ELISA quantitative detection method for exogenous Syn1-Rep protein in plant

Abstract

The invention discloses an ELISA quantitative detection method for exogenous Syn1-Rep protein in a plant, and relates to the technical field of plant molecular detection. The invention also provides a hybridoma cell strain with the preservation number of CGMCC (China General Microbiological Culture Collection Center) NO.46130 and a monoclonal antibody prepared from the hybridoma cell strain. The novel herbicide-resistant protein Syn1-Rep is quantitatively detected by adopting an ELISA method combining monoclonal antibody and polyclonal antibody sandwich and biotin and streptavidin, the used consumables are simple and easy to obtain, the reaction specificity is ensured, the detection sensitivity is increased, and the method has universality.

Description

Technical Field

[0001] The present invention relates to the technical field of plant molecular detection, and more specifically to an ELISA quantitative detection method for exogenous Syn1-Rep protein in plants. Background Art

[0002] Rapeseed is one of the important oil crops. Weeds in the field production process will cause competition for rapeseed space, nutrients, and water, seriously affecting the yield and quality of rapeseed. Glufosinate, also known as glufosinate, is a non-selective organophosphorus herbicide that first damages the leaves of plants. By inhibiting glutamine synthetase in a targeted manner, it causes plant nitrogen metabolism disorders and leads to yellowing and necrosis. The glufosinate-resistant gene is introduced into the plant genome through transgenic means, giving the target plant the glufosinate-resistant characteristic, effectively distinguishing it from natural weeds, making field spraying of glufosinate an effective weed control method.

[0003] At present, the main glufosinate resistance genes include the BAR gene from soil bacteria Streptomyces hygroscopicus, the PAT gene from viridostemyl, and the GDHA gene from Escherichia coli and seaweed. The glufosinate acetyltransferase gene Syn1-Rep of the present invention is another new glufosinate resistance gene cloned from Rhodococcus sp. strain YM12 by Huazhong Agricultural University. Rice with the Syn1-Rep gene has a strong potential for herbicide resistance and can tolerate 5000g / hm 2 The Syn1-Rep gene was introduced into the Brassica napus variety, and the foreign gene could be stably inherited in the offspring and maintain the corresponding glufosinate-resistant herbicide characteristics.

[0004] However, with the rapid development of genetically modified crops, the unexpected food safety and environmental safety issues that genetically modified crops may bring have attracted much attention. Establishing a suitable method to detect genetically modified ingredients in genetically modified foods can promote the safe management of agricultural genetically modified organisms. Since the protein encoded by the Syn1-Rep gene has a low homology with the amino acid sequence of other known PAT genes, it cannot be detected using the existing PAT protein quantitative detection kit. Therefore, it is an urgent problem for those skilled in the art to develop a rapid qualitative or quantitative analysis method for Syn1-Rep protein in herbicide-resistant rapeseed or its derivatives that needs to be solved. Summary of the invention

[0005] In view of this, the present invention provides an ELISA quantitative detection method for exogenous Syn1-Rep protein in plants.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] The ELISA quantitative detection method of exogenous Syn1-Rep protein in plants comprises the following steps:

[0008] S1: diluting the monoclonal antibody to 5 μg / mL as a coating solution (capture antibody) to coat the ELISA plate; the monoclonal antibody is secreted by a hybridoma cell line with a deposit number of CGMCC NO.46130;

[0009] S2: discard the coating solution, wash with PBST solution, and add blocking solution to block;

[0010] S3: discard the blocking solution, wash with PBST solution, and add 100 μL of the protein sample to be tested for incubation;

[0011] S4: discard the protein sample to be tested, wash with PBST solution, and add biotinylated detection antibody with a final concentration of 3 μg / mL for incubation; the biotinylated detection antibody is a biotin-labeled rabbit polyclonal antibody, which is obtained by immunizing New Zealand white rabbits with the Syn1-Rep recombinant protein shown in SEQ ID NO.2;

[0012] S5: discard the biotinylated detection antibody and add 5000-fold diluted HRP-streptavidin for incubation;

[0013] S6: Add a color developer and allow the substrate to develop color in the dark; then add a stop solution to terminate the reaction and measure the OD value at 450 nm; substitute the OD value into the standard curve to calculate the content of Syn1-Rep protein in the protein sample to be tested.

