganism Culture Collection (referred to as CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with the deposit registration number CGMCC No.32160.

[0034] In the embodiments of the present invention, the efficacy of the oral synbiotic composition was demonstrated using an animal model of Cryptosporidium infection: reducing the amount of Cryptosporidium oocysts detected in feces; increasing the content of acetate, propionate and butyrate in intestinal contents; and enhancing the intestinal mucus barrier function (increasing the thickness of the ileal mucus layer and increasing the number of goblet cells).

[0035] The composition provided by the present invention has the functions of reducing the infection intensity of cryptosporidiosis and improving the intestinal mucus barrier. The present invention has industrial value in the medical field. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is the image of Bifidobacterium pseudolongum Bif under a microscope after Gram staining.

[0037] Figure 2 This is a microscopic image of Bacillus thetaiotaomicron after Gram staining.

[0038] Figure 3 This is a schematic diagram of the experimental process of Example 4.

[0039] Figure 4 is the standard curve and standard curve equation in Example 4.

[0040] Figure 5 This is the result of detecting the content of Cryptosporidium oocysts in feces in Example 4.

[0041] Figure 6 The initial weighing results of mice in Example 4 (a) and the weighing results after the experiment (b).

[0042] Figure 7 The results of the intestinal flora composition analysis in Example 4 (phylum level composition analysis).

[0043] Figure 8 The results of the intestinal flora composition analysis in Example 4 (genus level composition analysis).

[0044] Fig. 9 This is the result of analyzing the content of short-chain fatty acids in the intestinal contents in Example 4.

[0045] Fig.10 This is a photo taken under an optical microscope during the analysis of intestinal mucus barrier function in Example 4.

[0046] Fig.11 This is the quantitative result of the intestinal mucus barrier function analysis in Example 4.

[0047] Fig.12 This is a schematic diagram of the experimental process of Example 6.

[0048] Fig.13 This is the result of detecting the content of Cryptosporidium oocysts in feces in Example 6.

[0049] Fig.14 The results of the bacterial abundance determination in Example 6 (the copy number of the 16S rRNA gene).

[0050] Fig.15 The results of the bacterial abundance determination in Example 6 (the copy number of Bifidobacterium pseudolongum Bif and the copy number of Bacteroides thetaiotaomicron Bac). DETAILED DESCRIPTION

[0051] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0052] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. Unless otherwise specified, the quantitative tests in the following examples are set up for three repeated experiments, and the results are averaged. Guar gum (also known as guar gum or Guar gum) (Specification: "Viscosity: 5000-5500 cps; 200 mesh") (CAS No.: 9000-30-0): Aladdin Reagent (Shanghai) Co., Ltd., product catalog number G109238. Mineral mixture (AIN 93G mineral mixture): MP Biomedicals. Vitamin mixture (AIN-93-Vx mixed vitamins): MP Biomedicals. Stool DNA extraction kit (EZNA stool DNA kit): Omega Biotek Inc., USA, product catalog number M4015-02. Sterile defibrinated horse blood: Zhengzhou De Ning Biotechnology Co., Ltd., product catalog number DX208. Method for counting Bifidobacterium pseudolongum: Determine the colony forming unit after anaerobic culture using solid TPY broth medium. Method for counting Bacteroides thetaiotaomicron: Determine the colony forming unit after anaerobic culture using solid EG medium containing horse blood. Method for anaerobic culture: Culture in an anaerobic box (in which an anaerobic gas production bag and oxygen indicator are added to achieve an anaerobic environment). Anaerobic gas production bag (2.5L specification): Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd., product catalog number is HBYY001. Oxygen indicator: Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd., product catalog number is HBYY004. Anaerobic box (2.5L specification): Mitsubishi, Japan, product catalog number is C-31.

