LAMP (Loop-Mediated Isothermal Amplification) and CRISPR / BrCas12b mediated one-pot nucleic acid molecule detection method for detecting salmonella

Abstract

The invention belongs to the field of biology, relates to a salmonella gene detection technology, and discloses a one-pot detection method combining LAMP (loop-mediated isothermal amplification) and CRISPR / BrCas12b mediated nucleic acid molecule detection. The method comprises the following steps: designing an LAMP primer, a small guide RNA (Ribonucleic Acid) and a transcription template overlapping PCR (Polymerase Chain Reaction) primer, performing loop-mediated isothermal amplification, constructing CRISPR / Cas shearing recognition (Cas-LAMP), constructing a single-tube one-pot reaction system of the CRISPR / Cas shearing recognition, detecting the specificity and sensitivity of Cas-LAMP amplification, and the like. In order to solve the technical problem that amplification and shearing recognition cannot be carried out synchronously, the invention provides a Cas-LAMP technology capable of linking two-step reaction of amplification and shearing recognition, and accurate, sensitive and rapid detection of nucleic acid molecules is realized in an in-vitro single reaction tube system. Compared with a traditional nucleic acid molecule detection method, the method has the following advantages that one-pot detection can be directly carried out without step-by-step operation, high sensitivity and strong specificity are achieved, and rapid field detection can be achieved. The method provides technical support for conventional nucleic acid detection, and has a wide field instant detection application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and relates to a highly sensitive nucleic acid molecule detection method for Salmonella in foodborne epidemic detection, and in particular to a one-pot highly sensitive Salmonella detection method combining loop-mediated isothermal amplification (LAMP) and CRISPR / BrCas12b-mediated, as well as related primers, probes and small guide RNA (sgRNA) sequences. Background Art

[0002] Salmonella is a common Gram-negative enteric pathogen that is widely found in animals, especially in the intestines of livestock such as poultry, pigs, and cattle. Salmonella infection is one of the important causes of foodborne zoonotic infectious diseases worldwide, and is usually transmitted through food, drinking water, or direct contact with contaminated objects. The clinical manifestations of Salmonella infection include diarrhea, abdominal pain, vomiting, fever, and other symptoms. In severe cases, it can lead to fatal complications such as sepsis and intestinal perforation. Salmonella can be divided into multiple serotypes based on its antigenic characteristics. Common pathogenic serotypes include Salmonella Enteritidis (SE), Salmonella typhimurium, and Salmonella choleraesuis. Salmonella infection is highly contagious and pathogenic, especially during food production and processing. If the food is not thoroughly heated or the sanitary conditions are not up to standard, Salmonella can multiply rapidly and spread through the food chain. In particular, foods such as eggs, meat and milk are easy carriers of Salmonella. In recent years, Salmonella infection has become a major challenge in the field of global public health, resulting in millions of infections and a large number of deaths each year. In order to effectively prevent and control Salmonella infection, early rapid and sensitive detection methods are particularly important.

[0003] Traditional methods for detecting Salmonella, such as culture and biochemical detection, usually take a long time and are complicated to operate. Although immunological methods can provide certain specificity, they still face problems such as antibody sources and high costs, which limit their application in large-scale detection. With the development of molecular biology technology, Salmonella detection based on polymerase chain reaction (PCR), real-time fluorescence quantitative PCR and other technologies has gradually become mainstream, which can provide higher sensitivity and specificity. However, traditional PCR technology usually requires expensive instruments and equipment, and is complicated to operate, requiring high professional knowledge of the detection personnel. In recent years, isothermal nucleic acid amplification technology, such as loop-mediated isothermal amplification (LAMP), has provided a new solution for the rapid on-site detection of Salmonella, which has the advantages of simple operation, low cost and wide applicability, showing broad application prospects.

[0004] Prokaryotes such as bacteria and archaea form their own adaptive immune system through clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (Cas). The CRISPR-Cas system protects prokaryotes from foreign genetic material through synergistic action. Initially, the CRISPR-Cas system was widely studied and applied in the field of synthetic biology as a gene editing tool. As the biological functions of different CRISPR-associated proteins are gradually revealed, new gene editing elements and tools are constantly being developed and designed. In 2015, Zhang Feng's team reported that CRISPR-Cas12a has nuclease activity, indicating its great potential in the field of gene editing and biotechnology. The powerful gene editing ability of the CRISPR-Cas system is derived from the specific or non-specific cutting activity of the Cas protein, which has stimulated people's interest in its application in the development of new detection tools. In 2016, Abudayyeh et al. found that Cas12 can not only specifically cut the target sequence, but also has "trans-cutting" activity, that is, after binding and recognizing the target sequence, Cas12 can non-specifically cut the single-stranded fluorescent reporter probe, release the fluorescent signal, and thus achieve detection. This discovery opened up a new path for the application of CRISPR-Cas system in nucleic acid detection and quickly became the focus of research. Subsequently, nucleic acid detection technology based on CRISPR-Cas continued to develop, showing efficient and accurate pathogen detection capabilities. Among the second class of Cas effector proteins, Cas9 is widely used in genome editing and regulation, while Cas12 has become an important tool in nucleic acid detection and disease monitoring due to its higher specificity and potential for combination with nucleic acid amplification methods, showing great application prospects. Today, as a powerful detection tool, the CRISPR-Cas system has been widely used in nucleic acid detection, microbial detection, molecular imaging and other fields, and can detect different targets at low cost and high specificity. Therefore, the further application of CRISPR-Cas technology will promote continuous breakthroughs in the field of disease diagnosis. However, since the optimal enzyme activity temperature of most Cas12 proteins does not match the optimal reaction temperature of Bst DNA polymerase in the LAMP reaction, it is difficult to carry out amplification and cleavage reactions simultaneously in the same reaction tube; if it is divided into two steps, it not only increases the complexity of the operation, but may also cause aerosol contamination due to frequent opening of the lid, further increasing the impact on the accuracy of the test results. Summary of the invention

[0005] The present invention aims to solve the problem of compatibility of LAMP and Cas shearing system, and provides a kind of LAMP and CRISPR / Cas mediated rapid, highly sensitive, highly specific one-pot nucleic acid molecule detection method for Salmonella, and the primers, probes and small guide RNA (sgRNA) sequences involved. The present invention relates to DNA amplification and CRISPR / Cas12b shearing signal amplification detection, specifically, under the action of Bst DNA polymerase, 4-6 specific primers are used to amplify the target DNA. At the same time, BrCas12b and sgRNA form a ternary complex with the amplified product, activate the "trans-cutting" activity of BrCas12b, cut the single-stranded fluorescent reporter probe, release the fluorescent signal, so as to achieve the synchronization of amplification and detection reaction. At the same time, the present invention cleverly inserts the protospacer adjacent motif (PAM, protospacer adjacent motif) into the double-stranded DNA product by primer design, breaking through the sgRNA design dependence on the target sequence PAM site. By optimizing the reaction system and conditions, the present invention enables amplification and shearing reactions to be performed simultaneously in the same reaction system, thereby achieving efficient detection of Salmonella samples in a single reaction system. This method not only has the advantages of high sensitivity, strong specificity and rapid detection, but is also highly adaptable to other single-stranded and double-stranded DNA targets, demonstrating a wide range of application potential.

[0006] The objective of the present invention is achieved through the following technical solutions:

[0007] <First aspect>

[0008] The present invention provides a Cas-LAMP one-pot nucleic acid molecule detection method for Salmonella, the method comprising the following steps:

[0009] S1. Extracting nucleic acid samples from samples to be tested;

[0010] S2. Design synthetic primers and probes; design 6 specific oligonucleotide LAMP primers according to the invA gene sequence of Salmonella: upstream internal primer FIP, downstream internal primer BIP, upstream external primer F3 and downstream external primer R3, as well as upstream loop primer LF and downstream loop primer LB; random TA-rich single-stranded DNA reverse cleavage probe; LAMP product-specific small guide RNA (sgRNA) sequence and its transcription template overlapping PCR synthetic primers, the base sequence is as SEQ ID No: 1-14;

[0011]

[0012]

[0013] S3. Prepare a reaction mixture system, wherein the mixture system includes: a single-stranded DNA reverse-cleavage probe, 6 oligonucleotide LAMP primers, a small (single) guide RNA (sgRNA) or its derivatives, a CRISPR-related Cas protein or its variants, a Cas-LAMP one-pot reaction buffer, and a Bst DNA polymerase or its variants; wherein the small guide RNA or its derivatives contain a sequence complementary to the oligonucleotide LAMP primer invA-FIP; and the oligonucleotide LAMP primer invA-FIP sequence is complementary to a partial sequence of one chain of the target molecule and a partial sequence of the small guide RNA or its derivatives, and also introduces a PAM site sequence;

[0014] S4, adding the nucleic acid sample extracted in step 1 to the reaction system of step 3, and performing a constant temperature reaction. Under the action of Bst DNA polymerase, 6 specific primers bind to and amplify the nucleic acid target. At the same time, BrCas12b, sgRNA and the amplified product form a ternary complex; activating the "trans-cleavage" activity of BrCas12b, cutting the single-stranded DNA trans-cleavage fluorescent reporter probe, and releasing a fluorescent signal;

[0015] S5. Use a fluorescence detector to collect, read and record the fluorescence signal generated by the Cas-LAMP one-pot reaction, and use the fluorescence signal to determine the presence or absence of the target nucleic acid molecule in the sample to be tested. The reaction result is presented in real time in the form of a fluorescence curve. The temperature of the Cas-LAMP one-pot reaction is 63°C and the reaction time is 20 minutes.

[0016] The technical principles of the present invention are as follows:

[0017] The target gene amplification of the LAMP reaction is divided into two stages: the initial stage and the cycle stage. The initial stage starts from the forward inner primer FIP. The inner primer invA-FIP consists of two regions, F2 and F1c. In order to make the CRISPR-BrCas12b system independent of the target PAM site, we added TTT-PAM sites to the connecting region between F2 and F1c to modify FIP, introduce the PAM site into the LAMP product, and then cleverly avoid the dependence of BrCas12b on the target sequence PAM site sequence; the F2 region is complementary to F2c on the invA gene, and the primer is extended using Bst chain displacement DNA polymerase to start the DNA chain displacement reaction. At the same time, the outer primer invA-F3 is complementary to the target F3c region. Under the action of the Bst enzyme, the synthesized DNA chain is displaced after extension; the displaced single-stranded 5' end contains F1c and F1 regions, and the bases in these two regions can amplify the target fragment to form a ring structure. Similarly, another inner primer invA-BIP is composed of B2 and B1c, the B2 region is complementary to B2c on the invA gene sequence, the outer primer invA-F3-2 is complementary to F3c on the invA gene sequence, and the outer primer invA-R3 is complementary to B3c on the invA gene sequence. The invA gene primer set has a total of 6 primers, and 2 more loop primers LF and LB are added on the basis of the inner and outer primers to accelerate the LAMP amplification efficiency. Under the action of Bst DNA enzyme, the extension of the new DNA chain begins, and the single strand of BIP that is displaced, including the B1c and B1 regions, will also form a ring structure. Finally, through the action of extension and chain displacement, dumbbell-shaped structures are formed at both ends of the target sequence, which is the starting structure of the LAMP amplification cycle. In the cycle stage, starting from the F1 loop at the 3' end, the F2 end and the circular F2c region are synthesized and extended, and then the initial single strand of F1 is displaced by chain displacement to form a circular structure; similarly, starting from the B1 end, the primer B2 end and the B2c end region are synthesized and extended, and the single strand of B1 end is displaced by the Bst enzyme to finally form a circular structure. After cyclic amplification, the final product is a mixture of circular structure and polycyclic cauliflower-like structure DNA.

[0018] At the same time, invA-sgRNA is specially designed to target LAMP products with a given PAM site. BrCas12b forms a ternary complex of BrCas12b-sgRNA-dsDNA with the target DNA under the guidance of sgRNA, activating the trans-cleavage activity of BrCas12b, resulting in the shearing of the single-stranded DNA trans-cleavage fluorescent reporter probe. The shearing of LAMP and BrCas12b is achieved simultaneously in the same system. When there is no target, BrCas12b does not work, and the FAM fluorescent group attached to the fluorescent probe is quenched by BHQ1, and no fluorescent signal is generated. When the target is present, LAMP amplifies, and at the same time sgRNA recognizes the target sequence to form a ternary complex of BrCas12b-sgRNA-dsDNA, and then the fluorescent probe is sheared, the fluorescent group is separated from the quenching group, and fluorescence is released.

