Cryptosporidium-resistant synbiotic preparation, preparation method and application thereof

Abstract

The application discloses an anti-cryptosporidium synbiotic preparation and a preparation method and application thereof. The application provides a composite microbial agent which comprises Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron. In the composite microbial agent, the quantity ratio of Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron is 1-10:1-10. The application further provides a composition which comprises the composite microbial agent and guar gum. The application further protects application of the composite microbial agent or the composition in preparation of products for treating and / or preventing cryptosporidiosis and in preparation of products for improving intestinal function. The application has industrial value in the medical field.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological medicine, and relates to an anti-Cryptosporidium synbiotic preparation and a preparation method and application thereof. BACKGROUND

[0002] Cryptosporidium spp. is one of the main parasitic pathogens causing diarrhea in children and various young animals. For people with immunosuppression due to illness or organ transplantation, infection with Cryptosporidium can lead to death. At present, Cryptosporidium has become the second largest pathogen causing diarrhea in children under the age of 2, second only to rotavirus. The prevalence of Cryptosporidium is also common in other animals, especially pre-weaning calves. Studies have found that almost all calves have been infected with Cryptosporidium. When infected with Cryptosporidium, calves show symptoms such as watery diarrhea, loss of appetite, weight loss, and even death in severe cases, which has caused huge economic losses to the dairy industry.

[0003] Although Cryptosporidium disease seriously threatens the health of humans and animals and causes huge economic losses, the drugs and vaccines available for the prevention and treatment of Cryptosporidium disease are still very limited. So far, the only drug available for the treatment of human Cryptosporidium disease is nitazoxanide, and studies have found that this drug is ineffective for immunosuppressed people. In terms of animal Cryptosporidium disease prevention, lactonic dehydrodicamphine is the only drug that can be used to prevent Cryptosporidium disease in newborn calves, but this drug has high toxicity. More than twice the therapeutic dose (therapeutic dose: 0.1 mg / Kg BW) can cause poisoning, and symptoms such as diarrhea, bloody stool, loss of appetite, and weight loss can occur. In addition, lactonic dehydrodicamphine can only be used for the prevention of Cryptosporidium disease and cannot be used for newborn calves with diarrhea for more than 24 hours.

[0004] Microecological preparations, also known as microecological regulators, are live microbial preparations made from normal microorganisms or substances that promote the growth of microorganisms. Microecological preparations have the functions of maintaining or adjusting the microecological balance, preventing diseases, and promoting the health of the host. Microecological preparations are divided into three categories according to their components: probiotics, prebiotics, and synbiotics, and are used as auxiliary drugs for diarrhea and functional gastrointestinal diseases in clinical practice. Probiotics are microorganisms that are beneficial to the body, including Bifidobacterium, Lactobacillus, and Bacteroides. Prebiotics are organic substances that are not digested and absorbed by the host but can selectively promote the metabolism and proliferation of beneficial bacteria in the body, thereby improving the health of the host. Synbiotics are a combination of probiotics and prebiotics. The intake of synbiotics by the body not only supplements the number of probiotics exogenously, but also provides prebiotics to promote the growth of probiotics, and the combination of the two plays a better role.

[0005] At present, there is no synbiotic for reducing the intensity of cryptosporidium infection. If a synbiotic for preventing or reducing the intensity of cryptosporidium infection is found, a new way and thought will be provided for the prevention of cryptosporidiosis. SUMMARY

[0006] The purpose of the present application is to provide an anti-cryptosporidium synbiotic preparation and a preparation method and application thereof.

[0007] The present application provides a compound microbial agent, comprising Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron.

[0008] In the compound microbial agent, the quantity ratio of Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron is 1-10:1-10.

[0009] Specifically, in the compound microbial agent, the quantity ratio of Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron is 1-4:1-4.

[0010] Specifically, in the compound microbial agent, the quantity ratio of Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron is 1:1.

[0011] The quantity ratio refers to the cfu ratio.

[0012] Specifically, the Bifidobacterium pseudolongum is Bifidobacterium pseudolongum Bif.

[0013] Specifically, the Bacteroides thetaiotaomicron is Bacteroides thetaiotaomicron Bac.

