A micrococcus that knocks out a gene, and a construction method and application thereof

Abstract

This invention relates to a gene-knockout Micromonas micrococcus, its construction method, and its applications. The gene-knockout Micromonas micrococcus is constructed by knocking out the appa gene in the Micromonas micrococcus genome. The construction method is as follows: (1) Obtaining the upstream and downstream homologous arm fragments of the gene to be knocked out, appa; (2) Obtaining the ermB resistance gene fragment; (3) Sequentially connecting the upstream homologous arm fragment, the ermB resistance gene, and the downstream homologous arm fragment; (4) Transforming the fused DNA fragment into Micromonas micrococcus through natural transformation; (5) Screening to obtain Micromonas micrococcus with the target gene appa knocked out. This invention is the first to achieve gene knockout in Micromonas micrococcus using natural transformation, effectively overcoming the difficulties in transforming and gene editing Micromonas micrococcus. The constructed Micromonas micrococcus with the appa gene knocked out can be used to study the autophagy mechanism of periodontal ligament stem cells (hPDLSCs).

Description

Technical Field

[0001] This invention relates to a gene-knockout micromonad, its construction method, and its application, belonging to the field of molecular biology technology. Background Technology

[0002] Periodontitis, characterized by gingival recession and alveolar bone resorption, is the most common inflammatory disease in the human oral cavity. Besides being a leading cause of tooth loss in adults, periodontitis is also a potential risk factor for a variety of systemic diseases, such as Alzheimer's disease, cardiovascular disease, and various types of cancer.6 Among the complex factors contributing to chronic periodontitis, the microorganisms in dental plaque are considered a major contributing factor.

[0003] Current research on the pathogenesis of periodontitis mainly focuses on several classic Gram-negative bacteria, such as *Porphyromonas gingivalis* and *Fusobacterium nucleatum*. In recent years, a previously underestimated periodontitis pathogen, *Parvimonas micra* (P. micra), has received increasing attention due to its close relationship with gastrointestinal tumors. *P. micra* is classified as a periodontal pathogen associated with the "orange complex" of periapical abscesses, chronic periapical periodontitis, and periodontal disease. Furthermore, *P. micra* is involved in the development of a range of systemic diseases, such as colorectal cancer, pleural effusion, and bloodstream infections.

[0004] AppA has been identified as a surface protein of *P. micra*, which participates in autophagy by binding to proteins in human periodontal ligament cells (hPDLSCs), thereby promoting their intracellular survival. Therefore, constructing gene knockout strains allows for a more comprehensive study of the role of appa in *P. micra* evading autophagy, and provides new insights into understanding the complex pathogenesis of periodontitis. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a gene-knockout micromonad, its construction method, and its applications.

[0006] The technical solution of the present invention is as follows:

[0007] A type of Micromonas microsporidium with the appa gene knocked out is constructed by knocking out the appa gene in the genome of Micromonas microsporidium; the NCBI accession number of the appa gene is NCTC11808_00643.

[0008] The method for constructing the above-mentioned gene-knockout Micromonas microbe includes the following steps:

[0009] (1) Using the genome of Micromonas microphylla as a template, primers were designed and PCR amplification was performed to obtain the upstream and downstream homologous arm fragments of the gene appa to be knocked out.

[0010] (2) The ermB resistance gene template was artificially synthesized, primers were designed, and the ermB resistance gene fragment was obtained by PCR amplification.

[0011] (3) The upstream homologous arm fragment, the ermB resistance gene fragment and the downstream homologous arm fragment were sequentially ligated by overlap PCR to obtain a fusion DNA fragment;

[0012] (4) Dissolve the fusion DNA fragment in double-distilled water to obtain a fusion DNA fragment solution; then add the fusion DNA fragment solution dropwise onto BHI solid medium and let it stand for 12-24 hours to obtain a medium containing the fusion DNA fragment.

[0013] Micromonas microbiota were cultured to obtain a Micromonas microbiota suspension; then the Micromonas microbiota suspension was added dropwise to a culture medium containing a fusion DNA fragment and cultured under anaerobic conditions at 37°C for 24–48 h to allow the fusion DNA fragment to be transformed into Micromonas microbiota.

[0014] (5) The transformed micromonads were spread onto BHI solid medium containing erythromycin and cultured for 4 to 8 days. After screening, micromonads with the target gene appa knocked out (PmΔappa) were obtained.

