Indel molecular marker for identifying two Guangdong and Guangxi area of the rice field eel strain and application thereof
By developing Indel molecular markers and their primer pairs for identifying swamp eel strains in Guangdong and Guangxi, the problem of swamp eel strain identification has been solved, enabling rapid and accurate strain identification and acquisition of superior traits, and supporting precision breeding.
Patent Information
- Application Number
- CN202411875852.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-19
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2044-12-19
AI Technical Summary
Currently, there is a lack of effective methods for targeted screening of yellow eel strains in Guangdong and Guangxi regions. Existing technologies cannot accurately identify yellow eel strains from different regions, leading to difficulties in germplasm resource screening.
Indel molecular markers and their corresponding primer pairs were developed for identifying the strains of yellow eels from Guangdong and Guangxi regions. By PCR amplification and gel electrophoresis or sequencing analysis, the differences in amplified fragments can be used to quickly identify whether the yellow eels belong to the strains from Guangdong and Guangxi regions.
It enables rapid and accurate identification of yellow eel strains in Guangdong and Guangxi regions, obtains superior traits, and supports precision breeding.
Smart Images

Figure CN119639914B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of aquatic molecular breeding, and particularly relates to an Indel molecular marker for identifying the Monopterus albus strains in Guangdong and Guangxi regions and application thereof. BACKGROUND
[0002] Monopterus albus belongs to Synbranchiformes, Synbranchidae and Monopterus, is widely distributed in paddy fields, marshes and mud ponds in various countries in Asia, and is widely distributed in both tropical and temperate regions. It has very outstanding commercial value due to its rich nutritional value, special flavor and unique taste, and is known as one of the most economically valuable “special freshwater fish” in China. According to the 2024 China Fishery Statistical Yearbook, the domestic Monopterus albus production has exceeded 355,000 tons, and the current resource production is in short supply, and the price is high, and its market potential is huge. However, the germplasm resources and reserves of wild Monopterus albus are decreasing, and its genetic structure is severely damaged. Therefore, it is particularly necessary to accurately and directionally screen high-quality wild germplasm. Guangdong and Guangxi regions are one of the regions with the most abundant water resources in China, and have very rich high-quality germplasm resources.
[0003] At present, there is no effective method to directionally screen Monopterus albus strains in different regions, so it is necessary to develop a molecular marker for screening Monopterus albus strains in a specific region. Molecular markers are genetic markers based on nucleotide sequence variations between individuals, which can reflect specific DNA fragments of differences in the genome between populations. Compared with other morphological markers, cytological markers and microsatellite markers, Indel markers have the advantages of simple operation, high efficiency, high repeatability, and can be used for marker analysis in different stages of biological development and different tissues. At present, there is no effective method to directionally screen Monopterus albus strains in Guangdong and Guangxi regions, so it is necessary to develop a molecular marker for screening Monopterus albus strains in Guangdong and Guangxi regions. SUMMARY
[0004] The purpose of the present application is to provide an Indel molecular marker A or B for identifying Monopterus albus strains in Guangdong and Guangxi regions,
[0005] The nucleotide sequence of the Indel marker A is shown in SEQ ID NO: 5 or SEQ ID NO: 7; and the nucleotide sequence of the Indel marker B is shown in SEQ ID NO: 6 or SEQ ID NO: 8.
[0006] a deletion of the sequence AAGCATTTAAAGTCTGGTGCTTCAC at the 65-89 bp bases of the sequence shown in SEQ ID NO: 7, corresponds to SEQ ID NO: 5;
[0007] a deletion of the sequence GTGATCAGTCGCTGCGTCTGTG at the 29-51 bp bases of the sequence shown in SEQ ID NO: 8, corresponds to SEQ ID NO: 6.