[0014] The present application also provides a composition comprising the compound microbial agent and guar gum. Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron are probiotics, and guar gum is prebiotic, so the composition provided by the present application is a synbiotic composition.

[0015] The ratio in the composition is as follows: Bifidobacterium pseudolongum 0.5x10 8 -5x10 8 cfu: Bacteroides thetaiotaomicron 0.5x10 8 -5x10 8 cfu: guar gum 0.1-10g. The ratio in the composition is as follows: Bifidobacterium pseudolongum 0.5x10 8 -5x10 8 cfu: Bacteroides thetaiotaomicron 0.5x10 8 -5x10 8 cfu: guar gum 0.2-3.2g. The ratio in the composition is as follows: Bifidobacterium pseudolongum 1x10 8 -4x10 8 cfu: Bacteroides thetaiotaomicron 1x10 8 -4x10 8cfu: guar gum 0.2-3.2g. The composition is compounded as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.2-0.8g. The composition is compounded as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.2g. The composition is compounded as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.3g. The composition is compounded as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.4g. The composition is compounded as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.5g. The composition is compounded as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.6g. The composition is compounded as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.7g. The composition is compounded as follows: Bifidobacterium pseudolongum 10 8 cfu: Bacteroides thetaiotaomicron 10 8 cfu: guar gum 0.8g.

[0016] Specifically, the CAS number of the guar gum is 9000-30-0.

[0017] Specifically, the viscosity of the guar gum is 5000-5500cps.

[0018] Specifically, the specification of the guar gum is 200 mesh.

[0019] The present application also protects Bifidobacterium pseudolongum Bif.

[0020] The present application also protects Bacteroides thetaiotaomicron Bac.

[0021] The present application also protects the use of any of the above-mentioned complex microbial agents or any of the above-mentioned compositions or Bifidobacterium pseudolongum Bif or Bacteroides thetaiotaomicron Bac in the preparation of products for inhibiting Cryptosporidium.

[0022] The present application also protects the use of any of the above-mentioned complex microbial agents or any of the above-mentioned compositions or Bifidobacterium pseudolongum Bif or Bacteroides thetaiotaomicron Bac in the preparation of products for treating and / or preventing cryptosporidiosis.

[0023] The present application also protects the use of any of the above-mentioned complex microbial agents or any of the above-mentioned compositions or Bifidobacterium longum subsp. longum Bif or Bacteroides thetaiotaomicron Bac in the preparation of a product for improving intestinal function.

[0024] The present application also provides a product for inhibiting Cryptosporidium, which contains any of the above-mentioned complex microbial agents or any of the above-mentioned compositions.

[0025] The present application also provides a product for treating and / or preventing cryptosporidiosis, which contains any of the above-mentioned complex microbial agents or any of the above-mentioned compositions.

[0026] The present application also provides a product for improving intestinal function, which contains any of the above-mentioned complex microbial agents or any of the above-mentioned compositions.

[0027] The improvement of intestinal function is manifested by increasing the content of acetic acid and / or propionic acid and / or butyric acid in the intestinal contents. The improvement of intestinal function is manifested by increasing the content of acetic acid and / or propionic acid and / or butyric acid in the intestinal contents of Cryptosporidium infected individuals. The improvement of intestinal function is manifested by increasing the content of acetic acid and / or propionic acid and / or butyric acid in the contents of the jejunum and ileum. The improvement of intestinal function is manifested by increasing the content of acetic acid and / or propionic acid and / or butyric acid in the contents of the jejunum and ileum of Cryptosporidium infected individuals. The improvement of intestinal function is manifested by increasing the content of acetic acid and / or propionic acid in the contents of the colon. The improvement of intestinal function is manifested by increasing the content of acetic acid and / or propionic acid in the contents of the colon of Cryptosporidium infected individuals.