[0053] Liquid TPY broth medium (pH 6.5): Each liter contains 10.0 g of hydrolyzed casein, 5.0 g of plant peptone, 2.0 g of yeast powder, 5.0 g of glucose, 0.5 g of L-cysteine, 2.0 g of dipotassium hydrogen phosphate, 0.5 g of magnesium chloride, 0.25 g of zinc sulfate, 0.15 g of calcium chloride, 0.001 g of ferric chloride and 1.0 g of Tween 80, and the balance is distilled water. Compared with liquid TPY broth medium, the only difference between solid TPY broth medium and liquid TPY broth medium is the addition of 20 g of agar per liter.

[0054] Preparation method of solid EG culture medium containing horse blood: take 2.4 g beef extract powder, 10.0 g peptone, 5.0 g yeast extract powder, 4.0 g disodium hydrogen phosphate, 1.5 g glucose, 0.5 g soluble starch, 0.2 g L-cystine, 0.5 g L-cysteine ​​hydrochloride and 15.0 g agar, add distilled water to 1L, adjust the pH to 7.6-7.8, sterilize under high pressure and cool to 50°C, then add 50 mL sterile defibrinated horse blood.

[0055] Cryptosporidium tyzeri ( Cryptosporidium tyzzeri ), as described in the following literature: Molecular characterization of Cryptosporidium spp. ,Enterocytozoon bieneusi and Giardia duodenalis in laboratory rodents in China; Parasite 29, 46 (2022).

[0056] Example 1. Isolation, identification and preservation of Bifidobacterium pseudolongum Bif The strain Bif was isolated and screened from mouse feces.

[0057] The morphological characteristics of strain Bif are: Gram-positive, non-motile, rod-shaped, sometimes forked at one end, and strictly anaerobic bacteria. See the microscope photo of strain Bif after Gram staining. Figure 1 .

[0058] Physiological and biochemical characteristics of strain Bif: positive for α-galactosidase, β-galactosidase, α-glucosidase, α-arabinosidase, alkaline phosphatase, arginine aromatase, leucylglycine aromatase, phenylalanine aromatase, pyroglutamate aromatase, tyrosine aromatase, alanine aromatase, glycine aromatase, and glutamylglutamate aromatase; able to ferment mannose.

[0059] The sequencing results of the characteristic segment of the 16S rRNA gene coding sequence in the genomic DNA of the strain Bif are shown in SEQ ID NO: 1, and the sequencing results were compared for homology at NCBI.

[0060] Based on the above morphological characteristics, physiological and biochemical characteristics and molecular identification results, strain Bif belongs to Bifidobacterium pseudolongum and is named Bifidobacterium pseudolongum ( Bifidobacterium pseudolongum )Bif.

[0061] Bifidobacterium pseudolongum ( Bifidobacterium pseudolongum)Bif, was deposited on October 9, 2024 in the General Microbiology Center of China Microorganism Culture Collection (referred to as CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with the deposit registration number CGMCC No.32159.

[0062] Example 2: Isolation, identification and preservation of Bacillus thetaiotaomicron The strain Bac was isolated and screened from mouse feces.

[0063] The morphological characteristics of strain Bac are: Gram-negative, non-spore-forming, obligately anaerobic rods. Microscopic photos of strain Bac after Gram staining are shown in Figure 2 .

[0064] Physiological and biochemical characteristics of strain Bac: positive for α-galactosidase, β-galactosidase, α-glucosidase, α-arabinosidase, arginine aromatase, proline aromatase, phenylalanine aromatase, leucine aromatase, pyroglutamate aromatase, tyrosine aromatase, alanine aromatase, glycine aromatase, histidine aromatase, glutamylglutamate aromatase, and serine aromatase; capable of fermenting mannose and converting L-tryptophan into indole.

[0065] The sequencing result of the characteristic segment of the 16S rRNA gene coding sequence in the genomic DNA of the strain Bac is shown in SEQ ID NO: 2, and the sequencing result was compared for homology at NCBI.

[0066] Based on the above morphological characteristics, physiological and biochemical characteristics and molecular identification results, strain Bac belongs to Bacteroides thetaiotaomicron and is named Bacteroides thetaiotaomicron ( Bacteroides thetaiotaomicron )Bac.