[0014] Preferably,

[0015] Add 100 μL of the coating solution in S1 to each well and coat at 4°C overnight;

[0016] S2 specifically includes: discarding the coating solution; washing with PBST solution 3-4 times, gently tapping the edge of the ELISA plate for 5 seconds each time and soaking for 30 seconds; patting the residual liquid dry, adding 250 μL of blocking solution to each well, and incubating at 25°C for 1 hour;

[0017] S3 specifically includes discarding the blocking solution; washing with PBST solution 3-4 times; patting the residual liquid dry, adding 100 μL of the protein sample to be tested to each well, and incubating at 25°C for 1 hour;

[0018] S4 specifically includes discarding the protein sample to be tested, washing with PBST solution for 5 times; patting the residual liquid dry, using antibody diluent to dilute the biotin-labeled rabbit polyclonal antibody to a final concentration of 3 μg / mL, adding 100 μL to each well, and incubating at 25°C for 1 hour;

[0019] S5 specifically discarded the biotinylated detection antibody, washed five times with PBST solution; patted dry the residual liquid, added 5000-fold diluted HRP-streptavidin, added 100 μL to each well, and incubated at 25°C for 1 h;

[0020] S6 specifically includes discarding HRP-streptavidin, washing with PBST solution for 5 times; patting dry the residual liquid, adding TMB color developer, 100 μL / well, and reacting at 25°C in the dark for 3-5 minutes; adding 50 μL 0.5 M sulfuric acid to each well to terminate the reaction, and measuring the OD value at 450 nm; substituting the OD value into the standard curve to calculate the content of Syn1-Rep protein in the protein sample to be tested.

[0021] Preferably, the standard curve formula in step S6 is y=0.0312x-0.0337, wherein x is the concentration of the standard product, and y is the OD450 value after color development.

[0022] More preferably, the drawing of the standard curve specifically includes: using the Syn1-Rep recombinant protein shown in SEQ ID NO.2 as the standard protein, diluting stepwise to obtain standard protein solutions with concentrations of 64 ng / mL, 32 ng / mL, 16 ng / mL, 8 ng / mL, 4 ng / mL, 2 ng / mL, 1 ng / mL, 0.5 ng / mL and 0 ng / mL, incubating with biotinylated detection antibodies and HRP-streptavidin, developing the color and determining the OD450 value, and drawing the standard curve regression equation.

[0023] Another object of the present invention is to provide a hybridoma cell line, wherein the deposit number of the hybridoma cell line is CGMCC NO.46130.

[0024] Another object of the present invention is to provide a monoclonal antibody secreted by the above hybridoma cell line.

[0025] Another object of the present invention is to provide a detection kit, comprising a monoclonal antibody secreted by a hybridoma cell line with a deposit number of CGMCC NO.46130, and a biotin-labeled rabbit polyclonal antibody, wherein the rabbit polyclonal antibody is obtained by immunizing New Zealand white rabbits with the Syn1-Rep recombinant protein shown in SEQ ID NO.2.

[0026] Preferably, the coating concentration of the monoclonal antibody is 5 μg / mL, and the concentration of the biotin-labeled rabbit polyclonal antibody is 3 μg / mL.

[0027] Preferably, the rabbit polyclonal antibody is prepared by using the Syn1-Rep recombinant protein shown in SEQ ID NO.2 as an antigen, immunizing 2-month-old female New Zealand white rabbits, separating serum after venous blood collection, purifying the antibody by ammonium sulfate precipitation, and purifying the antibody by Protein A-agarose affinity chromatography.

[0028] Preferably, the kit further comprises HRP-streptavidin, a color developing solution, a stop solution, a blocking solution, a washing solution and a standard substance Syn1-Rep protein;

[0029] The amino acid sequence of the standard Syn1-Rep protein is shown in SEQ ID NO.2.

[0030] Beneficial effects: The present invention discloses an ELISA quantitative detection method for exogenous Syn1-Rep protein in plants, and also provides a hybridoma cell line with a deposit number of CGMCC NO.46130 and a monoclonal antibody prepared therefrom. The present invention adopts a monoclonal antibody and a polyclonal antibody sandwich, and an ELISA method combining biotin and streptavidin to quantitatively detect the novel anti-herbicide protein Syn1-Rep, which not only ensures the reaction specificity, but also increases the detection sensitivity, and has universal applicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0032] Figure 1 : SDS-PAGE analysis of the small-scale expression of pET30a-Syn1-Rep fusion protein in Example 1 of the present invention. Lane M in the figure: protein marker; Lane 1: after B induction; Lane 2: before B induction; Lane 3: after R induction; Lane 4: before R induction.

[0033] Figure 2 : SDS-PAGE analysis of the pET30a-Syn1-Rep protein expression in Example 1 of the present invention. Lane M: protein marker; Lane 1: supernatant; Lane 2: precipitate.