[0028] The improvement of intestinal function is manifested by enhancing the intestinal mucus barrier function. The improvement of intestinal function is manifested by enhancing the intestinal mucus barrier function of Cryptosporidium infected individuals. The enhancement of intestinal mucus barrier function is manifested by increasing the thickness of the ileal mucus layer. The enhancement of intestinal mucus barrier function is manifested by increasing the thickness of the ileal mucus layer of Cryptosporidium infected individuals. The enhancement of intestinal mucus barrier function is manifested by increasing the number of Muc2 positive goblet cells in the ileum. The enhancement of intestinal mucus barrier function is manifested by increasing the number of Muc2 positive goblet cells in the ileum of Cryptosporidium infected individuals.

[0029] The cryptosporidiosis refers to a disease caused by Cryptosporidium infection.

[0030] Specifically, the Cryptosporidium is Cryptosporidium parvum.

[0031] Any of the above-mentioned products can be a pharmaceutical product.

[0032] Bifidobacterium pseudolongum Bif, which was preserved in China General Microbiological Culture Collection Center (CGMCC, located at No. 1, Huayuancun, Beijing, China) on October 09, 2024, and the preservation registration number is CGMCC No. 32159.

[0033] Bacteroides thetaiotaomicron Bac, which was preserved in China General Microbiological Culture Collection Center (CGMCC, located at No. 1, Huayuancun, Beijing, China) on October 09, 2024, and the preservation registration number is CGMCC No. 32160.

[0034] In the embodiments of the present application, the efficacy of the oral synbiotic composition is proved by using an animal model infected with Cryptosporidium: reducing the detection amount of Cryptosporidium oocysts in feces; increasing the content of acetic acid, propionic acid and butyric acid in intestinal contents; and enhancing the intestinal mucus barrier function (increasing the thickness of the ileal mucus layer and increasing the number of goblet cells).

[0035] The composition provided by the present application has the functions of reducing the intensity of Cryptosporidium infection and improving the intestinal mucus barrier. The present application has industrial value in the field of medicine. BRIEF DESCRIPTION OF DRAWINGS

[0036] Figure 1 It is a microscopic image of Bifidobacterium pseudolongum Bif after Gram staining.

[0037] Figure 2 It is a microscopic image of Bacteroides thetaiotaomicron Bac after Gram staining.

[0038] Figure 3 It is a schematic diagram of the test procedure of Example 4.

[0039] Figure 4 It is a standard curve and a standard curve equation in Example 4.

[0040] Figure 5 It is the result of detecting the content of Cryptosporidium oocysts in feces in Example 4.

[0041] Figure 6 It is the initial weight result (a) and the weight result (b) after the experiment of mice in Example 4.

[0042] Figure 7 It is the result of intestinal flora composition analysis (phylum level composition analysis) in Example 4.

[0043] Figure 8Results of the analysis of the intestinal flora composition (genus level composition analysis) in Example 4.

[0044] Figure 9 Results of the analysis of the short-chain fatty acid content in the intestine in Example 4.

[0045] Figure 10 Photos under the optical microscope during the analysis of the intestinal mucus barrier function in Example 4.

[0046] Figure 11 Quantitative results of the analysis of the intestinal mucus barrier function in Example 4.

[0047] Figure 12 Schematic diagram of the test procedure of Example 6.

[0048] Figure 13 Results of the detection of the content of Cryptosporidium parvum oocysts in feces in Example 6.

[0049] Figure 14 Results of the determination of the flora abundance (copy number of 16S rRNA gene) in Example 6.

[0050] Figure 15 Results of the determination of the flora abundance (copy number of Bifidobacterium longum and copy number of Bacteroides thetaiotaomicron) in Example 6. DETAILED DESCRIPTION

[0051] The application will be further described in conjunction with the specific embodiments, and the examples given are only for the purpose of illustrating the application, but not for limiting the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the application.

