Method and device for detecting and acquiring biomarkers

Abstract

Devices and methods for in situ detection and capture of molecular biomarkers from a subject are provided. In particular, the device comprises an array of microneedles attached to a probe having specificity for one or more biomarkers of interest. The device may be used directly on a subject (e.g., through skin puncture) to detect biomarkers in the subject's body (e.g., tissue, blood flow).

Description

[0001] This application is a divisional application of a Chinese patent application with an application date of December 13, 2013, application number 202111395029.0, and invention name “Methods and devices for detecting and obtaining biomarkers”.

[0002] The application with the application date of December 13, 2013, application number 202111395029.0, and invention name “Methods and devices for detecting and obtaining biomarkers” is a divisional application of the Chinese patent application with the application date of December 13, 2013, application number 201380065515.3, and invention name “Methods and devices for detecting and obtaining biomarkers” (the corresponding PCT application with the application date of December 13, 2013 and application number PCT / US2013 / 075187).

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] This application claims the benefit of U.S. Provisional Patent Application Serial No. 61 / 737,237, filed December 14, 2012, which is incorporated herein by reference in its entirety. Background Art

[0005] