ELISA Quantitative Detection Method for Exogenous Syn1-Rep Protein in Plants

The ELISA quantitative detection method, using a biotin-streptavidin sandwich method combining a monoclonal antibody secreted by the CGMCC NO. 46130 hybridoma cell line and a biotin-labeled rabbit polyclonal antibody, solved the problem of the existing technology that was unable to detect the Syn1-Rep protein content in rapeseed transgenic for the Syn1-Rep gene, achieving a highly specific and sensitive detection effect.

CN119643865BActive Publication Date: 2025-09-23OIL CROPS RES INST CHINESE ACAD OF AGRI SCI +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411875571.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-19
Publication Date
2025-09-23
Estimated Expiration
2044-12-19

AI Technical Summary

Technical Problem

Existing technologies are unable to effectively detect the content of Syn1-Rep protein in transgenic rapeseed with the Syn1-Rep gene for herbicide resistance, especially because its amino acid sequence has low homology and cannot be detected using existing PAT protein quantitative detection kits.

Method used

Syn1-Rep protein was quantitatively detected by ELISA, using a monoclonal antibody secreted by the CGMCC NO. 46130 hybridoma cell line combined with a biotin-labeled rabbit polyclonal antibody, and a biotin-streptavidin sandwich method.

Benefits of technology

The specific and sensitive quantitative detection of Syn1-Rep protein was achieved, ensuring the accuracy and sensitivity of the detection, and is suitable for the rapid quantitative analysis of Syn1-Rep protein in genetically modified foods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119643865B_ABST
    Figure CN119643865B_ABST
Patent Text Reader

Abstract

The present invention discloses an ELISA quantitative detection method for exogenous Syn1-Rep protein in plants, relating to the field of plant molecular detection technology. The present invention also provides a hybridoma cell line with a deposit number of CGMCC No. 46130 and a monoclonal antibody prepared therefrom. The present invention employs an ELISA method combining a monoclonal antibody and a polyclonal antibody sandwich, and biotin and streptavidin, to quantitatively detect the herbicide-resistant protein Syn1-Rep. The consumables used are simple and readily available, ensuring reaction specificity while increasing detection sensitivity and possessing universal applicability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant molecular detection, and more particularly to an ELISA quantitative detection method for exogenous Syn1-Rep protein in plants. Background Art

[0002] Rapeseed is a key oilseed crop. Weeds in field production can cause competition for space, nutrients, and water, severely impacting yield and quality. Glufosinate, also known as glufosinate, is a non-selective organophosphorus herbicide that initially damages plant leaves. By inhibiting glutamine synthetase, it disrupts plant nitrogen metabolism, leading to yellowing and necrosis. Genetic engineering can introduce glufosinate-resistance genes into plant genomes, conferring glufosinate-resistance to target plants, effectively distinguishing them from natural weeds and making field spraying of glufosinate an effective weed control method.

[0003] Currently, glufosinate-resistance genes mainly include the BAR gene from the soil bacterium Streptomyces hygroscopicus, the PAT gene from Streptomyces viridans, and the GDHA gene from Escherichia coli and seaweed. The glufosinate-resistance acetyltransferase gene Syn1-Rep, described in this invention, is another new glufosinate-resistance gene cloned by Huazhong Agricultural University from the Rhodococcus sp. strain YM12. Rice transplanted with the Syn1-Rep gene exhibits strong herbicide resistance, tolerating 5000 g / hm2. 2 The Syn1-Rep gene was introduced into a Brassica napus variety, and the exogenous gene was stably inherited in the offspring and maintained the corresponding glufosinate-resistant herbicide characteristics.

[0004] However, with the rapid development of genetically modified crops, concerns have arisen about the potential for unexpected food safety and environmental hazards. Establishing appropriate methods for detecting genetically modified ingredients in genetically modified foods can facilitate the safe management of agricultural genetically modified organisms. Because the protein encoded by the Syn1-Rep gene shares low amino acid sequence homology with other known PAT genes, it cannot be detected using existing PAT protein quantitative detection kits. Therefore, developing a rapid qualitative or quantitative analysis method for Syn1-Rep protein in herbicide-resistant rapeseed transgenic for Syn1-Rep or its derivatives is an urgent need for those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides an ELISA quantitative detection method for exogenous Syn1-Rep protein in plants.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The ELISA quantitative detection method for exogenous Syn1-Rep protein in plants comprises the following steps:

[0008] S1: Dilute the monoclonal antibody to 5 μg / mL as a coating solution (capture antibody) and coat the ELISA plate; the monoclonal antibody is secreted by the hybridoma cell line with the deposit number CGMCC No. 46130;

[0009] S2: discard the coating solution, wash with PBST solution, and add blocking solution to block;

[0010] S3: Discard the blocking solution, wash with PBST solution, and add 100 μL of the protein sample to be tested for incubation;

[0011] S4: Discard the protein sample to be tested, wash with PBST solution, and add a biotinylated detection antibody with a final concentration of 3 μg / mL for incubation; the biotinylated detection antibody is a biotin-labeled rabbit polyclonal antibody obtained by immunizing New Zealand white rabbits with the Syn1-Rep recombinant protein shown in SEQ ID NO.2;

[0012] S5: Discard the biotinylated detection antibody and add 5000-fold diluted HRP-streptavidin for incubation;

[0013] S6: Add a color developer and allow the substrate to develop color in the dark; then add a stop solution to terminate the reaction and measure the OD value at 450 nm; substitute the OD value into the standard curve to calculate the content of Syn1-Rep protein in the protein sample to be tested.

[0014] Preferably,

[0015] Add 100 μL of the coating solution described in S1 to each well and coat at 4°C overnight;

[0016] S2 specifically involves: discarding the coating solution; washing with PBST solution 3-4 times, gently tapping the edge of the plate for 5 seconds and soaking for 30 seconds each time; patting dry the remaining liquid, adding 250 μL of blocking solution to each well, and incubating at 25°C for 1 hour;

[0017] S3 specifically includes discarding the blocking solution; washing with PBST solution 3-4 times; patting dry the residual liquid, adding 100 μL of the protein sample to be tested to each well, and incubating at 25°C for 1 hour;

[0018] S4 specifically includes discarding the protein sample to be tested and washing with PBST solution five times; patting dry the residual liquid, diluting the biotinylated rabbit polyclonal antibody with antibody diluent to a final concentration of 3 μg / mL, adding 100 μL to each well, and incubating at 25°C for 1 h;

[0019] S5 specifically includes discarding the biotinylated detection antibody and washing with PBST solution five times; patting dry the residual liquid, adding 5000-fold diluted HRP-streptavidin, adding 100 μL to each well, and incubating at 25°C for 1 h;

[0020] S6 specifically involves discarding HRP-streptavidin and washing five times with PBST solution; patting dry any remaining liquid, adding TMB color developer (100 μL / well), and reacting at 25°C in the dark for 3-5 minutes; adding 50 μL of 0.5 M sulfuric acid to each well to terminate the reaction, and measuring the OD value at 450 nm; substituting the OD value into the standard curve to calculate the Syn1-Rep protein content in the protein sample to be tested.

[0021] Preferably, the standard curve formula in step S6 is y=0.0312x-0.0337, where x is the concentration of the standard product and y is the OD450 value after color development.

[0022] More preferably, the drawing of the standard curve specifically comprises: using the Syn1-Rep recombinant protein shown in SEQ ID NO.2 as the standard protein, diluting it stepwise to obtain a standard protein solution with a concentration of 64 ng / mL, 32 ng / mL, 16 ng / mL, 8 ng / mL, 4 ng / mL, 2ng / mL, 1 ng / mL, 0.5 ng / mL and 0 ng / mL, incubating with a biotinylated detection antibody and HRP-streptavidin, developing the color and measuring the OD450 value, and drawing the standard curve regression equation.

[0023] Another object of the present invention is to provide a hybridoma cell line, wherein the hybridoma cell line is deposited with CGMCC NO. 46130.

[0024] Another object of the present invention is to provide a monoclonal antibody secreted by the above hybridoma cell line.

[0025] Another object of the present invention is to provide a detection kit comprising a monoclonal antibody secreted by the hybridoma cell line with a deposit number of CGMCC No. 46130, and a biotin-labeled rabbit polyclonal antibody, wherein the rabbit polyclonal antibody is obtained by immunizing New Zealand white rabbits with the Syn1-Rep recombinant protein shown in SEQ ID NO. 2.

[0026] Preferably, the coating concentration of the monoclonal antibody is 5 μg / mL, and the concentration of the biotin-labeled rabbit polyclonal antibody is 3 μg / mL.

[0027] Preferably, the rabbit polyclonal antibody is prepared by immunizing 2-month-old female New Zealand white rabbits with the Syn1-Rep recombinant protein shown in SEQ ID NO.2 as an antigen, collecting venous blood and separating the serum, purifying the antibody by ammonium sulfate precipitation, and purifying the antibody by Protein A-agarose affinity chromatography.

[0028] Preferably, the kit further comprises HRP-streptavidin, a color developing solution, a stop solution, a blocking solution, a washing solution and a standard Syn1-Rep protein;

[0029] The amino acid sequence of the standard Syn1-Rep protein is shown in SEQ ID NO.2.