[0067] Bacteroides thetaiotaomicron ( Bacteroides thetaiotaomicron )Bac, was deposited on October 9, 2024 in the General Microbiology Center of China Microorganism Culture Collection (referred to as CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), with the deposit registration number CGMCC No.32160.

[0068] Example 3, preparation of feed 1. Preparation of Feed A (Feed without Dietary Fiber) The raw materials (total raw material mass of 1 kg) were mixed with water according to the formula in Table 1, and then pelletized feed was made by extrusion using a pellet feed machine. The pelletized feed had a water content of 6-8% and a cylindrical shape (the bottom diameter of the cylinder was about 0.6 cm and the height of the cylinder was 3-4 cm). The pelletized feed was vacuum packed and stored at 4°C.

[0069] Table 1

[0070] 2. Preparation of Feed B (Feed containing 10% guar gum) The raw materials (total raw material mass is 1 kg) were mixed with water according to the formula in Table 2, and then pelletized feed was made by extrusion using a pellet feed machine. The pelletized feed had a water content of 6-8% and a cylindrical shape (the bottom diameter of the cylinder was about 0.6 cm and the height of the cylinder was 3-4 cm). The pelletized feed was vacuum packed and stored at 4°C.

[0071] Table 2

[0072] Example 4, Animal Efficacy Test (Effect of Guar Gum) The experimental animals were SPF C57BL / 6J mice (3 weeks old, female, weight difference less than 1 g). They were raised in an SPF animal laboratory at 20-25 ℃, 12h light / 12h dark. The challenge substance was to suspend the oocysts of Cryptosporidium tyzeri in physiological saline to a concentration of 1×10 7 Negative feces: feces of C57BL / 6J mice negative for Cryptosporidium typhimurium. Figure 3 .

[0073] 1. Group processing The experimental animals were randomly divided into two groups, with 10 animals in each group.

[0074] NDF group: The mice were first adaptively fed with feed A for 5 days, then the challenge substance was given by gavage (0.1 mL of challenge substance / mouse), and then fed with feed A for 56 days.

[0075] GG group: The mice were first adaptively fed with feed B for 5 days, then the challenge substance was given by gavage (0.1 mL of challenge substance / mouse), and then fed with feed B for 56 days.

[0076] During the feeding process, the mice were allowed to drink water and eat feed freely.

[0077] During the grouping process, feces were collected regularly, which were fecal samples. Method for collecting feces: Each mouse was housed in a single cage, and normal feed and drinking water were provided. Feces were collected after 12 hours of feeding.

[0078] 2. Detection of Cryptosporidium oocysts in stool samples 1. Make a standard curve Suspend Cryptosporidium tyzeri oocysts in saline to a concentration of 1 × 10 7 / mL, 1×10 6 / mL, 1×10 5 / mL, 1×10 4 / mL, 1×10 3 / mL, 1×10 2 oocysts / mL or 10 / mL, which are oocyst suspensions with different oocyst contents. Mix 0.1 mL of oocyst suspension with 0.1 g of negative feces to make the feces standard. Take the feces standard, freeze and thaw repeatedly three times with liquid nitrogen and 90°C water bath, then use the feces DNA extraction kit and operate according to the instructions to extract DNA, and then perform qPCR (using upstream primer F1, downstream primer R1 and probe P1) to make a standard curve.

[0079] The nucleotide sequence of the upstream primer F1: ATGACGGGTAACGGGGAAT; Nucleotide sequence of downstream primer R1: CCAATTACAAAACCAAAAAGTCC; The nucleotide sequence of probe P1: CGCGCCTGCTGCCTTCCTTAGATG.

[0080] The standard curve and standard curve equation are shown in Figure 4 In the standard curve equation, Y is the Ct value and X is the logarithmic value of the number of Cryptosporidium oocysts in Tyzer with the base 10.