[0008] Another object of the present application is to provide primer pair 1 and primer pair 2 for amplifying the above-mentioned Indel molecular markers A and B, respectively, the nucleotide sequences of which are shown in Table 1 as SEQ ID NO: 1-4:
[0009] Table 1 Nucleotide sequences of two pairs of primers
[0010]
[0011] When the above-mentioned primer pairs of SEQ ID NO: 1-4 are used to amplify the genome DNA of the test area of the rice field eel, two Guangdong and Guangxi area rice field eel strains can be quickly screened according to the amplified fragments. If the nucleotide sequence of the amplified product is shown in SEQ ID NO: 5 or SEQ ID NO: 6, it is identified as a Guangdong and Guangxi area rice field eel strain; if the nucleotide sequence of the amplified product is shown in SEQ ID NO: 7 or SEQ ID NO: 8, it is identified as a non-Guangdong and Guangxi area rice field eel strain.
[0012] The present application also provides a kit for identifying Guangdong and Guangxi area rice field eel strains, comprising one or both of primer pair 1 shown in SEQ ID NO: 1-2 and primer pair 2 shown in SEQ ID NO: 3-4.
[0013] The present application also provides the above-mentioned Indel marker, primer pairs of SEQ ID NO: 1-4 or a kit containing primer pairs shown in SEQ ID NO: 1-4 for identifying Guangdong and Guangxi area rice field eel strains.
[0014] The present application also provides a method for identifying a southwest area rice field eel strain, comprising the following steps:
[0015] 1. Take the muscle tissue of the tail of the test rice field eel for extracting the genome DNA of the rice field eel;
[0016] 2. Use the genome DNA of the rice field eel as a template, and use one or more than one pair of primer pairs shown in SEQ ID NO: 1-2 or SEQ ID NO: 3-4 for PCR amplification to obtain an amplified product;
[0017] 3. According to the nucleotide sequence of the amplification product, respectively, aligning with SEQ ID NO: 5-6 or SEQ ID NO: 7-8 is identified; if the nucleotide sequence of the amplification product is respectively as shown in SEQ ID NO: 5 or SEQ ID NO: 6, it is identified as the two Guangdong and Guangxi region of the Chinese rice field eel strain; if the nucleotide sequence of the amplification product is respectively as shown in SEQ ID NO: 7 or SEQ ID NO: 8, it is identified as the non-two Guangdong and Guangxi region of the Chinese rice field eel strain.
[0018] The innovation of the scheme of the present application is:
[0019] The present application provides an Indel marker for identifying the two Guangdong and Guangxi region of the Chinese rice field eel strain, using the molecular marker primer pair provided by the present application to perform PCR amplification on different regions of the Chinese rice field eel strain, which can quickly identify whether it is the two Guangdong and Guangxi region of the Chinese rice field eel strain according to the amplified fragment. The Indel marker provided by the present application can be applied in practice, which can realize the rapid identification of the two Guangdong and Guangxi region of the Chinese rice field eel strain germplasm resource, so as to obtain the excellent traits of the strain, and finally realize the precision breeding. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 : Gel electrophoresis diagram of PCR amplification of 18 Chinese rice field eel strain DNA using primer pair 1
[0021] Figure 2 : Gel electrophoresis diagram of PCR amplification of 18 Chinese rice field eel strain DNA using primer pair 2
[0022] Wherein the numbers 1-18 respectively represent the following 18 Chinese rice field eel strains:
[0023] 1, Nanning, Guangxi; 2, Zhanjiang, Guangdong; 3, Guangzhou, Guangdong; 4, Hefei, Anhui; 5, Changsha, Hunan; 6, Weinan, Shaanxi; 7, Ankang, Shaanxi; 8, Ganzhou, Jiangxi; 9, Jiujiang, Jiangxi; 10, Chengdu, Sichuan; 11, Zhengzhou, Henan; 12, Dali, Yunnan; 13, Dandong, Liaoning; 14, Dongying, Shandong; 15, Huai'an, Jiangsu; 16, Baoding, Hebei; 17, Sanya, Hainan; 18, Xiantao, Hubei DETAILED DESCRIPTION
[0024] The following examples are only used to further illustrate the content of the present application, but should not be understood as limiting the present application. Without departing from the spirit and essence of the present application, modifications or replacements of the methods, steps or conditions of the present application all belong to the scope of the present application. The experimental methods not specified in the specific conditions and the reagents and materials not specified in the formula in the examples are all according to the conventional conditions in the art, and the reagents used are all commercially available.
[0025] The application provides an Indel marker for identifying whether the Misgurnus anguillicus is a Guangdong and Guangxi region Misgurnus anguillicus strain, and the acquisition method of the molecular marker is as follows: based on the existing Misgurnus anguillicus genome sequence, the Misgurnus anguillicus of different region strains is resequenced, the genomic region of the Misgurnus anguillicus strain in the Guangdong and Guangxi region is identified by whole genome association analysis, and the physical position is located at the 62393694-62393718 site on the 2nd chromosome (Chr2) of the Misgurnus anguillicus and the 61693628-61693651 site on the 2nd chromosome (Chr2) of the Misgurnus anguillicus. The flanking sequences of 200bp before and after the Indel variation in the genomic region are selected for primer development. The Indel marker is amplified by primers, and whether the Misgurnus anguillicus to be tested is the Misgurnus anguillicus strain in the Guangdong and Guangxi region is identified by the difference of the amplified fragments. The amplified fragments meet the nucleotide sequences of the Indel markers SEQ ID NO:5-6.
[0026] The application provides two pairs of primers for detecting the Indel molecular marker, and the forward and reverse primer sequences are shown in SEQ ID NO:1-4.
[0027] Example 1: Identification of 18 region Misgurnus anguillicus strains
[0028] (1) Extraction of Misgurnus anguillicus sample genomic DNA
[0029] A small piece of tail muscle of about 0.5g of the Misgurnus anguillicus to be tested is cut, and the genomic DNA is extracted by using a tissue genomic DNA extraction kit (brand: Tiangen, product number: 69504). The purity and concentration of the obtained DNA sample are detected by using a NanoDrop2000 spectrophotometer, and the extracted DNA can be stored at -20℃ for long-term storage.
[0030] (2) Indel marker fragment PCR amplification
[0031] The genomic DNA of the Misgurnus anguillicus obtained above is used as a template, and the primer pairs shown in the nucleotide sequences of primer pair 1 SEQ ID NO:1-2 or primer pair 2 SEQ ID NO:3-4 in Table 1 are used for PCR amplification.
[0032] The following 20ul reaction system is configured by using a premixed type PCR reagent kit with dye (brand: TaKaRa, product number: RR903A): Premix Taq 10ul, 10ul of forward primer 0.5ul, 10ul of reverse primer 0.5ul, template DNA 1ul, and supplementing ddH2O to a total volume of 20ul.
[0033] The PCR amplification procedure is as follows: pre-denaturation at 98℃ for 10 min, denaturation at 98℃ for 10 s, annealing at 60℃ for 30 s, extension at 72℃ for 1 min, 35 cycles, and extension at 72℃ for 5 min.
[0034] (3) Agarose gel electrophoresis of the amplified product
[0035] An agarose gel with a concentration of 2% is prepared, and the PCR amplified product is added and electrophoresed with a 50 bp DNA marker as a marker. The electrophoresis conditions are set as follows: voltage 110 V, electrophoresis time 60 min. The bands are photographed using a gel imaging instrument to obtain a gel picture.
[0036] (4) Identification of the amplified product
[0037] The identification is performed according to the bands on the gel picture or the sequencing result of the PCR amplified product (sequencing is performed by Shanghai Shengong Bioengineering Co., Ltd.).
[0038] When the electrophoresis gel shows a band at 180 bp using primer pair 1 or the sequencing result of the amplified product is as shown in SEQ ID NO: 5, the detected rice eel is a rice eel strain from the Guangdong and Guangxi region; if a band is shown at 205 bp or the sequencing result of the amplified product is as shown in SEQ ID NO: 7, the detected rice eel is a rice eel strain not from the Guangdong and Guangxi region.
[0039] When the electrophoresis gel shows a band at 118 bp using primer pair 2 or the sequencing result of the amplified product is as shown in SEQ ID NO: 6, the detected rice eel is a rice eel strain from the Guangdong and Guangxi region; if a band is shown at 141 bp or the sequencing result of the amplified product is as shown in SEQ ID NO: 8, the detected rice eel is a rice eel strain not from the Guangdong and Guangxi region.