[0030] Beneficial Effects: The present invention discloses an ELISA method for quantitatively detecting exogenous Syn1-Rep protein in plants. Also provided is a hybridoma cell line with a deposit number of CGMCC No. 46130 and a monoclonal antibody prepared therefrom. This method utilizes a sandwich ELISA method of monoclonal and polyclonal antibodies, combined with biotin and streptavidin, to quantitatively detect the herbicide-resistant protein Syn1-Rep, ensuring reaction specificity while increasing detection sensitivity and possessing universal applicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0032] Figure 1 : SDS-PAGE analysis of the small-scale expression of the pET30a-Syn1-Rep fusion protein in Example 1 of the present invention. Lane M: protein marker; Lane 1: after B induction; Lane 2: before B induction; Lane 3: after R induction; Lane 4: before R induction.

[0033] Figure 2 : SDS-PAGE analysis of the pET30a-Syn1-Rep protein expression in Example 1 of the present invention. Lane M: protein marker; Lane 1: supernatant; Lane 2: precipitate.

[0034] Figure 3: SDS-PAGE analysis of nickel-agarose affinity chromatography purification of the pET30a-Syn1-Rep inclusion body fusion protein in Example 1. Lane M: Protein Marker; Lanes 1-4: 500 mM / 200 mM / 100 mM and 50 mM imidazole eluates; Lane 5: Flow-through.

[0035] Figure 4 : SDS-PAGE identification diagram of the finally purified pET30a-Syn1-Rep protein in Example 1 of the present invention.

[0036] Figure 5 : SDS-PAGE identification diagram of antibody specificity in Example 2 of the present invention.

[0037] Figure 6 : The standard curve drawn among Example 4 of the present invention.

[0038] Figure 7 : The standard curve drawn among Comparative Example 1 of the present invention. DETAILED DESCRIPTION

[0039] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0040] The experimental methods used in the following examples are conventional unless otherwise specified. All experimental materials and reagents, unless otherwise specified, are commercially available. The Syn1-Rep transgenic Brassica napus leaves used are from Chinese invention patent CN 110195067 B.

[0041] 0.25% Coomassie Brilliant Blue staining solution: 100 mL of staining solution contains 0.25 g Coomassie Brilliant Blue R-250, 45 mL of methanol, 10 mL of glacial acetic acid, and 45 mL of ddH2O.

[0042] Destaining solution: Each liter contains 50 mL of ethanol, 100 mL of glacial acetic acid, and 850 mL of ddH2O.

[0043] TBST wash buffer: Each liter contains 100 mL of 1 M Tris-HCl, 88 g of sodium chloride, and 0.1% Tween-20, and is made up to volume with ddH2O.

[0044] PBST washing solution: the solvent is sterile ddH2O, the solute is 0.01 M PBS buffer and Tween-20; the pH value is 7.4; the volume percentage of Tween-20 in the washing solution is 0.05%.

[0045] Example 1 Preparation of antigen

[0046] 1. Small-scale expression of recombinant protein

[0047] 1) Plasmid construction and transformation: Use BamH I and Xho I to insert the target gene into Syn1-Rep The pET-30a-Syn1-Rep vector was ligated into the prokaryotic expression vector pET-30a to obtain the pET-30a-Syn1-Rep vector, which was then transformed into the expression strain BL21 (B).

[0048] Syn1-Rep :atgctttcagagatgctgttcctggtgatcttcctggaatccttgagat ccacaacgaggctattgctaactctactgccatctgggatgagactcctgctgaccttgatgagagaaggagatggttcgatgacaggagagctaacggattccctgtgct cgttgctgatgttgacggagtggttgctggatacgcttcttacggagtgtggagagctaagtcatcttacagacatactgttgagaactctgtttacgtgcatgttgatcat cacaggagaggaattgctactgcactcatgactgagcttatcgagagagctagagctggaggaatccatgtgatcgttgcttctgtggagtctactaacgctacttctgtg gctcttcatgagagattcggattcaggattgttgctcacatgcctgaggtgggaagaaagttcggaagatggcttgatatgacttaccttcagctcactctttagtaa, seq ID NO.1.

[0049] 2) Activation of bacterial strains and induced expression: Positive colonies were picked and activated by overnight culture at 37°C. The activated bacterial strain was expanded into 5 mL at a ratio of 1:50 and cultured at 37°C until OD600 = 0.4-0.6. 0.5 mL of bacterial strain was collected and treated as a pre-induction control. 1.0 mM IPTG was added to the remaining 4.5 mL and expression was induced at 37°C for 3 h. The collected bacterial cells were centrifuged and treated as a post-induction sample. Protein expression was identified by SDS-PAGE. The results are shown in the attached figure. Figure 1 As shown, the target protein was obviously expressed after IPTG induction.