[0019] The fluorescence signal generated by the Cas-LAMP one-pot reaction can be collected, read, recorded and analyzed by a fluorescence detector to determine the presence or absence of target nucleic acid molecules in the sample to be tested.

[0020] The Cas-LAMP one-pot reaction is a DNA nucleic acid detection platform, which is highly adaptable to the detection of different single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) targets. The detection system proposed by the present invention is simple to operate, can simultaneously amplify and detect targets in a single reaction tube, reduce the contamination risk of open tube reactions, has low requirements for temperature control, can reduce laboratory equipment requirements, shorten detection time, has a high degree of automation, has high sensitivity, strong specificity, and is suitable for simple and rapid nucleic acid detection.

[0021] The CRISPR-associated Cas protein or its variant is a nuclease with single-stranded or double-stranded DNA recognition and cleavage functions and single-stranded DNA cleavage functions. It is a CRISPR-Cas protease that can tolerate a reaction temperature above 55°C and can specifically recognize target DNA under the guidance of sgRNA, and has cis- and trans-cleavage activity, including but not limited to any one or any variant of AapCas12b, BrCas12b, and AacCas12b proteins. The enzyme may include a mixture of wild-type, modified, codon-optimized, evolved, thermophilic, chimeric, engineered and / or more than one Cas protein. The CRISPR-Cas protease is preferably BrCas12b. The CRISPR-Cas nuclease combined with sgRNA can be specifically activated by the target nucleic acid sequence to have non-specific DNA nuclease activity, thereby achieving the cleavage of the DNA fluorescent probe.

[0022] The Bst chain displacement DNA polymerase is a DNA polymerase with chain displacement effect, which can displace the downstream DNA chain without template denaturation. The DNA polymerase or its variant can be any one or any variant of Bst 2.0 DNA polymerase, Bst 3.0 DNA polymerase, Warmstar Bst 2.0 DNA polymerase, Bst LF DNA polymerase, OmniAmp DNA polymerase, etc. The enzyme can include a mixture of wild-type, modified, codon-optimized, evolved, thermophilic, chimeric, engineered and / or more than one chain displacement DNA polymerase. The Bst chain displacement DNA polymerase is preferably Bst 3.0 DNA polymerase. The DNA polymerase has 5'-3' DNA polymerase activity and chain displacement activity, which can automatically dissociate from the hydrogen bond of the template double-stranded DNA and then synthesize a new DNA chain. Due to its characteristics, the Bst enzyme can synthesize DNA at a constant temperature without the double-strand dissociation of DNA, and the synthesis is not affected by the secondary structure of DNA.

[0023] The single-stranded DNA trans-cleavage probe is a single-stranded DNA, the 5' end of which is labeled with a fluorescent group including but not limited to FAM, HEX, VIC, CY5, CY3, ROX, TAMRA, TET, FITC, and JOE, and the 3' end is labeled with a quenching group including but not limited to TAMRA, BHQ1, MGB, BHQ2, etc. that can be combined with any fluorescent group at the 5' end.

[0024] The random TA-rich single-stranded DNA sequence may be TTATTATT or TTTTT or TTTTTTTT or other TA-rich single-stranded DNA sequences, and the preferred sequence is TTATTATT; the sequence can be recognized and cut by the CRISPR-Cas protein.

[0025] The spacer sequence of the small guide RNA (sgRNA) or its derivative is complementary to the LAMP product nucleic acid molecule sequence.

[0026] The main components of the Cas-LAMP one-pot reaction buffer include dNTPs, Tris-HCl, MgSO4, KCl, ATP, DTT, (NH4)2SO4, Triton X-100 and mannitol. The preferred reaction buffer includes: 0.18mM-1.62mM dNTPs, 10mM-40mM Tris-HCl, 1.8mM-16.2mM MgSO4, 5mM-20mM KCl, 0.01mM-10mM ATP, 0.5mM-10mM DTT, 5mM-20mM (NH4)2SO4, 0.1%-0.4% Triton X-100 and 100mM-400mM mannitol, with a pH value between 6.5-8.0.

[0027] In the above technical solution of the present invention, the Salmonella nucleic acid sample to be detected can be extracted from a food sample or a clinical sample by a magnetic bead method or a column method to obtain the nucleic acid.

[0028] The temperature of the isothermal reaction is 61°C-68°C, preferably 63°C, and the isothermal reaction time is 10min-80min, preferably 20min; during the isothermal reaction, under the action of the Bst enzyme, the inner primer and the outer primer perform LAMP amplification on the target gene fragment to produce DNA fragments of different lengths, thereby achieving target enrichment. At the same time, the CRISPR-BrCas12b system starts working, and the sgRNA targets the LAMP product with a given PAM site. Under the guidance of the sgRNA, a ternary complex of BrCas12b-sgRNA-dsDNA is formed, which activates the trans-cleavage activity of BrCas12b, resulting in the shearing of the single-stranded DNA probe, thereby generating a detectable fluorescent signal.

[0029] <Second Aspect>

[0030] Furthermore, the present invention also provides a reaction system for Salmonella nucleic acid detection, including a single-stranded DNA trans-cleavage fluorescent reporter probe, 6 oligonucleotide LAMP primers, a small (single) guide RNA (sgRNA) or its derivatives, a CRISPR-related Cas protein or its variants, a Cas-LAMP one-pot reaction buffer, and a Bst DNA polymerase or its variants.

[0031] A kit including the reaction system also belongs to the protection scope of the present invention, and can realize accurate, rapid and highly sensitive detection of Salmonella DNA molecules under isothermal conditions.

[0032] The present invention can quickly complete the detection of Salmonella nucleic acid molecules under isothermal conditions. First, the nucleic acid of the sample to be detected is obtained by rapid nucleic acid extraction; then, the chain displacement DNA polymerase, the combined enzyme of CRISPR-related proteins, sgRNA, single-stranded DNA fluorescent probe and oligonucleotide primers are used to react with the nucleic acid to be detected under isothermal conditions; finally, by detecting the fluorescent signal, it is determined whether the target nucleic acid molecule exists in the sample to be detected.

[0033] The CRISPR-associated Cas protein or its variant and sgRNA form a binary complex, which specifically binds to the amplified product to form a ternary complex, thereby activating nonspecific trans-cleavage activity and ultra-sensitively cutting single-stranded DNA molecules in the reaction system; the CRISPR-associated Cas protein or its variant may include wild-type, modified, codon-optimized, evolved, thermophilic, chimeric, engineered and / or a mixture of more than one Cas protein.