[0052] The experimental methods in the following examples are all routine methods, unless otherwise specified, which are performed according to the techniques or conditions described in the literature in the art or according to the instructions of the products. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially. The quantitative tests in the following examples, unless otherwise specified, are all set up in triplicate, and the results are averaged. Guar gum (also known as guar bean gum or Guar gum) (specification: "viscosity: 5000-5500 cps; 200 mesh") (CAS No.: 9000-30-0): Aladdin Reagent (Shanghai) Co., Ltd., product catalog No. G109238. Mineral mixture (AIN 93G mineral mixture): MP Biomedicals. Vitamin mixture (AIN-93-Vx mixed vitamins): MP Biomedicals. Stool DNA extraction kit (E.Z.N.A. stool DNA kit): Omega Biotek Inc., USA, product catalog No. M4015-02. Sterile defibrinated horse blood: Zhengzhou Denying Biotechnology Co., Ltd., product catalog No. DX208. Bifidobacterium pseudolongum counting method: colony-forming units were measured after solid TPY broth culture under anaerobic conditions. Bacteroides thetaiotaomicron counting method: colony-forming units were measured after solid EG medium containing horse blood was cultured under anaerobic conditions. Anaerobic culture method: cultured in an anaerobic box (in which an anaerobic gas generator bag and an oxygen indicator were added to achieve an oxygen-free environment). Anaerobic gas generator bag (2.5L specification): Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd., product catalog No. HBYY001. Oxygen indicator: Qingdao High-tech Industrial Park Haibo Biotechnology Co., Ltd., product catalog No. HBYY004. Anaerobic box (2.5L specification): Mitsubishi, product catalog No. C-31.

[0053] Liquid TPY broth medium (pH 6.5): contains 10.0 g of hydrolyzed casein, 5.0 g of vegetable peptone, 2.0 g of yeast powder, 5.0 g of glucose, 0.5 g of L-cysteine, 2.0 g of potassium phosphate dibasic, 0.5 g of magnesium chloride, 0.25 g of zinc sulfate, 0.15 g of calcium chloride, 0.001 g of ferric chloride, and 1.0 g of Tween 80 per liter, with the balance being distilled water. The difference between the solid TPY broth medium and the liquid TPY broth medium is only that 20 g of agar is added per liter.

[0054] Preparation method of solid EG medium containing horse blood: take beef extract powder 2.4 g, peptone 10.0 g, yeast extract powder 5.0 g, sodium phosphate dibasic 4.0 g, glucose 1.5 g, soluble starch 0.5 g, L-cystine 0.2 g, L-cysteine hydrochloride 0.5 g, and agar 15.0 g, add distilled water to 1 L, adjust pH to 7.6-7.8, sterilize by high pressure, then add 50 mL sterile defibrillated horse blood.

[0055] Cryptosporidium tyzzeri, described in the following document: Molecular characterization of Cryptosporidium spp., Enterocytozoon bieneusi and Giardia duodenalis in laboratory rodents in China; Parasite 29, 46 (2022).

[0056] Example 1, isolation, identification and preservation of Bifidobacterium pseudolongum Bif

[0057] Strain Bif was isolated and screened from mouse feces.

[0058] Morphological characteristics of strain Bif: gram-positive, non-motile, rod-shaped cells, sometimes bifurcated at one end, strictly anaerobic bacteria. The microscope photo of strain Bif after gram staining is shown in Figure 1 .

[0059] Physiological and biochemical characteristics of strain Bif: α-galactosidase, β-galactosidase, α-glucosidase, α-arabinosidase, alkaline phosphatase, arginine arylase, leucyl glycine arylase, phenylalanine arylase, pyroglutamic acid arylase, tyrosine arylase, alanine arylase, glycine arylase, glutamyl glutamic acid arylase positive; can ferment mannose.

[0060] The sequencing results of the characteristic segment of the 16S rRNA gene coding sequence in the genomic DNA of strain Bif are shown as SEQ ID NO: 1, and the sequencing results are subjected to homology comparison in NCBI.

[0061] Based on the above morphological characteristics, physiological and biochemical characteristics and molecular identification results, strain Bif belongs to Bifidobacterium pseudolongum, which is named Bifidobacterium pseudolongum Bif.

[0062] Bifidobacterium pseudolongum Bif, which was preserved in China General Microbiological Culture Collection Center (CGMCC, located at No. 1, Huayuancun, Beijing, China) on October 09, 2024, and the preservation registration number is CGMCC No. 32159.

[0063] Example 2, isolation, identification and preservation of Bacteroides thetaiotaomicron Bac

[0064] Strain Bac was isolated and screened from mouse feces.