[0050] 2. Large-scale expression and purification of recombinant proteins

[0051] 1) Activation and Expression Induction: Resuscitate pET-30a-Syn1-Rep-positive BL21 (B) strains, expand the culture at a ratio of 1:50 after activation to 800 mL, and culture at 37°C to an OD600 of 0.4-0.6. Add 0.4 mM IPTG and induce expression at 37°C for 5 h. Centrifuge at 8000 rpm at 4°C for 5 min, and harvest the cells.

[0052] 2) Cell lysis: Add 100 mL of disruption solution and perform ultrasonic lysis. Lysis conditions: ice bath temperature, 60% power, 2 seconds of ultrasonication, 2 seconds of interval, and 15 minutes. Subsequently, centrifuge at 12,000 rpm and 4°C for 15 minutes, collect the supernatant and precipitate. Perform SDS-PAGE analysis to determine the expression form of the target protein. The results are shown in the attached figure. Figure 2 As shown, pET-30a-Syn1-Rep (B) is expressed in inclusion bodies.

[0053] 3) Inclusion body protein purification: The inclusion body protein was filtered through a 0.22 μm filter membrane, and the filtrate was collected and added to the equilibrated nickel NTA affinity column at a flow rate of 1 drop / 6 seconds. After washing, the target protein was eluted with 500 mM, 200 mM, 100 mM, and 50 mM imidazole eluents, respectively. The eluate was collected and analyzed by SDS-PAGE. The purification effect after washing and solubilization of the inclusion body is as shown in the attached figure. Figure 3 shown.

[0054] The eluate was collected and the protein product was obtained after dialysis and refolding. The final purified Syn1-Rep recombinant protein was between 25-35 KDa in size. The finished product was identified as shown in the attached Figure 4 The amino acid sequence was analyzed and shown as SEQ ID NO. 2.

[0055] SEQ ID NO. 2.

[0056] Example 2 Preparation of polyclonal antibodies

[0057] 1. Animal immunization

[0058] A two-month-old female New Zealand white rabbit was immunized and rested for one week before immunization. The antigen prepared and quality-controlled in Example 1 was dissolved in sterile PBS (pH 7.2) and injected into the inner thigh for a total of three immunizations, each at a dose of 500 μg per rabbit. The second immunization was performed 20 days after the initial immunization, and the third immunization was performed 20 days after the initial immunization. All subsequent immunizations were emulsified with an equal volume of Freund's complete adjuvant, except for the first immunization, which was emulsified with an equal volume of Freund's incomplete adjuvant. Venous blood was collected 14 days after the third immunization, and antibody titers were determined by ELISA endpoint assay. A fourth immunization was performed 28 days later, via ear vein injection, at a dose of 100 μg per rabbit, resulting in a final antibody titer of 1:81,000.

[0059] 2. Ammonium sulfate precipitation

[0060] Serum collected 14 days after the third immunization was centrifuged at 4000 rpm for 15 minutes at room temperature. The supernatant was slowly added dropwise with saturated ammonium sulfate at 4°C while stirring until half-saturated. Stirring was continued for 30 minutes, and the supernatant was discarded. The precipitate was dissolved in an appropriate amount of PBS buffer (0.01 M, pH 7.4). Saturated ammonium sulfate was slowly added dropwise with stirring at 4°C until the concentration reached 33%. Stirring was continued for 30 minutes, and the supernatant was discarded. The precipitate was dissolved in an appropriate amount of PBS buffer (0.01 M, pH 7.4) and dialyzed overnight at 4°C to collect the polyclonal antibody.

[0061] 3. Antibody Purification

[0062] Purification was performed using a Protein A-agarose affinity chromatography column. First, the polyclonal antibody was passed through the column with 5 mL of ultrapure water. After equilibration with 5 mL of PB buffer (0.4 M, pH 7.0), the column was slowly passed through. Contaminants were washed with 10 mL of PB buffer (0.4 M, pH 7.0). Antibody binding sites were then eluted with 5 mL of glycine-HCl buffer (0.1 M, pH 2.7). Tris-HCl (1 M, pH 8.0) was then added to neutralize the glycine, maintaining a neutral pH suitable for storage. Finally, the antibody was dialyzed into PBS buffer. The antibody concentration was 5 mg / mL as determined by the BCA assay.

[0063] Example 3 Preparation of monoclonal antibodies

[0064] 1. Animal immunization

[0065] Four 6-week-old female BALB / c mice were selected for immunization. The Syn1-Rep recombinant protein prepared and quality-controlled in Example 1 was used as an antigen, and the BALB / c mice were immunized three times by subcutaneous multi-point injection, with each immunization dose of 25 μg / mouse. The first immunization was emulsified with an equal amount of Freund's complete adjuvant, and the second immunization was performed 28 days after the interval. The third immunization was performed by intraperitoneal injection 14 days after the interval, and both were emulsified with an equal amount of Freund's incomplete adjuvant. Blood was collected from the tail vein 10 days after the second immunization, and the antibody titer was measured by an indirect method. Mice with higher antibody titers were selected for cell fusion.