[0034] Preferably, the kit comprises an enzyme mixture, a single-stranded DNA probe, a small guide RNA, a fluorescently labeled single-stranded DNA probe, an oligonucleotide primer and a Cas-LAMP reaction buffer; the enzyme mixture comprises CRISPR-Cas nuclease and a strand-displacing DNA polymerase.

[0035] Furthermore, the CRISPR-Cas nuclease is preferably BrCas12b. In the oligonucleotide primer, in order to achieve the independence of the CRISPR / BrCas12b system on the target PAM site, we added a TTT-PAM site to the connecting region between F2 and F1c to modify the primer FIP; the strand displacement DNA polymerase is Bst DNA polymerase; the DNA fluorescent probe is a single-stranded DNA with a FAM fluorescent group labeled at the 5' end and a BHQ1 fluorescent quenching group labeled at the 3' end.

[0036] In a specific embodiment, the buffer includes 0.18mM-1.62mM dNTPs, 10mM-40mM Tris-HCl, 1.8mM-16.2mM MgSO4, 5mM-20mM KCl, 0.01mM-10mM ATP, 0.5mM-10mM DTT, 5mM-20mM (NH4)2SO4, 0.1%-0.4% Triton X-100 and 100mM-400mM mannitol, with a pH between 6.5-8.0. Primer FIP / BIP 10μM-100μM, primer F3 / R3 2.5μM-25μM, primer LF / LB 0μM-50μM; FAM-labeled fluorescent probe 3μM-12μM; small guide RNA 20 nM-100nM, enzyme mixture (Bst DNA polymerase, 8U-32U; Cas12b protein, 75nM-300nM).

[0037] In the kit of the present invention, the target DNA, the small guide RNA and the Cas12b protein form a complex, which can cut other single-stranded DNA molecules in the system.

[0038] The present invention also provides a reaction system, which comprises: a single-stranded DNA probe, an oligonucleotide primer, a strand-displacing DNA polymerase and its variants, a small guide RNA (sgRNA) or its derivatives, a CRISPR-associated (Cas) protein or its variants, and a Cas-LAMP reaction buffer.

[0039] The present invention can quickly complete the detection of Salmonella DNA molecules under isothermal conditions. First, the DNA of the sample to be detected is obtained by nucleic acid extraction; then, the amplification enzyme, the combined enzyme of CRISPR-related proteins, and the single-stranded DNA probe are used to react with the nucleic acid to be detected under isothermal conditions. Finally, by detecting the fluorescent signal, it is determined whether the target nucleic acid exists in the sample to be detected.

[0040] The detection method and kit of the present invention is a rapid detection platform, which can quickly complete the detection of Salmonella nucleic acid molecules.

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] (1) High sensitivity: The present invention can detect nucleic acid molecules at the single copy level;

[0043] (2) Rapid: The present invention can complete the detection in as little as 20 minutes;

[0044] (3) Convenience: The present invention realizes isothermal reaction in a single tube with a single buffer solution, which is easy to operate and has simple steps;

[0045] (4) Low false positives: Although the reaction system of the present invention includes an amplification step, based on the specific recognition of the pre-amplification primer and the highly targeted specific recognition of the pre-amplification product by sgRNA, such a bispecific recognition system overcomes the problem of easy contamination of traditional molecular detection methods. At the same time, this method is a closed-tube reaction, which avoids the risk of aerosol contamination caused by secondary opening of the lid, and is physically isolated, which minimizes the possibility of contamination;

[0046] (5) Isothermal detection: Two engineered enzymes and chemical components together create an environment that simulates nucleic acid amplification in vivo to the greatest extent possible, and each engineered enzyme performs its own function and works at its optimal reaction temperature, so the working efficiency is the highest;

[0047] (6) One-step method: Two reaction-compatible buffers were constructed, and the target amplification and Cas12b cleavage detection reactions were placed in the same reaction tube. The sample detection was completed by a one-time addition, achieving a one-step method. Therefore, the operation is simpler, and the reaction efficiency is further improved and the reaction time is shortened. It is more suitable for rapid on-site detection, especially in areas with limited resources;

[0048] (7) Universality: The present invention can be used to detect any DNA target and distinguish point mutations. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0050] Figure 1 It is a schematic diagram of the process of detecting samples of the present invention;

[0051] Figure 2 for the detection sensitivity of Salmonella samples in this method;

[0052] Figure 3 For the detection specificity of Salmonella samples in this method;

[0053] Figure 4 Optimization of reaction temperature for detection of Salmonella samples in this method;

[0054] Figure 5 For batch sample testing of Salmonella samples in this method. DETAILED DESCRIPTION

[0055] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples. The following examples will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0056] The present invention is a one-pot nucleic acid molecule detection method mediated by LAMP and CRISPR / BrCas12b for detecting Salmonella, the process is as follows Figure 1 shown.

[0057] The sequences of primers, probes, etc. used in the examples are listed as follows:

[0058]

[0059] Example 1: A method for detecting Salmonella

[0060] Salmonella dsDNA (Target) was selected as the target sequence. The Target sequence is shown in SEQ ID NO.1, which is:

[0061] GGTGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTTATCGTTATTACCAAAGGTTCAGAACGTGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCGGATGCCGCGCGCGA ACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTTTACGGTTCCTTTGACGGTGCGATGAAGTTTATCAAAGGTGACGCTATTGCCGGCATCATTATTATCTTTGTGAACTTTATTGGCGGTATTTCGGTGGGGATGACTCGCCATGGTATGGATTTGTCCTCCGCCCTGTCTACTTA

[0062] Preparation of small guide RNA: Synthesize forward primer BrCas12b-sgRNA-F1 including T7 as SEQ ID NO.2, as follows:

[0063] TTCTTAATACGACTCACTATAGGGGAAGGTGGTTAGCTACAGGCTG ACCAGTGCAGTTG;

[0064] The forward primer BrCas12b-sgRNA-F2 of T7 is as shown in SEQ ID NO.3, which is:

[0065] GGCTGACCAGTGCAGTTGTGTCATGTGCTACGGTGACCTAACACGT CACTCAGTCACAA;

[0066] The forward primer BrCas12b-sgRNA-F3 of T7 is as shown in SEQ ID NO.4, which is:

[0067] CACGTCACTCAGTCACAACGGCTATCTATATTTCCACTAACCAAAGT TAGTGGAAATGT;

[0068] The forward primer Br-Sal-invA-sgRNA-F4 of T7 is as shown in SEQ ID NO.5, which is:

[0069] ACCAAAGTTAGTGGAAATGTAGATGGTTAGCACCATCCGCATCAAT AATACCG;

[0070] The reverse complementary long primer Br-Sal-invA-sgRNA-R containing the T7 sequence is shown in SEQ ID NO.6, which is: CGGTATTATTGATGCGGATGGTGCT;

[0071] The sgRNA transcription template was prepared by overlapping PCR, and the reaction was carried out overnight at 37 degrees using T7 transcriptase. The sgRNA was then purified using the RNAClean&Concentrator 100 kit and stored at -20 degrees or -80 degrees.