[0034] Figure 3: SDS-PAGE analysis of nickel agarose affinity chromatography purification of pET30a-Syn1-Rep inclusion body fusion protein in Example 1 of the present invention. Lane M: protein marker; Lanes 1-4: 500mM / 200mM / 100mM and 50mM imidazole eluents; Lane 5: effluent.

[0035] Figure 4 : SDS-PAGE identification diagram of the pET30a-Syn1-Rep protein finally purified in Example 1 of the present invention.

[0036] Figure 5 : SDS-PAGE identification diagram of antibody specificity in Example 2 of the present invention.

[0037] Figure 6 : The standard curve drawn among Example 4 of the present invention.

[0038] Figure 7 : The standard curve drawn in Comparative Example 1 of the present invention. DETAILED DESCRIPTION

[0039] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0040] The experimental methods used in the following examples are conventional methods unless otherwise specified. The experimental materials and reagents involved can be purchased from commercial sources unless otherwise specified. The Syn1-Rep gene-transformed rapeseed leaves used are obtained from Chinese invention patent CN 110195067B.

[0041] 0.25% Coomassie Brilliant Blue Staining Solution: 100 mL of staining solution contains 0.25 g of Coomassie Brilliant Blue R-250, 45 mL of methanol, 10 mL of glacial acetic acid and 45 mL of ddH2O.

[0042] Decolorizing solution: Each liter contains 50 mL of ethanol, 100 mL of glacial acetic acid and 850 mL of ddH2O.

[0043] TBST washing solution: Each liter contains 100 mL 1M Tris-HCl, 88 g sodium chloride and 0.1% Tween-20, and ddH2O to make up to volume.

[0044] PBST washing solution: the solvent is sterile ddH2O, the solute is 0.01M PBS buffer and Tween-20; the pH value is 7.4; the volume percentage of Tween-20 in the washing solution is 0.05%.

[0045] Example 1 Preparation of Antigen

[0046] 1. Small-scale expression of recombinant protein

[0047] 1) Plasmid construction and transformation: The target gene Syn1-Rep was linked into the prokaryotic expression vector pET-30a using BamH I and Xho I to obtain the pET-30a-Syn1-Rep vector, which was then transformed into the expression strain BL21 (B).

[0048] Syn1-Rep: atgcttatcagagatgctgttcctggtgatcttcctggaatccttgagat ccacaacgaggctattgctaactctactgccatctgggatgagactcctgctgaccttgatgagagaaggagatggttcgatgacaggagagctaacggattccctgtgct cgttgctgatgttgacggagtggttgctggatacgcttcttacggagtgtggagagctaagtcatcttacagacatactgttgagaactctgtttacgtgcatgttgatcat cacaggagaggaattgctactgcactcatgactgagcttatcgagagagctagagctggaggaatccatgtgatcgttgcttctgtggagtctactaacgctacttctgtg gctcttcatgagagattcggattcaggattgttgctcacatgcctgaggtgggaagaaagttcggaagatggcttgatatgacttaccttcagctcactctttagtaa, seq ID NO.1.

[0049] 2) Activation of strains and induced expression: Pick positive colonies and culture them at 37℃ overnight for activation. Expand the activated strains to 5mL at 1:50 and culture at 37℃ until OD600=0.4-0.6. Collect 0.5mL of strains and treat them as pre-induction control. Add 1.0mM IPTG to the remaining 4.5mL and induce expression at 37℃ for 3h. The collected bacteria by centrifugation are treated as post-induction samples and protein expression is identified by SDS-PAGE. The results are shown in the attached figure. Figure 1As shown, the target protein was obviously expressed after IPTG induction.

[0050] 2. Large-scale expression and purification of recombinant proteins

[0051] 1) Activation of strains and induced expression: Resuscitate pET-30a-Syn1-Rep positive BL21(B) strains, expand the culture at 1:50 to 800 mL after activation, culture at 37°C until OD600 = 0.4-0.6, add 0.4 mM IPTG, induce expression at 37°C for 5 h. Centrifuge at 8000 rpm and 4°C for 5 min to collect the bacteria.

[0052] 2) Bacterial cell lysis: Add 100 mL of disruption solution for ultrasonic lysis. The lysis conditions are as follows: ice bath temperature, power 60%, ultrasonic 2s, interval 2s, time 15min. Then, centrifuge at 12000rpm and 4℃ for 15min, collect the supernatant and precipitate. Perform SDS-PAGE to determine the expression form of the target protein. The results are shown in the attached figure. Figure 2 As shown, pET-30a-Syn1-Rep (B) was expressed in inclusion bodies.