[0066] 2. Establishment of Hybridoma Cell Lines

[0067] 1) Cell Fusion: Thaw myeloma cells and place in a 37°C CO2 incubator until ready for use. Select the immunized mouse with the highest titer, enucleate the eyeball, and collect blood. The serum is isolated and used as a positive control serum for testing. Immunized mice are killed by cervical dislocation, and the spleen is removed. Connective tissue is removed, and a splenocyte suspension is prepared. The resulting splenocytes are fused with myeloma cells using polyethylene glycol (PEG) as a fusion agent. After centrifugation, the supernatant is discarded and the suspension is vibrated in HAT selective medium to create a single-cell suspension. The suspension is then plated into 96-well cell culture plates for screening.

[0068] 2) Screening of Positive Hybridoma Cells: Seven days after cell fusion, visible colonies will appear at the bottom of the culture plate wells. Initial screening is performed using indirect ELISA. Strongly positive wells are recorded and promptly expanded and cloned in 24-well plates. Secondary screening is performed using limiting dilution, where the cell suspension is serially diluted until each well of a 96-well plate contains only a single cell. After several rounds of cloning, if all cloned wells demonstrate a 100% positive rate, it is confirmed that a hybridoma cell line secreting monoclonal antibodies has been obtained. After expansion, ascites fluid is prepared.

[0069] 3. Preparation and Purification of Monoclonal Antibodies

[0070] 1) Ascites preparation: 6-week-old healthy female mice were sensitized by intraperitoneal injection of 0.5 mL of liquid paraffin. One week later, 1×10 6 -2×10 6 Syn1-Rep monoclonal antibody hybridoma cells were expressed, and the condition of the mice was observed. After 7-10 days, when the abdominal cavity of the mice was obviously swollen, the ascites was collected.

[0071] 2) Antibody purification: The collected ascites was precipitated with ammonium sulfate and then purified using a Protein G-agarose affinity chromatography column. The specific steps were performed according to Example 2. A total of 10 positive monoclonal hybridoma cell lines were screened and established.

[0072] The double antibody sandwich ELISA method was used to screen monoclonal antibodies that could be paired with the rabbit polyclonal antibody in Example 2. The pairing results are shown in Table 1, where # indicates that the OD450 value exceeds the upper limit of detection of the microplate reader.

[0073] Table 1 ELISA pairing analysis of monoclonal antibodies and polyclonal antibodies

[0074]

[0075] The results showed that only the monoclonal antibody secreted by No. 5 could detect transgenic samples when paired with the rabbit polyclonal antibody (i.e., Example 2); the other antibodies failed to detect positive samples. Monoclonal antibody No. 5 was identified as an IgG2a subtype with a Kappa light chain. The concentration was 2.5 mg / mL, and the optimal titer was 729K. The rabbit polyclonal antibody used in this example was tested at a concentration of 5 mg / mL, with an optimal titer of 729K.

[0076] 4. Specificity Identification of Syn1-Rep Monoclonal Antibodies

[0077] Syn1-Rep mouse monoclonal antibody was detected using an overexpression system. Syn1-Rep transgenic rapeseed leaf protein and prokaryotic expressed Syn1-Rep recombinant protein were detected by Western Blot. The specific steps are as follows:

[0078] 1) Extraction of total protein from rapeseed leaves: Place leaf material (wild-type control and Syn1-Rep transgenic rapeseed) in a 2 mL centrifuge tube, grind into powder with liquid nitrogen, add 700 μL of plant total protein extract, shake and mix thoroughly, and incubate at 4°C for 20 min. Subsequently, centrifuge at 12,000 rpm for 10 min at 4°C. Aspirate the supernatant, aliquot, and store in a -80°C freezer.

[0079] 2) Protein denaturation: Mix the sample protein and protein loading buffer (5×) in a 4:1 volume ratio and denature in a 100°C metal bath for 10 min.

[0080] 3) Western Blot: Transfer proteins separated by PAGE gel electrophoresis to a PVDF membrane, incubate with blocking buffer for 1 hour, then add the primary antibody and incubate overnight at 4°C on a shaker. The next day, wash the membrane six times with TBST (5 minutes each), incubate with the secondary antibody for 1 hour, and then wash the membrane six times with TBST (5 minutes each). Finally, add ECL chemiluminescent substrate and visualize the results using a Bio-Rad developer. The PAGE gel preparation kit used in this example has an upper gel concentration of 4.5% and a lower gel concentration of 12.5%. The primary antibody used is the ascites-derived Syn1-Rep mouse monoclonal antibody (secreted by monoclonal hybridoma cell line No. 5), and the secondary antibody is HRP-conjugated goat anti-mouse IgG.

[0081] The experimental results are as follows Figure 5 As shown, the target protein Syn1-Rep was detected at around 15 kDa in all Syn1-Rep transgenic rapeseed leaf protein samples, indicating that the monoclonal antibody prepared in this example can specifically immunorecognize the Syn1-Rep protein.

[0082] Biological Deposits

[0083] The obtained number 5 Syn1-Rep mouse monoclonal antibody hybridoma cell line was named Syn1-Rep-10 and deposited in the General Microbiology Center of China Culture Collection of Microorganisms on November 7, 2024, with the deposit number CGMCC NO.46130. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0084] Example 4 Establishment of a biotin-streptavidin double antibody sandwich ELISA detection system

[0085] 1. Concentration selection range for the standard curve

[0086] The concentration range of the standard curve is particularly important to ensure the accuracy of the experimental results. Selecting an appropriate concentration range is conducive to the establishment of the standard curve and ultimately accurately calculating the sample concentration based on the standard curve. 2 It should be greater than 0.99, and the OD450 value of each scattered point should be between 2-0.08 to avoid exceeding the optimal reading range of the instrument.

[0087] 2. Drawing of the standard curve

[0088] 1) Antibody Coating: The monoclonal antibody purified in Example 3 was used as the capture antibody (secreted by monoclonal hybridoma cell line No. 5), diluted to 5 μg / mL and coated on an ELISA plate. 100 μL was added to each well and incubated at 4°C overnight to allow the capture antibody to adsorb to the surface of the ELISA plate.

[0089] 2) Blocking: Discard the liquid in the ELISA plate and add 250 μL of PBST to each well. Wash 3-4 times, gently tapping the edge of the plate for 5 seconds and soaking for 30 seconds each time. After washing, pat dry any remaining liquid on absorbent paper. Add 250 μL of commercial blocking solution (E-ELIR-003) to each well and incubate at 25°C for 1 hour.

[0090] 3) Standard Incubation: Wash the plate 3-4 times with PBST and pat dry any remaining liquid. Dilute the Syn1-Rep recombinant protein prepared in Example 1 to 10 μg / mL as a standard protein. Further serially dilute to obtain standard protein solutions with concentrations of 64 ng / mL, 32 ng / mL, 16 ng / mL, 8 ng / mL, 4 ng / mL, 2 ng / mL, 1 ng / mL, 0.5 ng / mL, and 0 ng / mL. Add 100 μL to each well and incubate at 25°C for 1 hour.

[0091] 4) Incubation with Biotinylated Detection Antibody: Wash the plate five times with PBST and pat dry. Dilute the biotinylated detection antibody to a final concentration of 3 μg / mL in Antibody Diluent. Add 100 μL to each well and incubate at 25°C for 1 hour. The detection antibody in this example is a biotinylated rabbit polyclonal antibody [labeled with a commercial biotin labeling kit (E-LK-B002A) containing a primary amino group (-NH2) molecule. The specific steps include concentration and exchange of buffer, recovery and quantification, labeling reaction, blocking and termination, ultrafiltration purification, and product collection, resulting in a final detection antibody concentration of 8 mg / mL].

[0092] 5) HRP-streptavidin incubation: Wash the plate five times with PBST and pat dry. Dilute HRP-streptavidin 5000-fold, add 100 μL to each well, and incubate at 25°C for 1 h.

[0093] 6) Substrate color development: Wash the plate five times with PBST and pat dry any remaining liquid. Add 100 μL of color development reagent to each well and incubate at 25°C in the dark for 3-5 minutes. Then, add 50 μL of stop solution and measure the OD450 of the resulting solution using a TECAN microplate reader. In this example, the color development reagent is TMB substrate solution, and the stop solution is 0.5 M sulfuric acid.

[0094] Experimental results: The final standard curve is as shown in the attached Figure 6 .

[0095] Reference formula: y=0.0312x-0.0337, where x is the concentration of the standard, the detection sensitivity can reach 1 ng / mL, and y is the OD450 value after color development.

[0096] Example 5 ELISA quantitative detection method for exogenous Syn1-Rep protein in rapeseed

[0097] 1) Extraction of total protein from rapeseed leaves: Grind approximately 0.1 g of fresh leaf material (wild-type control and Syn1-Rep transgenic rapeseed) into a powder with liquid nitrogen. Add 500 μL of plant total protein extract, shake well, and incubate at 4°C for 20 min. Centrifuge at 12,000 rpm for 10 min at 4°C. Aspirate the supernatant and store in a -80°C refrigerator.

[0098] 2) Determination of exogenous Syn1-Rep protein content by biotin-streptavidin sandwich ELISA: Following the steps of Example 4, capture antibody coating, blocking, sample incubation, biotinylated detection antibody incubation, HRP-streptavidin incubation, and color development were performed. The samples in this example were 20-fold diluted rapeseed leaf and bud tissue proteins. The measured OD450 values ​​were substituted into the standard curve regression equation y = 0.0312x - 0.0337 to calculate the exogenous Syn1-Rep protein content in the test samples, as shown in Table 2.

[0099] Table 2 Exogenous Syn1-Rep protein content in transgenic rapeseed

[0100]

[0101] Comparative Example 1 Different double antibody sandwich ELISA detection methods

[0102] Rabbit polyclonal antibody-HRP labeled secondary antibody double antibody sandwich ELISA detection

[0103] 1) Antibody coating: The purified No. 5 Syn1-Rep monoclonal antibody in Example 3 was used as the capture antibody and diluted to 5 μg / mL to coat the ELISA plate, with 100 μL per well.

[0104] 2) Standard Incubation: Wash the plate 4-5 times and pat dry. Dilute the Syn1-Rep recombinant protein prepared in Example 1 to 32 ng / mL, 16 ng / mL, 8 ng / mL, 4 ng / mL, 2 ng / mL, 1 ng / mL, 0.5 ng / mL, and 0 ng / mL as a standard protein solution. Add 100 μL to each well and incubate at 25°C for 1 hour. Gently vortex and mix thoroughly. Incubate at 25°C for 45 minutes.

[0105] 3) Rabbit polyclonal antibody incubation: Wash the plate five times and pat dry. Add 100 μL of rabbit polyclonal antibody to each well and incubate at 25°C for 30 min.

[0106] 4) Enzyme-labeled antibody incubation: Wash the plate five times and pat dry. Add 100 μL of HRP-labeled secondary antibody to each well and incubate at 25°C for 30 min.

[0107] 5) Substrate color development: Wash the plate five times and pat dry any remaining liquid. Add 100 μL of color development reagent to each well and incubate at 25°C in the dark for 15 min. Then, add 100 μL of stop solution and measure the OD450 of each well using a microplate reader. In this comparative example, the color development reagent is TMB substrate solution. Substituting the measured OD450 value into the standard curve regression equation, the exogenous Syn1-Rep protein content in the sample can be calculated.

[0108] Experimental results: The final standard curve is as shown in the attached Figure 7 .

[0109] Reference formula: y=0.0381x+0.1089, where x is the concentration of the standard, the detection sensitivity can reach 2 ng / mL, and y is the OD450 value after color development.

[0110] The capture antibody in this comparative example is No. 5 Syn1-Rep mouse monoclonal antibody. The sensitivity of the double antibody sandwich detection method of mouse monoclonal antibody-rabbit polyclonal antibody-enzyme-labeled secondary antibody is compared with that of the double antibody sandwich detection method of mouse monoclonal antibody-biotinylated rabbit polyclonal antibody-HRP-labeled streptavidin. After the detection antibody Syn1-Rep rabbit polyclonal antibody is biotinylated, the standard curve R 2 The value increased from 0.9601 to 0.9991, and the detection sensitivity increased from 2 ng / mL to 1 ng / mL, achieving signal amplification. A series of optimizations were performed on the double-antibody sandwich ELISA detection system, including extending the sample and antibody incubation time to 1 hour, adding a 5-second plate shaker before the 30-second soaking step during washing to reduce reagent carryover, and reducing the substrate color development reaction time from 15 minutes to 5 minutes, effectively reducing the probability of nonspecific binding.

[0111] Comprehensive antibody titer, feasibility of paired detection with multiple antibodies, positive detection rate, detection sensitivity and standard curve R 2 Based on the factors such as the specificity and sensitivity of the sample protein Syn1-Rep, the Syn1-Rep mouse monoclonal antibody No. 5 was selected as the capture antibody and paired with the biotinylated rabbit polyclonal antibody. The biotinylated rabbit polyclonal antibody was combined with HRP-streptavidin to amplify the detection signal to establish the Syn1-Rep protein double antibody sandwich ELISA detection system, which effectively increased the specificity and sensitivity of the sample protein Syn1-Rep detection.

[0112] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0113] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. An ELISA quantitative detection method for exogenous Syn1-Rep protein in plants, characterized in that: The following steps are involved: S1: Dilute the monoclonal antibody to 5 μg / mL as a coating solution and coat the ELISA plate; the monoclonal antibody is secreted by the hybridoma cell line with the deposit number CGMCC No. 46130; S2: discard the coating solution, wash with PBST solution, and add blocking solution to block; S3: Discard the blocking solution, wash with PBST solution, and add 100 μL of the protein sample to be tested for incubation; S4: Discard the protein sample to be tested, wash with PBST solution, and add a biotinylated detection antibody with a final concentration of 3 μg / mL for incubation; the biotinylated detection antibody is a biotin-labeled rabbit polyclonal antibody obtained by immunizing New Zealand white rabbits with the Syn1-Rep recombinant protein shown in SEQ ID NO.2; S5: Discard the biotinylated detection antibody and add 5000-fold diluted HRP-streptavidin for incubation; S6: Add a color developer and allow the substrate to develop color in the dark; then add a stop solution to terminate the reaction and measure the OD value at 450 nm; substitute the OD value into the standard curve to calculate the content of Syn1-Rep protein in the protein sample to be tested.

