Preparation of obligate parthenogenesis rotifer based on gene editing

Abstract

The invention belongs to the technical field of biology, and particularly relates to a method for cultivating obligate parthenogenesis rotifers based on a gene editing technology and application of the method in preparation of novel aquatic breeding initial feed. The application is obtained by combining brand new rotifer microinjection with gene knockout rotifer mutant screening, and a new obligate parthenogenesis rotifer variety prepared by the application can be used as a novel living body bait for aquaculture and seedling raising.

Description

Technical Field

[0001] The present application belongs to the field of biotechnology, and specifically relates to a method for cultivating obligate parthenogenetic rotifers based on gene editing technology and its application in the preparation of novel aquatic seedling starter bait. Technical Background

[0002] Rotifers are small zooplankton with rich nutritional value. They are the main live bait for the larval stage of aquatic animals such as fish, shrimps, and crabs in aquaculture. There are two ways of reproduction for rotifers: parthenogenesis and sexual reproduction. Parthenogenetic female rotifers have a high reproduction rate and can produce 25 to 30 offspring continuously within a week. When the population density increases (for example, 1 / mL), some female rotifers will reproduce sexually, produce 12 to 15 offspring, and sink to the bottom of the water in the form of dormant eggs, and develop into female rotifers when environmental conditions are suitable. From the perspective of cultivating live bait, the sexual reproduction process slows down the population growth rate and reduces energy utilization, so it should be avoided.

[0003] Meiosis is a key process for gamete formation in sexual reproduction, and homologous recombination is a core event of meiosis. The DNA mismatch repair protein MLH3 (MutL homolog 3) plays a key role in the disassembly of double Holliday junctions during the first prophase of meiosis. Knocking out the mlh3 gene leads to a significant decrease in the frequency of bivalents, disrupting the gamete formation process, thereby inhibiting sexual reproduction, which is conducive to the cultivation of new species of obligate parthenogenetic rotifers.

[0004] In rotifers, artificial gene silencing technology is still in the exploratory stage. Using transfection reagents, liposomes or electroporation, exogenous dsRNA or plasmid DNA can be delivered to the rotifer pseudocoelom to achieve a certain degree of gene expression knockdown. However, these technologies cannot penetrate germ cells, and the gene knockdown effects caused by them cannot be passed on. If microinjection technology can be used to inject CRISPR reagents directly into the ovaries of rotifer larvae, targeted gene editing can be achieved in germ cells to create a stably inherited transgenic line. However, for rotifer larvae, their body size is very small, only 1 / 2 to 2 / 3 of that of adults, and the cuticle on the surface of the body (i.e., the locules) also has a certain hardness. These characteristics make the injection of rotifer larvae ovaries extremely difficult, and there is no precedent in the prior art.

[0005] In view of this, this application is filed. Summary of the invention

[0006] In order to solve the above technical problems, this application successfully bred a new variety of rotifers with obligate parthenogenetic characteristics through precise and efficient CRISPR gene editing, combined with specific rotifer microinjection equipment and injection methods. Specifically, it includes: using a specific rotifer microinjection device (including a rotifer larvae clamping straw, a flat dish with a side cut, and an injection needle with an opening of about 2 to 3 μm), injecting Cas9 and mlh3-specific gRNA into the immature ovaries of the larvae, and completing the gene knockout during the maternal oogenesis process. The first generation (F1) single individuals are selected for culture to form a clonal population, and then the second generation (F2) is selected for high-resolution melting curve analysis and sequencing to identify the genotype of the clonal population. The obtained mlh3 gene function loss mutant is a new variety of obligate parthenogenetic rotifers, which can be used as a new type of live bait for aquaculture seedlings.

[0007] Specifically, this application proposes the following technical solutions:

[0008] The present application first provides a method for cultivating obligate parthenogenetic rotifers, comprising the following steps:

[0009] 1) Rotifer culture: Take Brachionus plicatilis rotifer and place it in culture medium for several days;

[0010] 2) Obtaining rotifer larvae: Pipette the rotifer culture solution into the cell culture plate, and repeatedly blow and suck to separate the eggs attached to the back of the rotifer body from the mother body. After culturing the eggs until the next day, obtain the rotifer larvae;

[0011] 3) Microinjection: Place the larvae in a zooplankton resting solution (such as ProtosloQuieting solution) diluted with seawater to slow down their movement; then transfer the larvae to the microinjection device and perform microinjection;

[0012] 4) Genotype identification of offspring: transfer the injected rotifers to a cell culture plate containing culture medium, culture and produce the first generation F1, pick out the F1 individual for culture, and form multiple clones; pick out a single second generation F2 from the multiple clones, extract genomic DNA for PCR (such as high-resolution melting curve) analysis, and evaluate the gene knockout population; then sequence the PCR product to identify the genotype of the clone population;

[0013] 5) The genotype of the clone population was selected as the homozygous mutant of mlh3 gene function loss (mlh3 - / - ) were cultured at high density to obtain a clonal population of rotifers that only reproduced parthenogenetically without any males.

[0014] Furthermore, in step 1), the culture solution is prepared by adding f / 2 culture medium to seawater filtered through a 0.22 μm filter membrane and having a salinity of 15 to 17 ppt, and then adding Tetraselmis so that the final concentration is 2×10 5 ~6x105 cells / mL.

[0015] Furthermore, the step 1) specifically includes: taking a small amount of Brachionus plicatilis rotifer and placing it in the culture solution, and culturing it continuously for several days in an environment of 21-23° C. and a photoperiod of 12 / 12h until the rotifer density reaches 30-50 / mL.

[0016] Furthermore, the step 2) specifically includes: aspirating 3-5 mL of rotifer culture solution into a multi-well cell culture plate, repeatedly blowing and sucking with a pipette to separate the eggs attached to the rear side of the rotifer body from the mother body; then removing the adult rotifer, and culturing the eggs until the next day to obtain rotifer larvae.

[0017] Furthermore, in the step 3), the microinjection includes: connecting the microinjection device to a pneumatic microinjector and loading the injection needle with CRISPR reagent; placing the rotifer larvae in a flat dish filled with seawater, applying a negative pressure of -3 to -5 hPa to the rotifer larvae holding the straw, and adsorbing the rotifer ciliary crown; the injection needle is at an angle of 20 to 30 degrees to the horizontal plane, and penetrates the cuticle into the ovary; the injection pressure is 400 to 900 hPa, and the duration is 1 to 2 s.

[0018] Furthermore, the microinjection device includes a rotifer larvae clamping straw, a flat dish with a side cut and an injection needle with an opening of about 2 to 3 μm; the rotifer larvae clamping straw is drawn from a glass capillary with an outer diameter of no more than 1 mm, the end opening is flame polished, the outer diameter is 200 to 250 μm, the inner diameter is 100 to 150 μm, and the angle of 13 to 18 degrees is bent 5 to 10 mm away from the opening; the diameter of the flat dish is 50 to 60 mm, and the depth of the cut on one side edge is 2 to 3 mm to accommodate the clamping straw; the injection needle is drawn from a quartz capillary with an outer diameter of no more than 1 mm, the needle tip opening diameter is 2 to 3 μm, and the needle tip grinding angle is 20 to 30°.

[0019] Furthermore, the CRISPR reagent includes: Cas9 nuclease, mlh3-specific gRNA, tetramethylrhodamine-dextran and NEBuffer TM r3.1 Reaction buffer.

[0020] Furthermore, the mlh3-specific gRNA sequence is as follows: GCCGAUUCAAUCAGACCGAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO. 1).

[0021] The present application also provides a novel aquatic seedling starter bait, which is prepared by any of the above-mentioned methods.

[0022] The present application also provides the use of any of the above methods in the preparation of novel aquatic seedling starter bait.

[0023] Furthermore, the application includes the steps of any of the aforementioned methods.

[0024] Beneficial technical effects of this application:

[0025] The present application adopts a specific rotifer microinjection method combined with gene knockout rotifer mutant screening to obtain a new species of obligate parthenogenetic rotifer, which can be used as a new type of live bait for aquaculture seedlings. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 , schematic diagram of the rotifer microinjection device, in which the rotifer holding straw is 6 to 7 cm long, placed at ~15° to the horizontal plane, and the end of the straw is in contact with the bottom of the dish; the injection needle is 6 to 7 cm long, placed at ~20° to the horizontal plane, and the needle tip is 50 to 100 μm away from the bottom of the dish.

[0027] Figure 2 , rotifer microinjection diagram, among which Figure A is a rotifer larvae holding pipette connected to the microinjector; Figure B is a microinjection operation diagram: the holding pipette adsorbs the larvae ciliary crown, and the injection needle pierces the epidermal cuticle at 20°~30° from the back and pierces the ovary.

[0028] Figure 3 , High-resolution melting curves of mlh3 mutants of different genotypes. Compared with wild-type WT, mlh3 knockout homozygous mlh3 - / - The Tm value of mlh3 knockout heterozygous mlh3 + / - There are two peaks.

[0029] Figure 4 , CRISPR-mediated mlh3 gene knockout sequence information diagram; wherein, the shadow indicates the gRNA targeting sequence, the underline indicates PAM, > indicates base substitution, - indicates deletion, and the number of deleted nucleotides is indicated on the right side of the sequence. DETAILED DESCRIPTION

[0030] The embodiments of the present application will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present application and should not be considered as limiting the scope of the present application. In the examples, if no specific conditions are specified, the conditions are carried out according to normal conditions or manufacturer recommendations. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased from the market.

[0031] Partial term definition, unless otherwise defined below, the meaning of all technical terms and scientific terms used in the specific embodiments of the present application is intended to be the same as that commonly understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain the present application.

[0032] The term "approximately" in this application indicates an accuracy range that can be understood by those skilled in the art and still ensures the technical effect of the characteristic in question. The term generally indicates ±10%, preferably ±5%, of the indicated value.

[0033] As used in this application, the terms "comprises", "comprising", "having", "containing" or "involving" are inclusive or open-ended and do not exclude other unrecited elements or method steps. The term "consisting of" is considered a preferred embodiment of the term "comprising". If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists of only these embodiments.

[0034] In addition, the terms first, second, third, (a), (b), (c), and the like in the specification and claims are used to distinguish similar elements and are not necessarily required to describe a sequential or chronological order. It should be understood that the terms so used are interchangeable under appropriate circumstances, and the embodiments described in this application can be implemented in other sequences than those described or illustrated in this application.

[0035] The present application is described below in conjunction with specific embodiments.

[0036] Example 1. Establishment of gene knockout strategy and gRNA sequence optimization

[0037] Given that the target gene mlh3 plays a key role in disassembling double Holliday junctions during the prophase of meiosis, mlh3 gene knockout rotifers may inhibit sexual reproduction and thus be exclusively parthenogenetic. Therefore, the applicant attempted to establish a mlh3 gene knockout system based on CRISPR / Cas9 to achieve the cultivation of obligate parthenogenetic rotifers.

[0038] The specific experimental method steps and optimization process are as follows:

[0039] The CRISPR reagent designed in this application includes 600ng / μl Cas9 nuclease and 300ng / μl mlh3-specific gRNA (the molar ratio of the two is 1:3). In order to screen for highly efficient gRNA, the applicant designed three groups of gRNAs, targeting different target regions on the mlh3 gene exon: CCGATTCAATCAGACCGAGT, ATCCGAGGCTCTATGCACAG and CGACAATGGAAGAGGGATCG, and correspondingly designed three gRNA sequences, respectively:

[0040] gRNA-1:

[0041] GCCGAUUCAAUCAGACCGAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO. 1);

[0042] gRNA-2:

[0043] GAUCCGAGGCUCUAUGCACAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO. 2);

[0044] gRNA-3:

[0045] GCGACAAUGGAAGAGGGAUCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGUCGGGUGCUUUU (SEQ ID NO. 3).