[0065] Morphological characteristics of strain Bac: gram-negative, non-spore-forming, obligate anaerobic small rod-shaped bacteria. The microscope photograph of strain Bac after gram staining is shown in Figure 2 .

[0066] Physiological and biochemical characteristics of strain Bac: positive for alpha-galactosidase, beta-galactosidase, alpha-glucosidase, alpha-arabinosidase, arginine arylase, proline arylase, phenylalanine arylase, leucine arylase, pyroglutamic acid arylase, tyrosine arylase, alanine arylase, glycine arylase, histidine arylase, glutamylglutamic acid arylase, serine arylase; can ferment mannose and can convert L-tryptophan to indole.

[0067] The sequencing result of the characteristic segment of the 16S rRNA gene coding sequence in the genomic DNA of strain Bac is shown as SEQ ID NO: 2, and the sequencing result is subjected to homology comparison in NCBI.

[0068] Based on the above morphological characteristics, physiological and biochemical characteristics and molecular identification results, strain Bac belongs to Bacteroides thetaiotaomicron, and is named as Bacteroides thetaiotaomicron Bac.

[0069] Bacteroides thetaiotaomicron Bac, which was preserved in China General Microbiological Culture Collection Center (CGMCC, located at No. 1, Huayuancun, Beijing, China) on October 09, 2024, and the preservation registration number is CGMCC No. 32160.

[0070] Example 3, preparation of feed

[0071] I. Preparation of feed A (feed without dietary fiber)

[0072] The raw materials (total mass of 1 kg) were mixed with water according to the formulation of Table 1, and then pelletized by extrusion using a pelletizer. The moisture content of the pelletized feed was 6-8%, and the shape was cylindrical (cylindrical base diameter of about 0.6 cm, cylindrical height of 3-4 cm). The pelletized feed was vacuum packaged and stored at 4°C.

[0073] Table 1

[0074] Ingredients g Casein 200.0 L-cystine 3.0 Corn starch 447.486 Maltodextrin 132.0 Sucrose 100.0 Soybean oil 70.0 Mineral mix 35.0 Vitamin mix 10.0 Choline tartrate 2.5 TBHQ antioxidant 0.014

[0075] II. Preparation of feed B (feed containing 10% guar gum)

[0076] The raw materials (total mass of 1 kg) were mixed with water according to the formulation of Table 2, and then pelletized by extrusion using a pelletizer. The moisture content of the pelletized feed was 6-8%, and the shape was cylindrical (cylindrical base diameter of about 0.6 cm, cylindrical height of 3-4 cm). The pelletized feed was vacuum packaged and stored at 4°C.

[0077] Table 2

[0078] Ingredients g Casein 200.0 L-cystine 3.0 Corn starch 347.486 Maltodextrin 132.0 Sucrose 100.0 Guar gum 100.0 Soybean oil 70.0 Mineral mix 35.0 Vitamin mix 10.0 Choline tartrate 2.5 TBHQ antioxidant 0.014

[0079] Example 4, Animal efficacy test (effect of guar gum)

[0080] The test animals were SPF C57BL / 6J mice (3 weeks old, female, body weight difference less than 1 g). They were raised in a SPF animal laboratory at 20-25°C, 12 h light / 12 h dark. The challenge material was prepared by suspending T. taillai oocysts in physiological saline to a concentration of 1 x 10 7 Figure 3 .

[0081] I. Grouping and treatment

[0082] The test animals were randomly divided into two groups, 10 in each group.

[0083] NDF group: first adaptive feeding with feed A for 5 days, then gavage with challenge material (0.1 mL of challenge material per mouse), and then feeding with feed A for 56 days.

[0084] GG group: first adaptive feeding with feed B for 5 days, then gavage with challenge material (0.1 mL of challenge material per mouse), and then feeding with feed B for 56 days.

[0085] During the feeding process, the animals had free access to water and feed.

[0086] ​During the process of group treatment, collect feces regularly, namely feces samples. The method of collecting feces is as follows: feed each mouse in a single cage, normally provide feed and drinking water, and collect feces after 12 hours of feeding.