[0053] 3) Inclusion body protein purification: The inclusion body protein was filtered through a 0.22 μm filter membrane, and the filtrate was collected and added to the balanced nickel NTA affinity column. The flow rate was controlled at 1 drop / 6 seconds. After washing, the target protein was eluted with 500mM, 200mM, 100mM and 50mM imidazole eluents respectively, and the eluate was collected for SDS-PAGE detection. The purification effect of the inclusion body after washing and solubilization is as shown in the attached figure. Figure 3 shown.

[0054] The eluate was collected and the protein product was obtained after dialysis and refolding, and then SDS-PAGE was performed. The size of the final purified Syn1-Rep recombinant protein was between 25-35KDa. The identification of the finished product is as shown in the attached Figure 4 The amino acid sequence thereof was analyzed, as shown in SEQ ID NO.2.

[0055] MLIRDAVPGDLPGILEIHNEAIANSTAIWDETPADLDERRRWFDDRRANGFPVLVADVDGVVAGYASYGVWRAKSSYRHTVENSVYVHVDHHRRGIATALMTELIERARAGGIHVIVASVESTNATSVALHERFGFRIVAHMPEVGRKFGRWLDMTYLQLTL, SEQ ID NO. 2.

[0056] Example 2 Preparation of polyclonal antibodies

[0057] 1. Animal immunization

[0058] Select 1 female New Zealand white rabbit of 2 months old for immunization, rest for one week before immunization. Use the antigen prepared and qualified in Example 1, dissolve in sterilized PBS (pH7.2) solution, adopt the method of multiple injections in the inner thigh for 3 immunizations, each immunization dosage is 500μg / rabbit, the second immunization is carried out 20 days after the initial immunization, and the third immunization is carried out 20 days later. Except for the first immunization, an equal amount of Freund's complete adjuvant is used for emulsification, and an equal amount of Freund's incomplete adjuvant is used for emulsification thereafter. Venous blood is collected 14 days after the third immunization, and the antibody titer is detected by ELISA endpoint method. The fourth immunization is carried out 28 days later, and the ear vein injection is adopted. The immunization dosage is 100μg / rabbit, and the final antibody titer is 1:81000.

[0059] 2. Ammonium sulfate precipitation

[0060] The serum collected 14 days after the third immunization was centrifuged at room temperature at 4000rpm for 15min, and the supernatant was slowly added with saturated ammonium sulfate to half saturation under stirring at 4℃, and continued to stir for 30min, and centrifuged at 4℃ and 13000rpm for 30min, and the supernatant was discarded. The precipitate was dissolved in an appropriate amount of PBS buffer (0.01M, pH7.4), and saturated ammonium sulfate was slowly added to 33% under stirring at 4℃, and centrifuged at 4℃ and 13000rpm for 30min after stirring for 30min, and the supernatant was discarded. The precipitate was dissolved in an appropriate amount of PBS buffer (0.01M, pH7.4), dialyzed overnight at 4℃, and the polyclonal antibodies were collected.

[0061] 3. Antibody Purification

[0062] Protein A-agarose affinity chromatography column was used for purification. First, 5 mL of ultrapure water was passed through the column, and after equilibration with 5 mL of PB buffer (0.4 M, pH 7.0), the polyclonal antibody was slowly passed through the column. After washing away the impurities with 10 mL of PB buffer (0.4 M, pH 7.0), 5 mL of glycine-hydrochloric acid buffer (0.1 M, pH 2.7) was added to elute the antibody on the binding site, and then Tris-HCl (1 M, pH 8.0) was added to neutralize glycine to keep the pH of the antibody at a neutral level suitable for storage. Finally, the antibody was dialyzed into PBS buffer, and the antibody concentration detected by the BCA method was 5 mg / mL.

[0063] Example 3 Preparation of monoclonal antibodies

[0064] 1. Animal immunization

[0065] Four 6-week-old female BALB / c mice were selected for immunization. The Syn1-Rep recombinant protein prepared and qualified in Example 1 was used as an antigen, and the BALB / c mice were immunized three times by subcutaneous multi-point injection, with each immunization dose of 25 μg / mouse. The first immunization was emulsified with an equal amount of Freund's complete adjuvant, and the second immunization was performed at an interval of 28 days. The third immunization was performed by intraperitoneal injection at an interval of 14 days, and both were emulsified with an equal amount of Freund's incomplete adjuvant. Blood was collected from the tail vein 10 days after the second immunization, and the antibody titer was measured by an indirect method. Mice with higher antibody titers were selected for cell fusion.