[0072] The LAMP reaction primer sequence of Target, invA-F3, is shown in SEQ ID NO.7, which is: GTTGTCTTCTCTATTGTCACCGTGGT;

[0073] The LAMP reaction primer sequence of Target, invA-R3, is shown in SEQ ID NO. 8, which is: CCGCCAATAAAGTTCACAAAGAT;

[0074] The LAMP reaction primer sequence of Target, invA-FIP, is shown in SEQ ID NO. 9, which is: GCATCCGCATCAATAATACCGTTTCTCTGGATGGTATGCCCGG;

[0075] The LAMP reaction primer sequence of Target, invA-BIP, is shown in SEQ ID NO. 10, which is: GAACGGCGAAGCGTACTGGAACATCGCACCGTCAAAGGAA;

[0076] The LAMP reaction primer sequence of Target, invA-LF, is shown in SEQ ID NO. 11, which is: TCTGGATGGTATGCCCGGT;

[0077] The LAMP reaction primer sequence of Target, invA-LB, is shown in SEQ ID NO. 12, which is: CATCGCACCGTCAAAGGAA;

[0078] like Figure 1 As shown in the figure, amplification and shearing reaction: first, double-stranded DNA is extracted from the Salmonella sample to be tested, and the concentration is diluted from 10 7 copies / μL-10 -2 copies / μL; the reaction system was added separately, the reaction system included 0.54mMdNTPs, 40mM Tris-HCl, 12.6mM MgSO4, 10mM KCl, 0.5mMATP, 10mM DTT, 20mM(NH4)2SO4, 0.2%Triton X-100 and 400mM mannitol, pH 7.5. Primer FIP / BIP 10μM, primer F3 / R32.5μM, primer LF / LB 5μM; FAM-labeled fluorescent probe 12μM; small guide RNA 80nM, enzyme mixture (Bst DNA polymerase, 24U; Cas12b protein, 150nM).

[0079] Fluorescence detection: After the reaction is mixed, the temperature is set to 63 degrees in the fluorescence real-time quantitative PCR instrument (7900HT Fast Real-Time PCR), the fluorescent group of the fluorescence detection probe is FAM, the TTA-reporter sequence is as shown in SEQ ID NO.13: FAM-TTATTATT-BHQ1, the fluorescence signal collection time interval is 1 minute, and the detection time is 80 minutes.

[0080] The specific reaction process is as follows: add the double-stranded DNA to be tested into the integrated system of amplification and reaction, react at 63°C for 80 minutes, and simultaneously use the 7900HT Fast Real-Time RCR system for fluorescence signal detection. The fluorescence signal collection time interval is 1 minute and the detection time is 80 minutes.

[0081] Results: Figure 2As shown in Figure 2, this method can be used to detect double-stranded DNA of Salmonella, and this method can detect as low as 10 within 80 minutes. -1 copies / μL of Salmonella double-stranded DNA, and it can be seen from the figure that the target detection results of each concentration gradient can be clearly interpreted within 20 minutes after the reaction starts.

[0082] Example 2: Characterization of detection specificity using this method

[0083] Salmonella dsDNA (Target) was selected as the target sequence. The Target sequence is shown in SEQ ID NO.1, which is:

[0084] GGTGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTTATCGTTATTACCAAAGGTTCAGAACGTGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCGGATGCCGCGCGCGA ACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTTTACGGTTCCTTTGACGGTGCGATGAAGTTTATCAAAGGTGACGCTATTGCCGGCATCATTATTATCTTTGTGAACTTTATTGGCGGTATTTCGGTGGGGATGACTCGCCATGGTATGGATTTGTCCTCCGCCCTGTCTACTTA

[0085] Preparation of small guide RNA: Synthesize forward primer BrCas12b-sgRNA-F1 including T7 as SEQ ID NO.2, as follows:

[0086] TTCTTAATACGACTCACTATAGGGGAAGGTGGTTAGCTACAGGCTG ACCAGTGCAGTTG;

[0087] The forward primer BrCas12b-sgRNA-F2 of T7 is as shown in SEQ ID NO.3, which is:

[0088] GGCTGACCAGTGCAGTTGTGTCATGTGCTACGGTGACCTAACACGT CACTCAGTCACAA;

[0089] The forward primer BrCas12b-sgRNA-F3 of T7 is as shown in SEQ ID NO.4, which is:

[0090] CACGTCACTCAGTCACAACGGCTATCTATATTTCCACTAACCAAAGT TAGTGGAAATGT;

[0091] The forward primer Br-Sal-invA-sgRNA-F4 of T7 is as shown in SEQ ID NO.5, which is:

[0092] ACCAAAGTTAGTGGAAATGTAGATGGTTAGCACCATCCGCATCAAT AATACCG;

[0093] The reverse complementary long primer Br-Sal-invA-sgRNA-R containing the T7 sequence is shown in SEQ ID NO.6, which is: CGGTATTATTGATGCGGATGGTGCT;

[0094] The sgRNA transcription template was prepared by overlapping PCR, and the reaction was carried out overnight at 37 degrees using T7 transcriptase. The sgRNA was then purified using the RNAClean&Concentrator 100 kit and stored at -20 degrees or -80 degrees.