[0015] According to a preferred embodiment of the present invention, in step (1), the length of the upstream homologous arm fragment of the gene to be knocked out, appa, is 1303 bp, and the length of the downstream homologous arm fragment of appa is 1371 bp.

[0016] According to a preferred embodiment of the present invention, in step (1), the primer sequences for amplifying the upstream homologous arm fragment are as follows:

[0017] 1F: 5'-GAAATATCAACTAATTTTTTATCAGCAACA-3',

[0018] 1R: 5'-CTTATCTCCATTATATCTTATATAATTTATAATACAAAAGTGTGGAACA-3';

[0019] The primer sequences for amplifying the downstream homologous arm fragment are as follows:

[0020] 3F: 5'-CTATGAGTCGCCTTAAGTCCTCCTTGAGAAAAAAATAATT-3',

[0021] 3R: 5'-AAATTCAGACCTTTATAGCAAAGTTAAAG-3'.

[0022] According to a preferred embodiment of the present invention, in step (2), the NCBI accession number of the ermB resistance gene is AB057644;

[0023] The primer sequences for amplifying the ermB resistance gene are as follows:

[0024] 2F: 5'-AAGATATAATGGGAGATAAGACGTTC-3',

[0025] 2R: 5'-GGACTTAAGGCGACTCATAGAATTATTTCCTCCC-3'.

[0026] According to a preferred embodiment of the present invention, in step (3), the upstream homologous arm fragment, the ermB resistance gene and the downstream homologous arm fragment are ligated using the Clon Express One Step Cloning Kit.

[0027] According to a preferred embodiment of the present invention, in step (4), the concentration of the fusion DNA fragment solution is 0.01 to 0.1 μg / μL; preferably 0.05 μg / μL.

[0028] According to a preferred embodiment of the present invention, in step (4), the volume ratio of the fusion DNA fragment solution to the Micromonas micrococcus culture is 1:1.

[0029] According to a preferred embodiment of the present invention, in step (5), the screening is performed by detecting mutants using the homologous arm inner primer 4F / 4R;

[0030] The sequences of the primers 4F / 4R are as follows:

[0031] 4F: 5'-GAATTGTGATGTAATAAATATAT-3'

[0032] 4R: 5'-GCTTTCTATAACAAATTGTG-3'.

[0033] The above-mentioned application of knockout Micromonas appa in the study of autophagy mechanism of periodontal ligament stem cells (hPDLSCs).

[0034] Beneficial effects:

[0035] 1. This invention is the first to achieve gene knockout in Micromonas microsporum using natural transformation, effectively overcoming the difficulty of transforming and gene editing Micromonas microsporum. Furthermore, the naturally transformed DNA enters Micromonas microsporum in single-stranded form, unlike artificially introduced double-stranded DNA. Single-stranded DNA is largely resistant to degradation by most bacterial restriction endonucleases.

[0036] 2. The method for gene knockout of Micromonas microsporum provided by this invention does not require the construction and introduction of expression vectors, and can directly perform genetic complementation editing, reducing the experimental steps of developing plasmids that are compatible with bacteria.

[0037] 3. The *Micromonas microsporum* strain with the *appa* gene knocked out provided by this invention can be used in the study of autophagy mechanisms in periodontal ligament stem cells (hPDLSCs). The constructed *Micromonas microsporum* strain with the *appa* gene knocked out can increase the proportion of intracellular autolysosomes. Compared with wild-type *P. micra* (PmWT), the *Micromonas microsporum* strain with the *appa* gene knocked out (PmΔappa) weakens autophagy damage to periodontal ligament stem cells in vitro. Attached Figure Description

[0038] Figure 1 This is a schematic diagram of gene knockout in Micromonas microphylla.

[0039] Figure 2 The results of identification of Micromonas microphylla with the appa gene knocked out.

[0040] Figure 3 The effect of micromonas microsporum knockout of the target gene appa on autophagy of periodontal ligament stem cells (hPDLSCs). Detailed Implementation

[0041] The technical solution of the present invention will be further described below with reference to specific experimental examples, but the scope of protection of the present invention is not limited thereto. Unless otherwise specified, the reagents and materials involved in the examples are all commercially available products.

[0042] Micromonas microphylla (P. microsporum) ATCC 33270 is the standard type strain and can be obtained through commercial purchase.

[0043] Periodontal ligament stem cells (PDLSCs) are available for purchase at Shanghai Basic Culture Technology Co., Ltd.