[0066] 2. Establishment of hybridoma cell lines

[0067] 1) Cell fusion: Resuscitate myeloma cells and place them in a 37°C carbon dioxide incubator for later use. Take the immunized mouse with the highest titer, remove the eyeball and collect blood, and separate the serum as the positive control serum for detection. The immunized mice were killed by cervical dislocation, the spleen was removed, the connective tissue was removed, and a spleen cell suspension was prepared. The obtained spleen cells were fused with myeloma cells, polyethylene glycol (PEG) was used as a fusion agent, centrifuged, the supernatant was discarded, HAT selective culture medium was added, and single cell suspension was blown into a 96-well cell culture plate for screening.

[0068] 2) Screening of positive hybridoma cells: On the 7th day after cell fusion, visible clones grow at the bottom of the culture plate wells. The indirect ELISA method is used for primary screening, and the cell wells showing strong positive results are recorded. The positive cell wells are expanded and cloned in a 24-well plate in a timely manner. The limiting dilution method is used for secondary screening, and the cell suspension is continuously diluted until each well of the 96-well plate contains only a single cell. After several cloning operations, the positive rate of all cloned cell wells is 100%, which can determine that the hybridoma cell line secreting monoclonal antibodies has been obtained, and ascites is prepared after expansion culture.

[0069] 3. Preparation and purification of monoclonal antibodies

[0070] 1) Ascites preparation: 6-week-old healthy female mice were sensitized by intraperitoneal injection of 0.5 mL of liquid paraffin. One week later, 1×10 6 -2×10 6 The mice were cultured with a Syn1-Rep monoclonal antibody hybridoma cell and the condition of the mice was observed. After 7-10 days, when the abdominal cavity of the mice was obviously swollen, the ascites was collected.

[0071] 2) Antibody purification: After the collected ascites was precipitated with ammonium sulfate, a Protein G-agarose affinity chromatography column was used for purification, and the specific steps were performed according to Example 2. A total of 10 positive monoclonal hybridoma cell lines were screened and established.

[0072] The double antibody sandwich ELISA method was used to screen monoclonal antibodies that could be paired with the rabbit polyclonal antibody in Example 2. The pairing results are shown in Table 1, where # indicates that the OD450 value exceeds the upper limit of detection of the microplate reader.

[0073] Table 1 ELISA pairing analysis of monoclonal antibody and polyclonal antibody

[0074]

[0075] The results showed that only the monoclonal antibody secreted by No. 5 could be paired with the rabbit polyclonal antibody (i.e., Example 2) to detect the transgenic sample, and the other antibodies failed to detect the positive sample. The monoclonal antibody No. 5 was identified as IgG2a subtype, with a light chain of K type, a concentration of 2.5 mg / mL, and an optimal titer of 729K. The concentration of the rabbit polyclonal antibody in this example was 5 mg / mL, and the optimal titer was 729K.

[0076] 4. Specificity Identification of Syn1-Rep Monoclonal Antibody

[0077] The overexpression system was used to detect the Syn1-Rep mouse monoclonal antibody, and the Syn1-Rep transgenic rapeseed leaf protein and the prokaryotic expressed Syn1-Rep recombinant protein were detected by Western Blot. The specific steps are as follows:

[0078] 1) Extraction of total protein from rapeseed leaves: Take leaf materials (wild-type control and Syn1-Rep gene-transfected rapeseed) into 2 mL centrifuge tubes, grind into powder with liquid nitrogen, add 700 μL of plant total protein extract, shake and mix, place at 4°C for 20 min, then centrifuge at 4°C, 12,000 rpm for 10 min, aspirate the supernatant, divide into portions and store in a -80°C refrigerator.

[0079] 2) Protein denaturation: The sample protein and protein loading buffer (5×) were mixed at a volume ratio of 4:1 and placed in a 100°C metal bath for denaturation for 10 min.

[0080] 3) Western Blot: Transfer the protein separated by PAGE gel electrophoresis to a PVDF membrane, add blocking solution and incubate for 1 hour, add primary antibody and incubate overnight in a shaker at 4°C. The next day, wash the membrane 6 times with TBST for 5 minutes each time, add secondary antibody and incubate for 1 hour, and wash the membrane 6 times with TBST for 5 minutes each time. Finally, add ECL chemiluminescent substrate and observe the results in a Bio-Rad developer. The PAGE gel preparation kit used in this example has an upper gel concentration of 4.5% and a lower gel concentration of 12.5%. The primary antibody used is ascites-type Syn1-Rep mouse monoclonal antibody (secreted by monoclonal hybridoma cell line No. 5), and the secondary antibody is HRP-labeled goat anti-mouse IgG.