2. The ELISA quantitative detection method for exogenous Syn1-Rep protein in plants according to claim 1, characterized in that: Add 100 μL of the coating solution described in S1 to each well and coat at 4°C overnight; S2 specifically involves: discarding the coating solution; washing with PBST solution 3-4 times, gently tapping the edge of the plate for 5 seconds and soaking for 30 seconds each time; patting dry the remaining liquid, adding 250 μL of blocking solution to each well, and incubating at 25°C for 1 hour; S3 specifically includes discarding the blocking solution; washing with PBST solution 3-4 times; patting dry the residual liquid, adding 100 μL of the protein sample to be tested to each well, and incubating at 25°C for 1 hour; S4 specifically includes discarding the protein sample to be tested and washing with PBST solution 5 times; Pat dry the remaining liquid, dilute the biotinylated rabbit polyclonal antibody with antibody diluent to a final concentration of 3 μg / mL, add 100 μL to each well, and incubate at 25°C for 1 h; S5 specifically includes discarding the biotinylated detection antibody and washing with PBST solution five times; patting dry the residual liquid, adding 5000-fold diluted HRP-streptavidin, adding 100 μL to each well, and incubating at 25°C for 1 h; S6 specifically involves discarding HRP-streptavidin and washing five times with PBST solution; patting dry any remaining liquid, adding TMB color developer (100 μL / well), and reacting at 25°C in the dark for 3-5 minutes; adding 50 μL of 0.5 M sulfuric acid to each well to terminate the reaction, and measuring the OD value at 450 nm; substituting the OD value into the standard curve to calculate the Syn1-Rep protein content in the protein sample to be tested.

3. The ELISA quantitative detection method for exogenous Syn1-Rep protein in plants according to claim 1, characterized in that: The standard curve formula in step S6 is y=0.0312x-0.0337, where x is the concentration of the standard product and y is the OD450 value after color development.

4. The ELISA quantitative detection method for exogenous Syn1-Rep protein in plants according to claim 3, characterized in that: The drawing of the standard curve specifically includes: using the Syn1-Rep recombinant protein shown in SEQ ID NO.2 as the standard protein, diluting the solution stepwise to obtain standard protein solutions with concentrations of 64 ng / mL, 32 ng / mL, 16 ng / mL, 8 ng / mL, 4 ng / mL, 2 ng / mL, 1 ng / mL, 0.5 ng / mL and 0 ng / mL, incubating with a biotinylated detection antibody and HRP-streptavidin, developing the color and measuring the OD450 value, and drawing the standard curve regression equation.

5. A hybridoma cell line, characterized in that: The deposit number is CGMCC NO. 46130.

6. A monoclonal antibody, characterized in that Obtained by secretion from the hybridoma cell line according to claim 5.

7. A detection kit, characterized in that The invention comprises a monoclonal antibody secreted by a hybridoma cell line with a deposit number of CGMCC NO. 46130, and a biotin-labeled rabbit polyclonal antibody, wherein the rabbit polyclonal antibody is obtained by immunizing New Zealand white rabbits with the Syn1-Rep recombinant protein shown in SEQ ID NO.

2.

8. The kit according to claim 7, characterized in that The coating concentration of the monoclonal antibody was 5 μg / mL, and the concentration of the biotin-labeled rabbit polyclonal antibody was 3 μg / mL.

9. The kit according to claim 7, characterized in that The rabbit polyclonal antibody is prepared by immunizing 2-month-old female New Zealand white rabbits with the Syn1-Rep recombinant protein shown in SEQ ID NO.2 as an antigen, collecting venous blood and separating the serum, purifying the antibody by ammonium sulfate precipitation, and then purifying the antibody by Protein A-agarose affinity chromatography.

10. The kit according to claim 7, characterized in that It also includes HRP-streptavidin, color development solution, stop solution, blocking solution, washing solution and standard Syn1-Rep protein; The amino acid sequence of the standard Syn1-Rep protein is shown in SEQ ID NO.2.

Citation Information

Patent Citations

  • A method for cultivating glufosinate-resistant rapeseed

    CN110195067B

  • Method for cultivating glufosinate ammonium-resistant rapeseed

    CN110195067A

  • ELISA quantitative detection method for exogenous EPSPS protein in plant

    CN113109562A