[0087] II. Detecting the content of T. tenuis oocysts in feces samples

[0088] 1. Making a standard curve

[0089] Make T. tenuis oocysts suspended in normal saline, so that the content of oocysts is 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 or 10 / mL, namely oocyst suspensions with different oocyst contents. Mix 0.1 mL of oocyst suspension with 0.1 g of negative feces, namely feces standard samples. Take feces standard samples, freeze-thaw repeatedly with liquid nitrogen and a 90°C water bath for 3 times, then extract DNA by using a feces DNA extraction kit according to the instructions, then perform qPCR (use upstream primer F1, downstream primer R1 and probe P1) to make a standard curve.

[0090] The nucleotide sequence of upstream primer F1 is ATGACGGGTAACGGGGAAT;

[0091] The nucleotide sequence of downstream primer R1 is CCAATTACAAAACCAAAAAGTCC;

[0092] The nucleotide sequence of probe P1 is CGCGCCTGCTGCCTTCCTTAGATG.

[0093] The standard curve and the standard curve equation are shown in Figure 4 . In the standard curve equation, Y is the Ct value, and X is the logarithm value of the number of T. tenuis oocysts with 10 as the base.

[0094] 2. Detecting the content of T. tenuis oocysts in feces

[0095] Take 0.1 g of feces samples, freeze-thaw repeatedly with liquid nitrogen and a 90°C water bath for 3 times, then extract DNA by using a feces DNA extraction kit according to the instructions, then perform qPCR (use upstream primer F1, downstream primer R1 and probe P1) to obtain the Ct value. Substitute the Ct value into the standard curve equation to calculate the number of T. tenuis oocysts per gram of feces samples.

[0096] The results are shown in Figure 5 ( Figure 5The horizontal axis in the figure is the sampling time in days from the completion of the challenge. The number of oocysts in the feces of the GG group mice was significantly lower than that of the NDF group mice on days 3, 12, 15, 27, 33, 39, 45, 51, and 57 after infection (*: P < 0.05, **: P < 0.01).

[0097] III. After the grouping and at the end of the experiment, the mice were weighed.

[0098] The results are shown in Figure 6 There was no significant difference in the body weight of the mice in the two groups after the grouping and at the end of the experiment.

[0099] IV. Analysis of intestinal flora composition

[0100] After the grouping in step I, fecal samples were taken from 6 mice in each group (N1 to N6 for the 6 mice in the NDF group and G1 to G6 for the 6 mice in the GG group). The fecal samples were extracted for DNA using a fecal DNA extraction kit according to the instructions, and 16S rRNA gene sequencing and bioinformatics analysis were performed (completed by Beijing Nuowozhuyuan Technology Co., Ltd.).

[0101] The results of the analysis of the composition of the bacterial phylum in the feces are shown in Figure 7 The results of the analysis of the flora showed (at the phylum level) that the abundance of the Actinobacteria and Bacteroidetes phyla in the feces of the GG group mice was higher than that in the feces of the NDF group mice. The results of the analysis of the composition of the bacterial genus in the feces are shown in Figure 8 The results of the analysis of the flora showed (at the genus level) that the abundance of the Bifidobacterium and Bacteroides genera in the feces of the GG group mice was significantly higher than that in the feces of the NDF group mice.

[0102] V. Analysis of the content of short-chain fatty acids in the intestinal contents

[0103] After the grouping in step I and the collection of the last fecal sample, the mice were sacrificed by cervical dislocation, and the contents of the jejunoileum and the colon were taken. Quantitative detection of the content of short-chain fatty acids was performed (completed by Beijing Hexin Technology Co., Ltd.).

[0104] The content of short-chain fatty acids in the jejunoileum contents is shown in Figure 9 A-C. The content of short-chain fatty acids in the colon contents is shown in Figure 9 D-F. The content of acetic acid, propionic acid, and butyric acid in the jejunoileum contents of the GG group mice was significantly higher than that in the jejunoileum contents of the NDF group mice. The content of acetic acid and propionic acid in the colon contents of the GG group mice was significantly higher than that in the colon contents of the NDF group mice.

[0105] VI. Analysis of the intestinal mucus barrier function

[0106] Muc2 as an important biomarker plays a key role in intestinal health, inflammatory response and tumor occurrence. Muc2 antibody: abcam company, product catalog number is ab272692.