[0040] The experimental results are shown in Figure 1 and Figure 2 .
[0041] Figure 1 The amplified product bands of samples 1-3 are located at 180 bp, and the amplified bands of samples 4-18 are located at 205 bp.
[0042] Figure 2 The amplified product bands of samples 1-3 are located at 118 bp, and the amplified bands of samples 4-18 are located at 141 bp.
[0043] From Figure 1 and Figure 2 , it can be clearly seen that samples 1-3 from Nanning, Guangxi, Zhanjiang, Guangdong, and Guangzhou, Guangdong are indeed rice eel strains from the Guangdong and Guangxi region, and samples 4-18 are rice eels from other regions.
[0044] The above results show that the Indel markers A or B can be used to effectively identify whether the two Guangdong and Guangxi region rice eels are strains. Therefore, the Indel markers provided by the present application can be applied to rapid identification of specific geographical strain germplasm resources, so as to obtain excellent traits of the strain, and finally realize precision breeding.
Claims
1. An Indel marker A or B for identifying eel strains from Guangdong and Guangxi regions and those from other regions, characterized in that... The nucleotide sequence of Indel marker A of the Guangdong and Guangxi eel strain is shown in SEQ ID NO:5, and the nucleotide sequence of Indel marker B is shown in SEQ ID NO:6; the nucleotide sequence of Indel marker A of the non-Guangdong and Guangxi eel strain is shown in SEQ ID NO:7, and the nucleotide sequence of Indel marker B is shown in SEQ ID NO:
8.
2. The application of a primer pair for amplifying the Indel marker A or B as described in claim 1 in the identification of loach strains from the Guangdong and Guangxi regions and those from other regions, characterized in that... The primer pair used to amplify the Indel marker A is primer pair 1, and the nucleotide sequence of primer pair 1 is shown in SEQ ID NO:1-2; the primer pair used to amplify the Indel marker B is primer pair 2, and the nucleotide sequence of primer pair 2 is shown in SEQ ID NO:3-4.
3. A kit for identifying eel strains from Guangdong and Guangxi regions and those from other regions, characterized in that... It contains one or both of primer pair 1 as shown in SEQ ID NO:1-2 and primer pair 2 as shown in SEQ ID NO:3-4; primer pair 1 is used to amplify Indel label A, and primer pair 2 is used to amplify Indel label B; The nucleotide sequence of Indel marker A for the loach strain from the Guangdong and Guangxi regions is shown in SEQ ID NO:5, and the nucleotide sequence of Indel marker B is shown in SEQ ID NO:6; the nucleotide sequence of Indel marker A for the loach strain from outside the Guangdong and Guangxi regions is shown in SEQ ID NO:7, and the nucleotide sequence of Indel marker B is shown in SEQ ID NO:
8.
4. The application of the primers for identifying the Indel molecular markers A or B as described in claim 1 in the preparation of reagents for identifying loach strains from Guangdong and Guangxi regions and non-Guangdong and Guangxi regions.
5. A method for identifying the strains of yellow eels from the Guangdong and Guangxi regions and those from other regions, characterized in that... Includes the following steps: (1) Muscle tissue from the tail of the eel to be tested was taken for the extraction of genomic DNA from the eel; (2) Using the genomic DNA of the yellow eel as a template, PCR amplification was performed using one or two pairs of primers shown in SEQ ID NO:1-2 or SEQ ID NO:3-4 to obtain the amplification product; (3) The nucleotide sequence of the amplified product is compared with SEQ ID NO:5-6 or SEQ ID NO:7-8 respectively for identification; if the nucleotide sequence of the amplified product is as shown in SEQ ID NO:5-6 respectively, it is identified as a yellow eel strain from Guangdong and Guangxi regions; if the nucleotide sequence of the amplified product is as shown in SEQ ID NO:7-8 respectively, it is identified as a yellow eel strain from outside Guangdong and Guangxi regions.
Citation Information
Patent Citations
Indel molecular marker for identifying ricefield eel strain in southwest region and application of Indel molecular marker
CN119265316A