[0081] The experimental results are as attached Figure 5 As shown, the target protein Syn1-Rep was detected at about 15 kDa in the Syn1-Rep transgenic rapeseed leaf protein samples, indicating that the monoclonal antibody prepared in this example can specifically immunorecognize the Syn1-Rep protein.

[0082] 5. Biological preservation

[0083] The obtained numbered 5Syn1-Rep mouse monoclonal antibody hybridoma cell line was named Syn1-Rep-10 and deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on November 7, 2024, with the deposit number CGMCCNO.46130, and the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0084] Example 4 Establishment of biotin-streptavidin double antibody sandwich ELISA detection system

[0085] 1. Concentration selection range of standard curve

[0086] The concentration range of the standard curve is particularly important to ensure the accuracy of the experimental results. Selecting an appropriate concentration range is conducive to the establishment of the standard curve and ultimately accurately calculating the sample concentration based on the standard curve. 2 It should be greater than 0.99, and the OD450 value of each scattered point should be between 2-0.08 to avoid exceeding the optimal reading range of the instrument.

[0087] 2. Drawing of standard curve

[0088] 1) Antibody coating: The monoclonal antibody purified in Example 3 was used as the capture antibody (secreted by monoclonal hybridoma cell line No. 5), diluted to 5 μg / mL and coated on the ELISA plate. 100 μL was added to each well and placed at 4° C. overnight to allow the capture antibody to adsorb to the surface of the ELISA plate.

[0089] 2) Blocking: Discard the liquid in the ELISA plate, add 250μL PBST to each well and wash 3-4 times, gently tap the edge of the ELISA plate for 5s each time and soak for 30s. After washing, pat dry the remaining liquid on absorbent paper, add 250μL commercial blocking solution (E-ELIR-003) to each well, and incubate at 25℃ for 1h.

[0090] 3) Standard product incubation: Wash the plate 3-4 times with PBST and pat dry the residual liquid. Take the Syn1-Rep recombinant protein prepared in Example 1 as the standard protein and dilute it to 10 μg / mL. Then dilute it step by step to obtain standard protein solutions with concentrations of 64 ng / mL, 32 ng / mL, 16 ng / mL, 8 ng / mL, 4 ng / mL, 2 ng / mL, 1 ng / mL, 0.5 ng / mL and 0 ng / mL. Add 100 μL to each well and incubate at 25°C for 1 hour.

[0091] 4) Incubation with biotinylated detection antibody: Wash the plate 5 times with PBST and pat dry, dilute the biotinylated detection antibody to a final concentration of 3 μg / mL with antibody diluent, add 100 μL to each well, and incubate at 25°C for 1 hour. The detection antibody in this embodiment is a biotin-labeled rabbit polyclonal antibody [using a commercial biotin labeling kit (E-LK-B002A), the rabbit polyclonal antibody containing primary amino (-NH2) molecules is labeled. Specifically, it includes concentration and liquid replacement, quantitative recovery, labeling reaction, blocking termination, ultrafiltration purification and product collection, and the final detection antibody concentration is 8 mg / mL].

[0092] 5) HRP-streptavidin incubation: Wash the plate 5 times with PBST and pat dry. Dilute HRP-streptavidin 5000 times, add 100 μL to each well, and incubate at 25° C. for 1 h.

[0093] 6) Substrate color development reaction: Wash the plate 5 times with PBST and pat dry the residual liquid, add 100 μL of color developer to each well, place in 25°C in the dark for 3-5 minutes, then add 50 μL of stop solution and use TECAN microplate reader to detect the OD450 of the resulting solution. In this example, the color developer is TMB substrate solution and the stop solution is 0.5 M sulfuric acid.

[0094] Experimental results: The final standard curve is as shown in the attached Figure 6 .

[0095] Reference formula: y=0.0312x-0.0337, where x is the concentration of the standard product, the detection sensitivity can reach 1ng / mL, and y is the OD450 value after color development.

[0096] Example 5 ELISA quantitative detection method for exogenous Syn1-Rep protein in rapeseed

[0097] 1) Extraction of total protein from rapeseed leaves: Take about 0.1 g of fresh leaf material (wild-type control and Syn1-Rep gene-transfected Brassica napus) and grind it into powder with liquid nitrogen. Add 500 μL of plant total protein extract, shake and mix well, place at 4°C for 20 min, then centrifuge at 4°C and 12,000 rpm for 10 min, aspirate the supernatant, and store in a -80°C refrigerator.