[0081] 2. Detection of Cryptosporidium oocysts in feces 0.1 g of fecal sample was taken and repeatedly frozen and thawed three times using liquid nitrogen and 90°C water bath. Then, DNA was extracted using a fecal DNA extraction kit according to the instructions. Then, qPCR (upstream primer F1, downstream primer R1 and probe P1) was performed to obtain the Ct value. The Ct value was substituted into the standard curve equation to calculate the number of Cryptosporidium tyzeri oocysts per gram of fecal sample.

[0082] Results Figure 5 ( Figure 5 The horizontal axis in the figure is the sampling time, which is counted from the completion of the challenge. Compared with the mice in the NDF group, the amount of oocysts excreted in the feces of the mice in the GG group was significantly decreased on days 3, 12, 15, 27, 33, 39, 45, 51, and 57 after infection (*: P <0.05,**: P <0.01).

[0083] 3. After grouping and the experiment, the mice were weighed.

[0084] Results Figure 6 There was no significant difference in the body weight of the two groups of mice after grouping and treatment and after the end of the experiment.

[0085] 4. Analysis of intestinal flora composition After completing the grouping treatment in step 1, fecal samples were collected from 6 mice in each group (6 mice in the NDF group were represented by N1 to N6, and 6 mice in the GG group were represented by G1 to G6). Fecal samples were collected and DNA was extracted using a fecal DNA extraction kit according to the instructions for 16S rRNA gene sequencing and bioinformatics analysis (completed by Beijing Novogene Technology Co., Ltd.).

[0086] The results of fecal bacterial phylum level composition analysis are shown in Figure 7 The results of bacterial flora analysis showed (at the phylum level): compared with the feces of mice in the NDF group, the abundance of Actinobacteria and Bacteroidetes in the feces of mice in the GG group increased. The results of fecal bacterial genus level composition analysis are shown in Figure 8 The results of microbial flora analysis showed (at the genus level): compared with the feces of mice in the NDF group, the abundance of Bifidobacterium and Bacteroides in the feces of mice in the GG group was significantly increased.

[0087] 5. Analysis of short-chain fatty acids in intestinal contents After completing the grouping process in step 1 and the last fecal sample collection, the mice were killed by cervical dislocation, and the jejunal and ileal contents and colon contents of the mice were collected for quantitative detection of short-chain fatty acid content (completed by Beijing Hexin Technology Co., Ltd.).

[0088] The short-chain fatty acid content of jejunal contents is shown in Fig. 9 AC. The short-chain fatty acid content of colonic contents is shown in Fig. 9 DF. Compared with the jejunal contents of NDF group mice, the contents of acetate, propionate and butyrate in the jejunal contents of GG group mice were significantly increased. Compared with the colon contents of NDF group mice, the contents of acetate and propionate in the colon contents of GG group mice were significantly increased.

[0089] 6. Analysis of intestinal mucus barrier function As an important biomarker, Muc2 plays a key role in intestinal health, inflammatory response, and tumorigenesis. Muc2 antibody: abcam, product catalog number ab272692.

[0090] After the mice were killed in step 5, the ileum tissue was obtained, trimmed into tissue blocks, and then embedded in paraffin and prepared into paraffin sections (thickness of 5 μm), followed by immunohistochemical staining (primary antibody: Muc2 antibody). Pictures were taken under an optical microscope, and the crypt depth and mucus layer thickness in the ileum tissue were measured using Image J (Media Cybernetics, inc., Rockville, MD, USA). Mucus-producing goblet cells were observed and counted under an optical microscope (5-7 microscopic fields of each section were randomly selected).

[0091] Optical microscope photos Fig.10 The average number of positive goblet cells per crypt in the field of view is shown in Fig.11 The average villus length in the field of view is shown in a. Fig.11 b. The results of the thickness of the mucus layer in the field of view are shown in Fig.11 The results of crypt depth in the field of view are shown in Fig.11 The results showed that compared with NDF mice, the thickness of the mucus layer and the number of positive goblet cells in a single crypt of GG mice were significantly increased.