[0095] The LAMP reaction primer sequence of Target, invA-F3, is shown in SEQ ID NO.7, which is: GTTGTCTTCTCTATTGTCACCGTGGT;

[0096] The LAMP reaction primer sequence of Target, invA-R3, is shown in SEQ ID NO. 8, which is: CCGCCAATAAAGTTCACAAAGAT;

[0097] The LAMP reaction primer sequence of Target, invA-FIP, is shown in SEQ ID NO. 9, which is: GCATCCGCATCAATAATACCGTTTCTCTGGATGGTATGCCCGG;

[0098] The LAMP reaction primer sequence of Target, invA-BIP, is shown in SEQ ID NO. 10, which is: GAACGGCGAAGCGTACTGGAACATCGCACCGTCAAAGGAA;

[0099] The LAMP reaction primer sequence of Target, invA-LF, is shown in SEQ ID NO. 11, which is: TCTGGATGGTATGCCCGGT;

[0100] The LAMP reaction primer sequence of Target, invA-LB, is shown in SEQ ID NO. 12, which is: CATCGCACCGTCAAAGGAA;

[0101] like Figure 1 As shown in the figure, amplification and shearing reaction: first, double-stranded DNA was extracted from the samples of Salmonella, Escherichia coli O157:H7, Listeria monocytogenes, Vibrio parahaemolyticus and Staphylococcus aureus to be tested, and the concentration was diluted to 10 3 copies / μL; the reaction system was added separately, the reaction system included 0.54mM dNTPs, 40mM Tris-HCl, 12.6mM MgSO4, 10mM KCl, 0.5mMATP, 10mM DTT, 20mM (NH4)2SO4, 0.2% Triton X-100 and 400mM mannitol, pH 7.5. Primer FIP / BIP 10μM, primer F3 / R3 2.5μM, primer LF / LB 5μM; FAM-labeled fluorescent probe 12μM; small guide RNA 80nM, enzyme mixture (Bst DNA polymerase, 24U; Cas12b protein, 150nM).

[0102] Fluorescence detection: After the reaction is mixed, the temperature is set to 63 degrees in the fluorescence real-time quantitative PCR instrument (7900HT Fast Real-Time PCR), the fluorescent group of the fluorescence detection probe is FAM, the TTA-reporter sequence is as shown in SEQ ID NO.13: FAM-TTATTATT-BHQ1, the fluorescence signal collection time interval is 1 minute, and the detection time is 80 minutes.

[0103] The specific reaction process is as follows: add the double-stranded DNA to be tested into the integrated system of amplification and reaction, react at 63°C for 80 minutes, and simultaneously use the 7900HT Fast Real-Time RCR system for fluorescence signal detection. The fluorescence signal collection time interval is 1 minute and the detection time is 80 minutes.

[0104] Results: Figure 3 As shown, this method can detect double-stranded DNA of Salmonella with high specificity, and this method will not cross-react with other common foodborne pathogens, and there will be no false positives.

[0105] Example 3: Optimization of the reaction temperature of the system for detecting Salmonella by the present method

[0106] Salmonella dsDNA (Target) was selected as the target sequence. The Target sequence is shown in SEQ ID NO.1, which is:

[0107] GGTGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTTATCGTTATTACCAAAGGTTCAGAACGTGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCGGATGCCGCGCGCGA ACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTTTACGGTTCCTTTGACGGTGCGATGAAGTTTATCAAAGGTGACGCTATTGCCGGCATCATTATTATCTTTGTGAACTTTATTGGCGGTATTTCGGTGGGGATGACTCGCCATGGTATGGATTTGTCCTCCGCCCTGTCTACTTA

[0108] Preparation of small guide RNA: Synthesize forward primer BrCas12b-sgRNA-F1 including T7 as SEQ ID NO.2, as follows:

[0109] TTCTTAATACGACTCACTATAGGGGAAGGTGGTTAGCTACAGGCTG ACCAGTGCAGTTG;

[0110] The forward primer BrCas12b-sgRNA-F2 of T7 is as shown in SEQ ID NO.3, which is:

[0111] GGCTGACCAGTGCAGTTGTGTCATGTGCTACGGTGACCTAACACGT CACTCAGTCACAA;

[0112] The forward primer BrCas12b-sgRNA-F3 of T7 is as shown in SEQ ID NO.4, which is:

[0113] CACGTCACTCAGTCACAACGGCTATCTATATTTCCACTAACCAAAGT TAGTGGAAATGT;

[0114] The forward primer Br-Sal-invA-sgRNA-F4 of T7 is as shown in SEQ ID NO.5, which is:

[0115] ACCAAAGTTAGTGGAAATGTAGATGGTTAGCACCATCCGCATCAAT AATACCG;

[0116] The reverse complementary long primer Br-Sal-invA-sgRNA-R containing the T7 sequence is shown in SEQ ID NO.6, which is: CGGTATTATTGATGCGGATGGTGCT;

[0117] The sgRNA transcription template was prepared by overlapping PCR, and the reaction was carried out overnight at 37 degrees using T7 transcriptase. The sgRNA was then purified using the RNAClean&Concentrator 100 kit and stored at -20 degrees or -80 degrees.

[0118] The LAMP reaction primer sequence of Target, invA-F3, is shown in SEQ ID NO.7, which is: GTTGTCTTCTCTATTGTCACCGTGGT;

[0119] The LAMP reaction primer sequence of Target, invA-R3, is shown in SEQ ID NO. 8, which is: CCGCCAATAAAGTTCACAAAGAT;

[0120] The LAMP reaction primer sequence of Target, invA-FIP, is shown in SEQ ID NO. 9, which is: GCATCCGCATCAATAATACCGTTTCTCTGGATGGTATGCCCGG;

[0121] The LAMP reaction primer sequence of Target, invA-BIP, is shown in SEQ ID NO. 10, which is: GAACGGCGAAGCGTACTGGAACATCGCACCGTCAAAGGAA;

[0122] The LAMP reaction primer sequence of Target, invA-LF, is shown in SEQ ID NO. 11, which is: TCTGGATGGTATGCCCGGT;

[0123] The LAMP reaction primer sequence of Target, invA-LB, is shown in SEQ ID NO. 12, which is: CATCGCACCGTCAAAGGAA;

[0124] like Figure 1 As shown in the figure, amplification and shearing reaction: first, double-stranded DNA was extracted from the Salmonella sample to be tested, and the concentration was gradiently diluted to 10 3copies / μL; the reaction system was added separately, the reaction system included 0.54mM dNTPs, 40mM Tris-HCl, 12.6mM MgSO4, 10mM KCl, 0.5mMATP, 10mM DTT, 20mM (NH4)2SO4, 0.2% Triton X-100 and 400mM mannitol, pH 7.5. Primer FIP / BIP 10μM, primer F3 / R3 2.5μM, primer LF / LB 5μM; FAM-labeled fluorescent probe 12μM; small guide RNA 80nM, enzyme mixture (Bst DNA polymerase, 24U; Cas12b protein, 150nM).

[0125] Fluorescence detection: After the reaction was mixed, it was divided into 10 parallel groups and the temperature was set to 61-70 degrees in a fluorescence real-time quantitative PCR instrument (7900HT FastReal-Time PCR) for reaction. The fluorescent group of the fluorescence detection probe was FAM, and the TTA-reporter sequence was as shown in SEQ ID NO.13: FAM-TTATTATT-BHQ1. The fluorescence signal collection time interval was 1 minute, and the detection time was 80 minutes.

[0126] The specific reaction process is as follows: the double-stranded DNA to be tested is added to the integrated system of amplification and reaction, divided into 10 repeated parallel groups, and reacted at a constant temperature of 61°C-70°C for 80 minutes. The 7900HT Fast Real-TimeRCR system is used for fluorescence signal detection simultaneously. The fluorescence signal collection time interval is 1 minute and the detection time is 80 minutes.

[0127] Results: Figure 4 As shown, when the reaction temperature is 63°C, the reaction efficiency of this method in detecting double-stranded DNA of Salmonella is the highest, and this is taken as the optimal detection temperature of the detection method.

[0128] Example 4: Batch sample testing of the present method for detecting Salmonella

[0129] Salmonella dsDNA (Target) was selected as the target sequence. The Target sequence is shown in SEQ ID NO.1, which is:

[0130] GGTGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTTATCGTTATTACCAAAGGTTCAGAACGTGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAAACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCGGATGCCGCGCGCGA ACGGCGAAGCGTACTGGAAAGGGAAAGCCAGCTTTACGGTTCCTTTGACGGTGCGATGAAGTTTATCAAAGGTGACGCTATTGCCGGCATCATTATTATCTTTGTGAACTTTATTGGCGGTATTTCGGTGGGGATGACTCGCCATGGTATGGATTTGTCCTCCGCCCTGTCTACTTA

[0131] Preparation of small guide RNA: Synthesize forward primer BrCas12b-sgRNA-F1 including T7 as SEQ ID NO.2, as follows:

[0132] TTCTTAATACGACTCACTATAGGGGAAGGTGGTTAGCTACAGGCTG ACCAGTGCAGTTG;

[0133] The forward primer BrCas12b-sgRNA-F2 of T7 is as shown in SEQ ID NO.3, which is:

[0134] GGCTGACCAGTGCAGTTGTGTCATGTGCTACGGTGACCTAACACGT CACTCAGTCACAA;

[0135] The forward primer BrCas12b-sgRNA-F3 of T7 is as shown in SEQ ID NO.4, which is:

[0136] CACGTCACTCAGTCACAACGGCTATCTATATTTCCACTAACCAAAGT TAGTGGAAATGT;

[0137] The forward primer Br-Sal-invA-sgRNA-F4 of T7 is as shown in SEQ ID NO.5, which is:

[0138] ACCAAAGTTAGTGGAAATGTAGATGGTTAGCACCATCCGCATCAAT AATACCG;

[0139] The reverse complementary long primer Br-Sal-invA-sgRNA-R containing the T7 sequence is shown in SEQ ID NO.6, which is: CGGTATTATTGATGCGGATGGTGCT;

[0140] The sgRNA transcription template was prepared by overlapping PCR, and the reaction was carried out overnight at 37 degrees using T7 transcriptase. The sgRNA was then purified using the RNAClean&Concentrator 100 kit and stored at -20 degrees or -80 degrees.

[0141] The LAMP reaction primer sequence of Target, invA-F3, is shown in SEQ ID NO.7, which is: GTTGTCTTCTCTATTGTCACCGTGGT;

[0142] The LAMP reaction primer sequence of Target, invA-R3, is shown in SEQ ID NO. 8, which is: CCGCCAATAAAGTTCACAAAGAT;

[0143] The LAMP reaction primer sequence of Target, invA-FIP, is shown in SEQ ID NO. 9, which is: GCATCCGCATCAATAATACCGTTTCTCTGGATGGTATGCCCGG;

[0144] The LAMP reaction primer sequence of Target, invA-BIP, is shown in SEQ ID NO. 10, which is: GAACGGCGAAGCGTACTGGAACATCGCACCGTCAAAGGAA;

[0145] The LAMP reaction primer sequence of Target, invA-LF, is shown in SEQ ID NO. 11, which is: TCTGGATGGTATGCCCGGT;

[0146] The LAMP reaction primer sequence of Target, invA-LB, is shown in SEQ ID NO. 12, which is: CATCGCACCGTCAAAGGAA;

[0147] like Figure 1As shown, amplification and shearing reaction: first, DNA was extracted from 10 groups of Salmonella positive samples and 10 groups of negative samples to be tested; the reaction system was added separately, and the reaction system included 0.54mM dNTPs, 40mM Tris-HCl, 12.6mMMgSO4, 10mM KCl, 0.5mMATP, 10mM DTT, 20mM (NH4) 2SO4, 0.2% Triton X-100 and 400mM mannitol, with a pH value of 7.5. Primer FIP / BIP 10μM, primer F3 / R3 2.5μM, primer LF / LB 5μM; FAM-labeled fluorescent probe 12μM; small guide RNA 80nM, enzyme mixture (Bst DNA polymerase, 24U; Cas12b protein, 150nM).

[0148] Fluorescence detection: After the reaction is mixed, the temperature is set to 63 degrees in the fluorescence real-time quantitative PCR instrument (7900HT Fast Real-Time PCR), the fluorescent group of the fluorescence detection probe is FAM, the TTA-reporter sequence is as shown in SEQ ID NO.13: FAM-TTATTATT-BHQ1, the fluorescence signal collection time interval is 1 minute, and the detection time is 80 minutes.

[0149] The specific reaction process is as follows: the target to be detected is added to the integrated system of amplification and reaction, the reaction is carried out at a constant temperature of 63°C for 80 minutes, and the 7900HT Fast Real-Time RCR system is used for fluorescence signal detection simultaneously. The fluorescence signal collection time interval is 1 minute and the detection time is 80 minutes.

[0150] Results: Figure 5 As shown, the accuracy of this method in detecting Salmonella is 100%, and no false positive or false negative events will occur.