[0046] Through experimental testing, the proportion of each genotype in the F2 generation is as follows:

[0047]

[0048] It can be seen that mlh3 obtained after gRNA-1 gene editing - / - The proportion of homozygous mutants was the highest, significantly better than gRNA-2 and gRNA-3 groups, and no chimeras were produced, with the highest gene editing efficiency. In summary, this application established gRNA-1 as a specific gRNA for mlh3 in subsequent studies.

[0049] Example 2. Preparation of microinjection device and optimization of injection steps

[0050] The larvae of rotifers are very small, only 1 / 2 to 2 / 3 of the size of adults, and the cuticle on their surface (i.e., the larvae) has a certain hardness. These characteristics make ovarian injection extremely difficult, and an effective microinjection method needs to be established to successfully deliver CRISPR reagents to immature ovaries.

[0051] 1. Preparation of the Microinjection Apparatus

[0052] The applicant has designed a specific microinjection device, which specifically includes a rotifer suction component, a holding component and an injection component (see Figure 1 and 2 ), the corresponding preparation method is as follows:

[0053] The applicant uses a clamping straw as a rotifer larvae suction component. The inner diameter of the opening at the end of the clamping straw is 100 to 150 μm, which can just accommodate the larval ciliary crown. The holding component selects a flat dish with a diameter of 50 to 60 mm, and the incision depth of one side edge is 2 to 3 mm to accommodate the clamping straw. The injection component uses a specific injection needle, which is drawn by a quartz capillary with an outer diameter of 1 mm (QF100-70-10, SUTTER INSTRUMENT) on a SUTTER P-2000 needle puller (drawing parameters: heat800, filament 4, velocity 60, delay 150, pull 175). The needle is polished on a SUTTER BV-10 needle grinder at an angle of 20 to 30° for 15 seconds, and the caliber of the needle tip opening is 2 to 3 μm. This injection needle is very sharp and can pierce the cuticle of the body surface and penetrate the ovary.

[0054] The above parameters are summarized and obtained by the applicant in the process of exploring the experimental conditions for rotifer injection. For example, the grinding angle of the injection needle and the size of the needle tip opening are particularly important for the injection success rate, which directly determines the effect of ovarian puncture and the degree of damage to the animal. The injection effects of different grinding angles are shown in the following table:

[0055]

[0056] 2. Exploration and optimization of microinjection methods

[0057] The applicant used the microinjection device prepared above to conduct in-depth exploration and optimization research on the operation steps of microinjection of rotifer larvae. The specific process is shown in the following table:

[0058]

[0059]

[0060] In comparison, based on the above-mentioned device, the following means are used for rotifer larvae microinjection with the best effect: applying a negative pressure of -3 to -5 hPa to the rotifer larvae holding straw can stably hold the rotifer; the injection needle is at an angle of 20 to 30 degrees to the horizontal plane, piercing the cuticle into the ovary; applying a positive pressure of 400 to 900 hPa to the injection needle for 1 to 2 seconds, and injecting a volume of 30 to 50 pL can fill the entire ovary.

[0061] Example 3: Cultivation and evaluation of obligate parthenogenetic rotifers

[0062] This example uses the gene knockout system established in the above-mentioned Example 1, combined with the microinjection device and means of Example 2, to evaluate the effectiveness and technical advantages of the method system of the present application. The specific experimental steps and evaluation steps are as follows:

[0063] 1) Rotifer culture: A small amount of Brachionus manjavacas was placed in 100 mL of culture medium, and cultured continuously for several days at 21-23°C and a photoperiod of 12 / 12h until the rotifer density reached 30-50 / mL; the culture medium was prepared by adding f / 2 culture medium to seawater filtered through a 0.22 μm filter membrane and having a salinity of 15-17 ppt, and then adding Tetraselmis so that the final concentration was 2×10 5 ~6x10 5 cells / mL.