[0107] After the mice were sacrificed in step five, the intestinal tissues were taken back, trimmed into tissue blocks, then paraffin-embedded and made into paraffin sections (5 pm in thickness), then immunohistochemical staining was performed (primary antibody: Muc2 antibody). Photographed under an optical microscope, the crypt depth and mucus layer thickness in ileum tissues were measured using Image J (Media Cybernetics, inc., Rockville, MD, USA). Observed and counted the mucus-producing goblet cells under an optical microscope (5-7 microscope fields were randomly selected for each section).

[0108] The photographs under an optical microscope are shown in Figure 10 . The number of positive goblet cells in each crypt in the field of view is shown in Figure 11 a. The average villus length in the field of view is shown in Figure 11 b. The results of the mucus layer thickness in the field of view are shown in Figure 11 c. The results of the crypt depth in the field of view are shown in Figure 11 d. The results show that: compared with NDF mice, the mucus layer thickness and the number of positive goblet cells in a single crypt of GG mice are significantly increased.

[0109] Example 5, preparation of probiotic bacterial suspension

[0110] I. Preparation of Bifidobacterium pseudolongum bacterial suspension

[0111] 1. Prepare liquid TPY broth medium, then distribute it into glass test tubes, then add 2 mL of liquid paraffin to each test tube (the paraffin layer is on the culture medium, which plays a sealing role), then autoclave, then stand and cool.

[0112] 2. Take the test tube completed in step 1, use a inoculation needle to prick and inoculate Bifidobacterium pseudolongum Bif under the culture medium under the paraffin layer, and incubate at 37°C for 48 h.

[0113] 3. After completing step 2, use a syringe to suck the bacterial liquid (note that the precipitate should not be sucked out), then centrifuge at 4°C, 4000g for 5 min, collect the bacterial precipitate, wash it with sterile PBS buffer for 3 times (each time is centrifuged at 4°C, 4000g for 5 min, then the bacterial precipitate is collected), then resuspended with PBS buffer to obtain a bacterial suspension with a content of 10 9 cfu / mL of Bifidobacterium pseudolongum.

[0114] II. Preparation of Bacteroides thetaiotaomicron bacterial suspension

[0115] 1. Bacteroides thetaiotaomicron Bac was inoculated on solid EG medium containing horse blood, and incubated anaerobically at 37°C for 48 h.

[0116] 2. After step 1, the bacteria on the surface of the culture medium were collected with sterile PBS buffer, and then centrifuged at 4000g for 5 min at 4°C to collect the bacterial precipitate. The bacterial precipitate was washed three times with sterile PBS buffer (each time, centrifuged at 4000g for 5 min at 4°C, and then the bacterial precipitate was collected), and then resuspended with PBS buffer to obtain a Bacteroides thetaiotaomicron bacterial suspension with a content of 10 9 cfu / mL.

[0117] Example 6, Animal efficacy test (effect of the probiotic composition)

[0118] The test animals were SPF C57BL / 6J mice (3 weeks old, female). They were bred in an SPF animal laboratory at 20-25°C with 12 h light / 12 h dark. The challenge was prepared by suspending T. taillai oocytes in normal saline to obtain a content of 1 x 10 7 Figure 12 (the day of challenge was taken as day 0, and the days before challenge were taken as day -1, day -2, etc., and the days after challenge were taken as day 1, day 2, etc.). The preparation method of 0.2 mL of the complex bacterial solution was as follows: 0.1 mL of the bacterial suspension of Bifidobacterium pseudolongum with a content of 10 9 cfu / mL prepared in Example 5 and 0.1 mL of the bacterial suspension of Bacteroides thetaiotaomicron with a content of 10 9 cfu / mL were mixed to obtain the complex bacterial solution.

[0119] I. The test animals were first adaptively bred for 3 days (free access to sterile water and free access to SPF maintenance feed), and then randomly divided into two groups (8 mice in each group) for group breeding.