[0151] The reaction process of this method includes LAMP target pre-amplification, CRISPR-related Cas protein or its variant recognition and cleavage, and single-tube one-pot detection reaction. The present invention successfully constructed a Cas-LAMP technology that integrates these two steps of reaction simultaneously, targeting the technical difficulties of target amplification, product recognition and cleavage, and the difficulty of performing both simultaneously in a single reaction system. In an in vitro single reaction tube system, nucleic acid molecules are enriched, amplified and identified at a constant temperature, thereby achieving accurate, ultra-sensitive and rapid detection of nucleic acid molecules.

[0152] Compared with the traditional nucleic acid molecule detection method, the present invention has the following advantages: no need to rely on PAM sites, extremely short detection time, high specificity, stable and reliable method, and can be applied to any DNA nucleic acid molecule target. This method has broad application prospects in the field of rapid nucleic acid molecule detection.

[0153] The specific embodiments of the present invention are described in detail above. It should be noted that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various deformations or modifications to the present invention without departing from the scope of the claims, and these changes should not affect the essential content of the present invention.

[0154]

[0155] <213> Artificial Sequence

[0156] <400> 4

[0157] cacgtcactc agtcacaacg gctatctata tttccactaa ccaaagttag tggaaatgt 59 <210> 5

[0158] <211> 53

[0159] <212> DNA

[0160] <213> Artificial Sequence

[0161] <400> 5

[0162] accaaagtta gtggaaatgt agatggttag caccatccgc atcaataata ccg 53

[0163] <210> 6

[0164] <211> 25

[0165] <212> DNA

[0166] <213> Artificial Sequence

[0167] <400> 6

[0168] cggtattatt gatgcggatg gtgct 25

[0169] <210> 7

[0170] <211> 26

[0171] <212> DNA

[0172] <213> Artificial Sequence

[0173] <400> 7

[0174] gttgtcttct ctattgtcac cgtggt 26

[0175] <210> 8

[0176] <211> twenty three

[0177] <212> DNA

[0178] <213> Artificial Sequence

[0179] <400> 8

[0180] ccgccaataa agttcacaaa gat 23

[0181] <210> 9

[0182] <211> 43

[0183] <212> DNA

[0184] <213> Artificial Sequence

[0185] <400> 9

[0186] gcatccgcat caataatacc gtttctctgg atggtatgcc cgg 43

[0187]

[0188]

Claims

1. A one-pot nucleic acid molecule detection method mediated by LAMP and CRISPR / BrCas12b for detecting Salmonella, characterized in that: The nucleic acid molecule detection method comprises the following steps: S1. Extract nucleic acid samples from Salmonella samples; S2. Prepare a reaction system mixed solution, wherein the mixed solution includes: a single-stranded DNA reverse-cleavage probe, 6 oligonucleotide LAMP primers, a small (single) guide RNA (sgRNA) or its derivatives, a CRISPR-related Cas protein or its variants, a Cas-LAMP one-pot reaction buffer, and a Bst DNA polymerase or its variants; S3, adding the nucleic acid sample to the reaction system mixture, performing a constant temperature reaction, and releasing a fluorescent signal; S4. After the fluorescent probe is cut, it generates a detectable fluorescent signal, which is read and recorded. The fluorescent signal is used to determine the presence of the target nucleic acid molecule in the sample to be tested. The nucleic acid test result is presented in real time in the form of a fluorescence curve.

2. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The nucleic acid molecules to be detected in the nucleic acid sample in step (1) include one or more of single-stranded DNA and double-stranded DNA.

3. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The CRISPR-associated Cas protein or its variant is a nuclease having single-stranded or double-stranded DNA recognition and cleavage functions and single-stranded DNA cleavage functions; the CRISPR-associated Cas protein or its variant includes any one of AacCas12b, AapCas12b, and BrCas12b or any one of their variants.

4. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The single-stranded DNA trans-cleavage probe is a single-stranded DNA, the 5' end of which is labeled with a fluorescent group including but not limited to FAM, HEX, VIC, CY5, CY3, ROX, TAMRA, TET, FITC, and JOE, and the 3' end is labeled with a quenching group including but not limited to TAMRA, BHQ1, MGB, BHQ2, etc. that can be combined with any fluorescent group at the 5' end.

5. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The small guide RNA or its derivative comprises a sequence complementary to the oligonucleotide LAMP primer invA-FIP; and the oligonucleotide LAMP primer invA-FIP sequence is complementary to a partial sequence of one chain of the target molecule and a partial sequence of the small guide RNA or its derivative, and also introduces a PAM site sequence.

6. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The Bst strand displacement DNA polymerase described in step (2) is a DNA polymerase with strand displacement effect, which can displace the downstream DNA chain without template denaturation; the DNA polymerase can be any one of Bst 2.0 DNA polymerase, Bst 3.0 DNA polymerase, Warmstar Bst 2.0 DNA polymerase, Bst LF DNA polymerase, OmniAmp DNA polymerase, etc., or any variant of any one of them.

7. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The spacer sequence of the small guide RNA (sgRNA) or its derivative described in step (2) is complementary to the LAMP product nucleic acid molecule sequence.

8. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The DNA single-stranded trans-cleavage probe described in step (2) is a random TA-rich single-stranded DNA sequence, which can be TTATTATT or TTTTT or TTTTTTTT or other TA-rich single-stranded DNA sequences, and the preferred sequence is TTATTATT; this sequence can be recognized by the CRISPR-Cas protein and non-specifically cleaved.

9. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The main components of the Cas-LAMP one-pot reaction buffer in step (2) include dNTPs, Tris-HCl, MgSO4, KCl, ATP, DTT, (NH4)2SO4, Triton X-100 and mannitol. The preferred reaction buffer includes: 0.18mM-1.62mM dNTPs, 10mM-40mM Tris-HCl, 1.8mM-16.2mM MgSO4, 5mM-20mM KCl, 0.01mM-10mM ATP, 0.5mM-10mM DTT, 5mM-20mM (NH4)2SO4, 0.1%-0.4% Triton X-100 and 100mM-400mM mannitol, with a pH value between 6.5-8.

0.

10. An isothermal nucleic acid detection system (kit) for the Salmonella nucleic acid detection method according to claim 1, characterized in that: The kit includes a single-stranded DNA trans-cleavage fluorescent reporter probe, 6 oligonucleotide LAMP primers, a small (single) guide RNA (sgRNA) or its derivatives, a CRISPR-related Cas protein or its variants, a Cas-LAMP one-pot reaction buffer, and a Bst DNA polymerase or its variants.

Images