[0092] Example 5: Preparation of probiotic suspension 1. Preparation of Bifidobacterium pseudolongum suspension 1. Prepare liquid TPY broth medium and then dispense it into glass test tubes. Then add 2 mL of liquid paraffin to each test tube (the paraffin layer is located on the top of the medium and plays a sealing role), then sterilize it by high pressure and let it stand to cool.

[0093] 2. Take the test tube that has completed step 1, and inoculate Bifidobacterium pseudolongum Bif into the culture medium under the paraffin layer using an inoculation needle, and culture it at 37°C for 48 h.

[0094] 3. After completing step 2, use a syringe to draw up the bacterial solution (be careful not to suck out the precipitate), then centrifuge at 4°C and 4000 g for 5 min, collect the bacterial precipitate, wash it three times with sterile PBS buffer (each time centrifuge at 4°C and 4000 g for 5 min, then collect the bacterial precipitate), and then resuspend it with PBS buffer to obtain a culture medium with a content of 10 9 cfu / mL of bacterial suspension.

[0095] 2. Preparation of Bacteroides thetaiotaomicron suspension 1. Spread Bacillus thetaiotaomicron onto solid EG medium containing horse blood and culture anaerobically at 37℃ for 48 h.

[0096] 2. After completing step 1, use sterile PBS buffer to collect the bacteria on the surface of the culture medium, then centrifuge at 4°C and 4000 g for 5 min, collect the bacterial precipitate, wash it three times with sterile PBS buffer (each time centrifuge at 4°C and 4000 g for 5 min, then collect the bacterial precipitate), and then resuspend it with PBS buffer to obtain a culture medium with a Bacteroides thetaiotaomicron content of 10 9 cfu / mL bacterial suspension.

[0097] Example 6. Animal efficacy test (effect of synbiotic composition) The experimental animals were SPF C57BL / 6J mice (3 weeks old, female). They were raised in an SPF animal laboratory at 20-25°C and 12 h light / 12 h dark. The challenge substance was a suspension of Cryptosporidium tyzeri oocysts in physiological saline to a concentration of 1×10 7 Negative feces: feces of C57BL / 6J mice negative for Cryptosporidium typhimurium. Fig.12 (The day of the challenge is day 0, the day before the challenge is day -1, day -2, etc., and the day after the challenge is day 1, day 2, etc.) Preparation method of 0.2 mL composite bacterial solution: 0.1 mL of the pseudo-longitudinal Bifidobacterium prepared in Example 5 with a content of 10 9 cfu / mL of bacterial suspension and 0.1 mL of Bacteroides thetaiotaomicron with a content of 10 9 cfu / mL bacterial suspension was obtained by mixing.

[0098] 1. The experimental animals were first adaptively fed for 3 days (free drinking of sterile water and free consumption of SPF maintenance feed), and then randomly divided into two groups (8 animals in each group) for group feeding.

[0099] GG-Vehical group: On days -6, -5, -4, and -3, ampicillin, neomycin, and vancomycin were added to the drinking water of mice (to make the content of ampicillin 1 g / L, neomycin 1 g / L, and vancomycin 0.5 g / L) to eliminate the original microorganisms in the intestines of mice; on day 0, the challenge substance was given by gavage (0.1 mL of the challenge substance / mouse); GG-Bif-Bac group: On days -6, -5, -4, and -3, ampicillin, neomycin, and vancomycin were added to the drinking water of mice (to make the content of ampicillin 1 g / L, neomycin 1 g / L, and vancomycin 0.5 g / L) to eliminate the original microorganisms in the intestines of mice; on day 0, the challenge substance was given by gavage (0.1 mL of the challenge substance / mouse); on days -3, -2, 1, and 2, the compound bacterial solution was given by gavage once each (0.2 mL of the compound bacterial solution / mouse); During the group feeding process, the mice were allowed to drink water and eat feed B freely.

[0100] From day -6 to day 9, a total of 16 days, during this time period, the average daily feed mass consumed by each mouse was 2 g (the guar gum content in 2 g of feed was 0.2 g).