[0064] 2) Obtaining rotifer larvae: Pipette 3-5 mL of rotifer culture medium into a multi-well cell culture plate and repeatedly blow and suck with a pipette to separate the eggs attached to the back of the rotifer body from the mother body; then remove the adult rotifers and culture the eggs until the next day to obtain rotifer larvae.

[0065] 3) Microinjection: Place the rotifer larvae in a zooplankton resting solution (such as ProtosloQuieting solution: https: / / www.carolina.com / protist-viewing-supplies / protoslo-quieting-solution-laboratory-grade-15-ml / 885141.pr) diluted 3 times with seawater for 3 to 5 minutes to slow down their movement; then transfer the larvae to the microinjection device prepared in Example 2, and perform microinjection of the CRISPR reagent prepared in Example 1 on an inverted microscope (total magnification 100x). Specifically: connect the microinjection device to the pneumatic microinjector, load the injection needle with 2μl CRISPR reagent; place the rotifer larvae in a dish filled with seawater, apply -3hPa negative pressure to the rotifer larvae holding straw, and adsorb the rotifer ciliary crown; the injection needle is at an angle of 20 degrees to the horizontal plane, penetrates the cuticle and pierces the ovary; the injection pressure is 500hPa, the duration is 2s, and the injection volume is 50pL. A total of 26 rotifer larvae were injected using the above method.

[0066] 4) Genotype identification of offspring: transfer the injected rotifers to a cell culture plate containing culture medium; the next day, 16 rotifers survived (survival rate ~60%) and were cultured separately. Each female rotifer produced 2 offspring per day. The first 6 offspring F1 were selected for individual culture to form polyclones; a single second-generation F2 was selected from the polyclones, and genomic DNA was crudely extracted by proteinase K method for high-resolution melting curve analysis to evaluate the gene knockout population (see Figure 3 ); then sequence the PCR products to identify the genotype of the clone population.

[0067] The mutations identified included base substitutions and nucleotide deletions, including genotypes with deletions of 2 bp, 5 bp, 7 bp, and 10 bp in the targeted region (mlh3 -2 / -2 、mlh3 -5 / -5 、mlh3 -7 / -7 、mlh3 -10 / -10 ) caused loss of mlh3 gene function; while base substitution or deletion of 3bp and 18bp resulted in changes or deletions of one to several amino acids in the MLH3 protein, without causing substantial damage to its protein function (see Figure 4 ); in the F2 clone population, mlh3 - / - About 64%, mlh3 + / - About 26%, mlh3 + / + About 10%.

[0068] 5) Evaluation of new species of obligate parthenogenetic rotifers: The genotype of the clone population is the homozygous mutant mlh3 with loss of function of the mlh3 gene - / -High-density culture was carried out; during the 70-day continuous intensive culture process, the population density reached 800-1000 / mL, and these clonal populations still only reproduced parthenogenetically without the appearance of male rotifers.

[0069] Through the above method, the present application established four new species of obligate parthenogenetic rotifers, the genotypes of which are mlh3 -2 / -2 、mlh3 -5 / -5 、mlh3 -7 / -7 、mlh3 -10 / -10 These new gene-edited rotifer species, as new live bait for aquaculture seedlings, can achieve stable and sustainable high-density cultivation, reduce the volume of aquaculture water, improve the energy utilization efficiency of biological baits, and reduce seedling costs.