[0044] Example 1: Knockout of the appa gene in Micromonas vaginalis

[0045] like Figure 1 As shown, a method for gene knockout in Micromonas microphylla includes the following steps:

[0046] (1) After thawing the Micromonas microsporidium (P. microra) ATCC 33270 strain, inoculate it onto BHI solid medium containing 10% sterile defibrinated sheep blood. In an anaerobic incubator containing 80% N2, 10% CO2 and 10% H2, incubate at 37°C for 3-5 days until colonies grow on BHI agar solid medium. Pick a single colony and inoculate it into Schaedler anaerobic broth medium and continue to culture for 3-5 days until it grows to the logarithmic phase. Collect the bacterial culture and extract the Micromonas microsporidium genome using a genome extraction kit.

[0047] Using the genome of Micromonas microphylla as a template, primers 1F / 1R and 3F / 3R were designed for the homologous arm of the gene appa to be knocked out. The upstream and downstream homologous arm fragments of the gene appa to be knocked out were obtained by PCR amplification. The NCBI accession number of the appa gene is NCTC11808_00643.

[0048] The sequence of the primers 1F / 1R used to amplify the upstream homologous arm fragment is as follows:

[0049] 1F: 5'-GAAATATCAACTAATTTTTTATCAGCAACA-3',

[0050] 1R: 5'-CTTATCTCCATTATATCTTATATAATTTATAATACAAAAGTGTGGAACA-3';

[0051] The sequences of the primers 3F / 3R used to amplify the downstream homologous arm fragment are as follows:

[0052] 3F: 5'-CTATGAGTCGCCTTAAGTCCTCCTTGAGAAAAAAATAATT-3',

[0053] 3R: 5'-AAATTCAGACCTTTATAGCAAAGTTAAAG-3';

[0054] The PCR amplification system was as follows: 50 μl system, including 200 ng template, 0.4 μM each of upstream and downstream primers, 25 μL of 2×Phanta Flash Master Mix, and the remainder made up with water;

[0055] The PCR amplification program was as follows: pre-denaturation at 98℃ for 30s, denaturation at 98℃ for 10s; annealing at 58℃ for 5s; extension at 72℃, 5-10s / kb, 55sec (30 cycles); termination extension for 1min; and final incubation at 4℃.

[0056] (2) The ermB resistance gene template was artificially synthesized by BGI Genomics Co., Ltd., primers 2F / 2R were designed, and the ermB resistance gene fragment (NCBI accession number AB057644) was obtained by PCR amplification.

[0057] The sequence of the primers 2F / 2R for amplifying the ermB resistance gene is as follows:

[0058] 2F: 5'-AAGATATAATGGGAGATAAGACGTTC-3',

[0059] 2R: 5'-GGACTTAAGGCGACTCATAGAATTATTTCCTCCC-3';

[0060] The PCR amplification system was as follows: 50 μl system, including 200 ng template, 0.4 μM each of upstream and downstream primers, 25 μL of 2×Phanta Flash Master Mix, and the remainder made up with water;

[0061] The PCR amplification program was as follows: pre-denaturation at 98℃ for 30s, denaturation at 98℃ for 10s; annealing at 58℃ for 5s; extension at 72℃, 5-10s / kb, 55sec (30 cycles); termination extension for 1min; and final incubation at 4℃.

[0062] (3) Using the Clon Express One Step Cloning Kit, the upstream homologous arm fragment, the ermB resistance gene and the downstream homologous arm fragment were sequentially ligated by the overlap PCR method to obtain the fusion DNA fragment;

[0063] (4) Dissolve 1 μg of fusion DNA fragment in 20 μL of double-distilled water to obtain a fusion DNA fragment solution with a concentration of 0.05 μg / μL; then add 20 μL of fusion DNA fragment solution to BHI solid medium and let it stand for 24 h to obtain a medium containing fusion DNA fragment.

[0064] Micromonas microspora ATCC 33270 bacterial suspension was streaked onto BHI solid medium and cultured in an anaerobic incubator for 3–5 days until single colonies appeared, following the conditions in step (1). Micromonas microspora were collected from the BHI solid medium using a disposable inoculation loop and inoculated into a BHI liquid medium containing 1 mL. The loop was rotated to promote bacterial release into the medium, and the cell suspension concentration was adjusted to OD600 = 0.4 to obtain a Micromonas microspora bacterial suspension. Then, 20 μL of the Micromonas microspora bacterial suspension (OD600 = 0.4) was added dropwise to a medium containing a fusion DNA fragment and cultured under anaerobic conditions at 37°C for 36 h to allow the fusion DNA fragment to be transformed into Micromonas microspora.