[0098] 2) Determination of exogenous Syn1-Rep protein content by biotin-streptavidin double antibody sandwich ELISA: According to the steps of Example 4, capture antibody coating, blocking, sample incubation, biotinylated detection antibody incubation, HRP-streptavidin incubation and color development reaction and other operations are performed. The sample in this example is rapeseed leaf and bud tissue protein diluted 20 times. The measured OD450 value is substituted into the standard curve regression equation y=0.0312x-0.0337, and the exogenous Syn1-Rep protein content contained in the sample to be tested is calculated as shown in Table 2.

[0099] Table 2 Exogenous Syn1-Rep protein content in transgenic rapeseed

[0100]

[0101] Comparative Example 1 Different double antibody sandwich ELISA detection methods

[0102] Rabbit polyclonal antibody-HRP labeled secondary antibody double antibody sandwich ELISA detection

[0103] 1) Antibody coating: The purified No. 5 Syn1-Rep monoclonal antibody in Example 3 was used as the capture antibody, diluted to 5 μg / mL and coated on the ELISA plate, 100 μL per well.

[0104] 2) Standard product incubation: Wash the plate 4-5 times and pat dry. Dilute the Syn1-Rep recombinant protein prepared in Example 1 to 32ng / mL, 16ng / mL, 8ng / mL, 4ng / mL, 2ng / mL, 1ng / mL, 0.5ng / mL and 0ng / mL standard protein solutions as standard protein. Add 100μL to each well and incubate at 25℃ for 1h. Add 100μL to each well, gently shake and mix, and incubate at 25℃ for 45min.

[0105] 3) Rabbit polyclonal antibody incubation: Wash the plate 5 times and pat dry, add 100 μL rabbit polyclonal antibody to each well, and incubate at 25°C for 30 min.

[0106] 4) Enzyme-labeled antibody incubation: Wash the plate 5 times and pat dry, add 100 μL HRP-labeled secondary antibody to each well, and incubate at 25°C for 30 min.

[0107] 5) Substrate color development reaction: Wash the plate 5 times and pat dry the residual liquid, add 100 μL of color developer to each well, place it in the dark at 25°C for 15 minutes, then add 100 μL of stop solution, and use a microplate reader to measure the OD450 of each well. In this comparative example, the color developer is TMB substrate solution. The measured OD450 value is put into the standard curve regression equation to calculate the exogenous Syn1-Rep protein content contained in the sample.

[0108] Experimental results: The final standard curve is as shown in the attached Figure 7 .

[0109] Reference formula: y=0.0381x+0.1089, where x is the concentration of the standard product, the detection sensitivity can reach 2ng / mL, and y is the OD450 value after color development.

[0110] The capture antibody in this comparative example is No. 5 Syn1-Rep mouse monoclonal antibody, and the sensitivity of the mouse monoclonal antibody-rabbit polyclonal antibody-enzyme-labeled secondary antibody double antibody sandwich detection method and the mouse monoclonal antibody-biotinylated rabbit polyclonal antibody-HRP-labeled streptavidin double antibody sandwich detection method are compared. After the detection antibody Syn1-Rep rabbit polyclonal antibody is biotinylated, the standard curve R 2 The value changed from 0.9601 to 0.9991, and the detection sensitivity changed from 2ng / mL to 1ng / mL, achieving the signal amplification effect. A series of optimizations were made to the double antibody sandwich ELISA detection system, including extending the sample and antibody incubation time to 1h, adding a 5s plate vibration step before the 30s soaking step during plate washing to reduce reagent residues, and reducing the substrate color development reaction time from 15min to 5min, effectively reducing the probability of nonspecific binding.

[0111] Comprehensive antibody titer, feasibility of detection with multiple antibodies, positive detection rate, detection sensitivity and standard curve R 2 Based on factors such as the value of γ-ray diffraction patterns, the Syn1-Rep mouse monoclonal antibody numbered 5 was selected as the capture antibody to be paired with the biotinylated rabbit polyclonal antibody. The Syn1-Rep protein double antibody sandwich ELISA detection system was established by combining the biotinylated rabbit polyclonal antibody with HRP-streptavidin to amplify the detection signal, which effectively increased the specificity and sensitivity of the sample protein Syn1-Rep detection.