[0101] 2. Detection of Cryptosporidium oocysts in feces During the grouping process, feces were collected on the 3rd, 5th, 7th and 9th days, which were fecal samples. Method for collecting feces: Each mouse was housed in a single cage, and feed and drinking water were provided normally. Feces were collected after 12 hours of feeding.

[0102] The method for detecting the content of Cryptosporidium tyzeri oocysts in feces is the same as step 2 of Example 4.

[0103] Results Fig.13 ( Fig.13 The horizontal axis in the figure is the sampling time, which is counted from the completion of the challenge. Compared with the mice in the GG-Vehical group, the amount of oocysts excreted in the feces of the mice in the GG-Bif-Bac group was significantly reduced (**: P <0.01).

[0104] 4. Determination of bacterial abundance During the grouping process, feces were collected on day -6, day -3, day 0 and day 3, which were fecal samples. Method for collecting feces: Each mouse was housed in a single cage, and normal feed and drinking water were provided. Feces were collected after 12 h of feeding.

[0105] Fecal samples were collected and genomic DNA was extracted using a fecal DNA extraction kit according to the instructions. The genomic DNA was used as a template to detect the copy number of the 16S rRNA gene, the copy number of the Bif gene of Bifidobacterium pseudolongum, and the copy number of the Bac gene of Bacteroides thetaiotaomicron. The primer sequences are shown in Table 3.

[0106] Table 3

[0107] The abundance results of the 16S rRNA gene copy number (reflecting the abundance of fecal flora) are shown in Fig.14 The results of the copy number of Bifidobacterium pseudolongum Bif and the copy number of Bacillus thetaiotaomicron are shown in Fig.15 The results showed that after feeding guar gum and supplementing with Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron, the abundance of the two bacteria in the intestinal flora of mice increased significantly.

[0108] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A composite bacterial agent, including Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron.

2. The composite bacterial agent according to claim 1, characterized in that: The pseudo-Bifidobacterium longum is the pseudo-Bifidobacterium longum Bif, and the polymorphic Bacteroides thetaiotaomicron is the polymorphic Bac; the pseudo-Bifidobacterium longum ( Bifidobacterium pseudolongum ) Bif, whose deposit registration number is CGMCC No.32159; Bacteroides thetaiotaomicron ( Bacteroides thetaiotaomicron )Bac, whose deposit registration number is CGMCC No.32160.

3. A composition comprising the composite bacterial agent according to claim 1 and guar gum.

4. Bifidobacterium pseudolongum ( Bifidobacterium pseudolongum )Bif, its deposit registration number is CGMCCNo.32159.

5. Bacteroides thetaiotaomicron ( Bacteroides thetaiotaomicron )Bac, whose deposit registration number is CGMCC No.32160.

6. Use of the composite bacterial agent according to claim 1 or the composite bacterial agent according to claim 2 or the composition according to claim 3 or the pseudo-Bifibacterium longum Bif according to claim 4 or the Bacillus thetaiotaomicron Bac according to claim 5 in preparing a product; the product is as follows (a1) or (a2): (a1) Products for inhibiting Cryptosporidium; (a2) Products for the treatment and / or prevention of cryptosporidiosis.

7. Use of the composite bacterial agent according to claim 1 or the composite bacterial agent according to claim 2 or the composition according to claim 3 or the pseudo-Bifibacterium longum Bif according to claim 4 or the Bacillus thetaiotaomicron Bac according to claim 5 in preparing a product; the product is a product for improving intestinal function.

8. A product for inhibiting Cryptosporidium, comprising the composite bacterial agent according to claim 1 or the composite bacterial agent according to claim 2 or the composition according to claim 3.

9. A product for treating and / or preventing cryptosporidiosis, comprising the composite bacterial agent according to claim 1 or the composite bacterial agent according to claim 2 or the composition according to claim 3.

10. A product for improving intestinal function, comprising the composite bacterial agent according to claim 1 or the composite bacterial agent according to claim 2 or the composition according to claim 3.

Images