[0065] (5) The transformed Micromonas were spread onto BHI solid medium containing erythromycin and cultured for 5 days to obtain mutant transformants; the transformants were screened and identified using primers 4F / 4R to obtain Micromonas with the target gene appa knocked out (Pm△AppA);

[0066] The sequences of the primers 4F / 4R are as follows:

[0067] 4F: 5'-GAATTGTGATGTAATAAATATAT-3',

[0068] 4R: 5'-GCTTTCTATAACAAATTGTG-3'.

[0069] The results of genome identification of the knockout strain using primers 1F / 3R, 4F / 4R and 2F / 3R are as follows: Figure 2 As shown. Figure 2 The WT sample was wild-type P. micra and served as the control group.

[0070] Depend on Figure 2 It can be seen that, compared with wild-type *Micromonas microphylla*, the appa gene in the selected strain has been knocked out from the *Micromonas microphylla* genome, and the ermB gene has successfully replaced the appa gene. This invention successfully achieved gene knockout in *Micromonas microphylla* through natural transformation, constructing a *Micromonas microphylla* strain with the target gene appa knocked out.

[0071] Example 2: Application of Micromonas microsporum with the appa gene knocked out in the study of autophagy mechanism in periodontal ligament stem cells (hPDLSCs)

[0072] 1. Periodontal ligament stem cell culture

[0073] Periodontal ligament stem cells (PDLSCs) were cultured in a 37°C, 5% CO2 incubator in a medium containing α-MEM (BI, Israel), 10% FBS (Gibco, USA) and 1% penicillin / streptomycin (Sigma-Aldrich, USA).

[0074] 2. Culture of strains with the target gene knocked out

[0075] Wild-type P. micra (PmWT) and the micromonads with the target gene appa knocked out (PmΔappa) constructed in Example 1 were cultured in SchaEdler anaerobic medium at 37°C under anaerobic conditions (80% N2, 10% CO2, and 10% H2) for 3–4 days. When PmWT and PmΔappa reached the logarithmic growth phase, the supernatant was discarded after centrifugation, and the bacterial cells were washed twice with PBS buffer. The OD600 was adjusted to 1 using a micro spectrophotometer to obtain PmWT bacterial suspension and PmΔappa bacterial suspension, respectively.

[0076] 3. Effects of Micromonas microsporum with the target gene appa knocked out on autophagy in periodontal ligament stem cells (hPDLSCs)

[0077] Periodontal ligament stem cells (PDLSCs) were seeded on cell slides and infected with a lentivirus (WZ Biosciences, China) encoding the mCherry-GFP-LC3B fusion protein at an MOI of 50. Twenty-four hours after infection, PDLSCs were co-incubated with *P. mWT* and *P. mΔappa* bacterial suspensions for 16 hours, respectively, and then fixed with 4% paraformaldehyde for 30 minutes. These groups were designated as the *P. mecta* and ΔAppA groups. Untreated PDLSCs served as a blank control (Control group), and serum-starved PDLSCs served as a positive control (Starvation group). Cell nuclei were then stained with DAPI for 5 minutes. All procedures were performed in the dark at room temperature. Finally, the cells were imaged using a laser confocal scanning microscope, and the number of mCherry and GFP fluorescent spots was analyzed using ImageJ software. The results are shown below. Figure 3 As shown.

[0078] Figure 3 In the diagram, red spots represent autolysosomes (mCherry+GFP-), and yellow spots represent autophagosomes (mCherry+GFP+). An increase in both yellow and red spots indicates enhanced autophagy flux. Conversely, an increase in yellow spot signaling without a change in red spot signaling, or a decrease in both yellow and red spots, suggests impaired autophagy flux.

[0079] Depend on Figure 3 It was found that, compared with wild-type P. micra (PmWT), the micromonads with the appa gene knocked out (PmΔappa) increased the proportion of intracellular autolysosomes, indicating that AppA may be an important cellular component for P. micra to evade autophagy in host cells. Therefore, the micromonads with the appa gene knocked out constructed in this invention can be used to study the autophagy mechanism of periodontal ligament stem cells (hPDLSCs).