[0112] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0113] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. An ELISA quantitative detection method for exogenous Syn1-Rep protein in plants, characterized in that: The following steps are involved: S1: diluting the monoclonal antibody to 5 μg / mL as a coating solution (capture antibody) to coat the ELISA plate; the monoclonal antibody is secreted by a hybridoma cell line with a deposit number of CGMCC NO.46130; S2: discard the coating solution, wash with PBST solution, and add blocking solution to block; S3: discard the blocking solution, wash with PBST solution, and add 100 μL of the protein sample to be tested for incubation; S4: discard the protein sample to be tested, wash with PBST solution, and add biotinylated detection antibody with a final concentration of 3 μg / mL for incubation; the biotinylated detection antibody is a biotin-labeled rabbit polyclonal antibody, which is obtained by immunizing New Zealand white rabbits with the Syn1-Rep recombinant protein shown in SEQ ID NO.2; S5: discard the biotinylated detection antibody and add 5000-fold diluted HRP-streptavidin for incubation; S6: Add a color developer and allow the substrate to develop color in the dark; then add a stop solution to terminate the reaction and measure the OD value at 450 nm; substitute the OD value into the standard curve to calculate the content of Syn1-Rep protein in the protein sample to be tested.

2. The ELISA quantitative detection method of exogenous Syn1-Rep protein in plants according to claim 1, characterized in that: Add 100 μL of the coating solution in S1 to each well and coat at 4°C overnight; S2 specifically includes: discarding the coating solution; washing with PBST solution 3-4 times, gently tapping the edge of the ELISA plate for 5 seconds each time and soaking for 30 seconds; patting the residual liquid dry, adding 250 μL of blocking solution to each well, and incubating at 25°C for 1 hour; S3 specifically includes discarding the blocking solution; washing with PBST solution 3-4 times; patting the residual liquid dry, adding 100 μL of the protein sample to be tested to each well, and incubating at 25°C for 1 hour; S4 specifically includes discarding the protein sample to be tested and washing with PBST solution 5 times; Pat dry the remaining liquid, dilute the biotinylated rabbit polyclonal antibody with antibody diluent to a final concentration of 3 μg / mL, add 100 μL to each well, and incubate at 25°C for 1 h; S5 specifically discarded the biotinylated detection antibody, washed five times with PBST solution; patted dry the residual liquid, added 5000-fold diluted HRP-streptavidin, added 100 μL to each well, and incubated at 25°C for 1 h; S6 specifically includes discarding HRP-streptavidin, washing with PBST solution for 5 times; patting dry the residual liquid, adding TMB color developer, 100 μL / well, and reacting at 25°C in the dark for 3-5 minutes; adding 50 μL 0.5 M sulfuric acid to each well to terminate the reaction, and measuring the OD value at 450 nm; substituting the OD value into the standard curve to calculate the content of Syn1-Rep protein in the protein sample to be tested.

3. The ELISA quantitative detection method of exogenous Syn1-Rep protein in plants according to claim 1, characterized in that: The standard curve formula in step S6 is y=0.0312x-0.0337, where x is the concentration of the standard product and y is the OD450 value after color development.

4. The ELISA quantitative detection method of exogenous Syn1-Rep protein in plants according to claim 3, characterized in that: The drawing of the standard curve specifically includes: using the Syn1-Rep recombinant protein shown in SEQ ID NO.2 as the standard protein, diluting stepwise to obtain standard protein solutions with concentrations of 64 ng / mL, 32 ng / mL, 16 ng / mL, 8 ng / mL, 4 ng / mL, 2 ng / mL, 1 ng / mL, 0.5 ng / mL and 0 ng / mL, incubating with biotinylated detection antibodies and HRP-streptavidin, developing the color and measuring the OD450 value, and drawing the standard curve regression equation.

5. A hybridoma cell line, characterized in that: The deposit number is CGMCC NO.46130.

6. A monoclonal antibody, characterized in that Obtained by secretion from the hybridoma cell line described in claim 5.

7. A detection kit, characterized in that: The invention comprises a monoclonal antibody secreted by a hybridoma cell line with a deposit number of CGMCC NO.46130 and a rabbit polyclonal antibody labeled with biotin. The rabbit polyclonal antibody is obtained by immunizing New Zealand white rabbits with the Syn1-Rep recombinant protein shown in SEQ ID NO.

2.

8. The kit according to claim 7, characterized in that The coating concentration of the monoclonal antibody was 5 μg / mL, and the concentration of the biotin-labeled rabbit polyclonal antibody was 3 μg / mL.

9. The kit according to claim 7, characterized in that The rabbit polyclonal antibody is prepared by using the Syn1-Rep recombinant protein shown in SEQID NO.2 as an antigen, immunizing 2-month-old female New Zealand white rabbits, separating serum after venous blood collection, purifying antibodies by ammonium sulfate precipitation, and purifying the antibodies by ProteinA-agarose affinity chromatography.

10. The kit according to claim 7, characterized in that It also includes HRP-streptavidin, a color developing solution, a stop solution, a blocking solution, a washing solution and a standard Syn1-Rep protein; the amino acid sequence of the standard Syn1-Rep protein is shown in SEQ ID NO.2.

Images