[0120] The GG-Vehical group: on day -6, day -5, day -4 and day -3, ampicillin, neomycin and vancomycin were added to the drinking water of the mice (to obtain an ampicillin content of 1 g / L, a neomycin content of 1 g / L and a vancomycin content of 0.5 g / L) to eliminate the original microorganisms in the intestinal tract of the mice; on day 0, the challenge (0.1 mL of challenge per mouse) was administered by gavage;

[0121] ​GG-Bif-Bac group: On day -6, day -5, day -4 and day -3, ampicillin, neomycin and vancomycin were added to the drinking water of the mice (1 g / L of ampicillin, 1 g / L of neomycin, 0.5 g / L of vancomycin) to eliminate the original microorganisms in the intestinal tract of the mice; on day 0, the mice were orally administered with the challenge (0.1 mL of challenge per mouse); on day -3, day -2, day 1 and day 2, the mice were orally administered with the compound bacterial solution once (0.2 mL of compound bacterial solution per mouse);

[0122] During the grouping and feeding process, the mice were allowed to drink water and eat feed freely.

[0123] From day -6 to day 9, a total of 16 days, the average amount of feed eaten by each mouse per day was 2 g (0.2 g of guar gum in 2 g of feed).

[0124] II. Detection of the content of Cryptosporidium parvum oocysts in feces

[0125] During the grouping and feeding process, the mice were allowed to drink water and eat feed freely.

[0126] The method for detecting the content of Cryptosporidium parvum oocysts in feces was the same as step II of Example 4.

[0127] The results are shown in Figure 13 ( Figure 13 The horizontal coordinate in FIG. 6 is the sampling time in days from the completion of the challenge. Compared with the mice in the GG-Vehical group, the mice in the GG-Bif-Bac group had a significantly reduced amount of oocysts in feces (**: P < 0.01).

[0128] IV. Determination of the abundance of flora

[0129] During the grouping and feeding process, the mice were allowed to drink water and eat feed freely.

[0130] The fecal samples were taken, and genomic DNA was extracted using a fecal DNA extraction kit and according to the instructions. The copy number of 16S rRNA gene, the copy number of Bif gene of Bifidobacterium longum and the copy number of Bac gene of Bacteroides thetaiotaomicron were detected using the genomic DNA as a template. The primer sequences are shown in Table 3.

[0131] Table 3

[0132]

[0133] The abundance results of the copy number of 16S rRNA gene (reaction fecal flora abundance) are shown in Table 1. Figure 14 The results of the copy number of Bifidobacterium pseudolongum and the copy number of Bacteroides thetaiotaomicron are shown in Table 2. Figure 15 The results show that the abundance of the two bacteria in the intestinal flora of mice is significantly improved after feeding guar gum and simultaneously supplementing Bifidobacterium pseudolongum and Bacteroides thetaiotaomicron.

[0134] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In short, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including the change made by the conventional technology known in the art, which is out of the range disclosed in this application. Some basic features can be applied according to the scope of the following attached claims.

Claims

1. An anti-Cryptosporidium synbiotic formulation, characterized in that: The anti-cryptosporidium synbiotic preparation is composed of Bifidobacterium pseudolongum (Bif) Bifidobacterium pseudolongum ), Bacteroides thetaiotaomicron (Bac) Bacteroides thetaiotaomicron ) and guar gum; the preservation accession number of the Bifidobacterium pseudolongum Bif is CGMCC No. 32159; the preservation accession number of the Bacteroides thetaiotaomicron Bac is CGMCC No. 32160.

2. Use of the anti-Cryptosporidium probiotic preparation according to claim 1 in the manufacture of a product; the product being (al) or (a2) below: (al) a product for inhibiting Cryptosporidium; (a2) a product for treating and / or preventing cryptosporidiosis.

3. Use of the anti-Cryptosporidium probiotic preparation according to claim 1 in the manufacture of a product; the product being a product for improving intestinal function.

4. A product for inhibiting Cryptosporidium, comprising the anti-Cryptosporidium probiotic preparation according to claim 1.

5. A product for treating and / or preventing cryptosporidiosis, comprising the anti-Cryptosporidium probiotic preparation according to claim 1.

6. A product for improving intestinal function, comprising the anti-Cryptosporidium probiotic preparation according to claim 1.

Images