[0080] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A knockout appa A method for constructing micromonads of genes, characterized in that: The genome of Micromonas microsporum appa The gene was knocked out and then constructed; appa The amino acid sequence encoded by the gene is shown in SEQ ID NO.1; The aforementioned knockout appa The method for constructing micromonads of the gene includes the following steps: (1) Using the genome of Micromonas microsporum as a template, primers were designed and the gene to be knocked out was obtained by PCR amplification. appa The upstream and downstream homologous arm fragments; (2) Artificial synthesis ermB Using a resistance gene template, primers were designed, and the gene was amplified by PCR to obtain... ermB Resistance gene fragments; (3) Using overlap PCR, the upstream homologous arm fragment, ermB The resistance gene and downstream homologous arm fragments are sequentially linked to obtain a fusion DNA fragment; (4) Dissolve the fusion DNA fragment in double-distilled water to obtain a fusion DNA fragment solution with a concentration of 0.01~0.1μg / μL; then add the fusion DNA fragment solution dropwise onto BHI solid medium and let it stand for 24h to obtain a medium containing the fusion DNA fragment; Micromonas microsporum suspension was streaked onto BHI solid medium and cultured in an anaerobic incubator for 3-5 days until single colonies grew. Micromonas microbiota were collected from BHI solid medium using a disposable inoculation loop and inoculated into 1 mL of BHI liquid medium. The loop was rotated to promote bacterial release into the medium, and the cell suspension concentration was adjusted to OD600 = 0.4 to obtain a Micromonas microbiota suspension. Then, 20 μL of the Micromonas microbiota suspension was added dropwise to a medium containing a fusion DNA fragment and cultured under anaerobic conditions at 37°C for 36 h to allow the fusion DNA fragment to be transformed into Micromonas microbiota. (5) The transformed Micromonas microsporum were spread onto BHI solid medium containing erythromycin and cultured for 5 days to obtain mutant transformants; the transformants were screened and identified using primers 4F / 4R to obtain knockout transformants. appa Genetically modified micromonads.

2. The knockout as described in claim 1 appa A method for constructing micromonads of genes, characterized in that, In step (1), the gene to be knocked out appa The upstream homologous arm fragment is 1303 bp in length. appa The downstream homologous arm fragment is 1371 bp.

3. The knockout as described in claim 1 appa A method for constructing micromonads of genes, characterized in that, In step (1), the primer sequences for amplifying the upstream homologous arm fragment are as follows: 1F: 5'-GAAATATCAACTAATTTTTTATCAGCAACA-3', 1R: 5'-CTTATCTCCATTATATCTTATATAATTTATAATACAAAAGTGTGGAACA -3'; The primer sequences for downstream homologous arm fragment amplification are as follows: 3F: 5'-CTATGAGTCGCCTTAAGTCCTCCTTGAGAAAAAAATAATT-3', 3R: 5'-AAATTCAGACCTTTATAGCAAAGTTAAAG-3'.

4. The knockout as described in claim 1 appa A method for constructing micromonads of genes, characterized in that, In step (2), the amplification primer sequences for the ermB resistance gene are as follows: 2F: 5'-AAGATATAATGGGAGATAAGACGTTC-3', 2R: 5'-GGACTTAAGGCGACTCATAGAATTATTTCCTCCC-3'.

5. The knockout as described in claim 1 appa A method for constructing micromonads of genes, characterized in that, In step (3), the upstream homologous arm fragment is ligated using the Clon Express One Step Cloning Kit. ermB Resistance gene and downstream homologous arm fragment.

6. The knockout as described in claim 1 appa A method for constructing micromonads of genes, characterized in that, In step (4), the concentration of the fusion DNA fragment solution is 0.05 μg / μL.

7. The knockout as described in claim 1 appa A method for constructing micromonads of genes, characterized in that, In step (4), the volume ratio of the fusion DNA fragment solution to the Micromonas microbiota culture is 1:

1.

8. The knockout as described in claim 1 appa A method for constructing micromonads of genes, characterized in that, In step (5), the screening is performed using the 4F / 4R primers inside the homologous arm to detect mutants; The sequences of the primers 4F / 4R are as follows: 4F: 5'-GAATTGTGATGTAATAAATATAT-3', 4R: 5'-GCTTTCTATAACAAATTGTG-3'.

9. The knockout prepared by the method of claim 1 appa Application of genes from micromonads in the study of autophagy mechanisms in periodontal ligament stem cells.

Images