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit it. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A method for cultivating obligate parthenogenetic rotifers, characterized in that: The steps include: 1) Rotifer culture: Take Brachionus plicatilis rotifer and place it in culture medium for several days; 2) Obtaining rotifer larvae: Pipette the rotifer culture solution into the cell culture plate, and repeatedly blow and suck to separate the eggs attached to the back of the rotifer body from the mother body. After culturing the eggs until the next day, obtain the rotifer larvae; 3) Microinjection: larvae are placed in a resting solution of zooplankton diluted with seawater; The larvae were then transferred to a microinjection apparatus and microinjections were performed; 4) Genotype identification of offspring: transfer the injected rotifers to a cell culture plate containing culture medium, culture and produce the first generation F1, pick out the F1 individual for culture, and form multiple clones; pick out a single second generation F2 from the multiple clones, extract genomic DNA for PCR analysis, and evaluate the gene knockout population; then sequence the PCR product to identify the genotype of the clone population; 5) The clone population genotype of which is the homozygous mutant of mlh3 gene functional loss was selected for high-density culture to obtain a clone population of rotifers that only reproduces parthenogenetically without males.

2. The cultivation method according to claim 1, characterized in that In step 1), the culture solution is prepared by adding f / 2 culture medium to seawater filtered through a filter membrane and having a salinity of 15 to 17 ppt, and then adding Tetraselmis to a final concentration of 2 x 10 5 ~6x10 5 cells / mL.

3. The cultivation method according to claim 2, characterized in that The step 1) specifically includes: taking a small amount of Brachionus plicatilis rotifer and placing it in the culture solution, and culturing it continuously for several days at 21-23° C. and a photoperiod of 12 / 12 h until the rotifer density reaches 30-50 rotifers / mL.

4. The cultivation method according to claim 1, characterized in that The step 2) specifically includes: aspirating 3-5 mL of rotifer culture solution into a multi-porous cell culture plate, repeatedly blowing and sucking with a pipette to separate the eggs attached to the rear side of the rotifer body from the mother body; then removing the adult rotifer, and culturing the eggs until the next day to obtain rotifer larvae.

5. The cultivation method according to claim 1, characterized in that: In the step 3), the microinjection includes: connecting the microinjection device to a pneumatic microinjector and loading the CRISPR reagent on the injection needle; placing the rotifer larvae in a flat dish filled with seawater, applying a negative pressure of -3 to -5 hPa to the rotifer larvae holding the straw to adsorb the rotifer ciliary crown; the injection needle is at an angle of 20 to 30 degrees to the horizontal plane, and penetrates the cuticle into the ovary; the injection pressure is 400 to 900 hPa, and the injection time is 1 to 2 s.

6. The cultivation method according to claim 5, characterized in that: The microinjection device comprises a rotifer larvae clamping straw, a flat dish with a side cutout and an injection needle with an opening of about 2 to 3 μm; the outer diameter of the rotifer larvae clamping straw is 200 to 250 μm, the inner diameter is 100 to 150 μm, and the straw is bent at an angle of 13 to 18 degrees at a distance of 5 to 10 mm from the opening; the diameter of the flat dish is 50 to 60 mm, and the cutout depth of one side edge is 2 to 3 mm to accommodate the clamping straw; the needle tip opening diameter of the injection needle is 2 to 3 μm, and the needle tip grinding angle is 20 to 30 degrees.

7. The cultivation method according to claim 5, characterized in that: The CRISPR reagents include: Cas9 nuclease, mlh3-specific gRNA, tetramethylrhodamine-dextran and NEBuffer TM r3.1 Reaction buffer.

8. The cultivation method according to claim 7, characterized in that: The mlh3-specific gRNA sequence is as follows: GCCGAUUCAAUCAGACCGAGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAG UGGCACCGAGUCCGGUGCUUUU.

9. A novel aquatic seedling feed, characterized in that: The bait is prepared by the method according to any one of claims 1-8.

10. Application of the method according to any one of claims 1 to 8 in the preparation of novel aquatic seedling starter feed.

Images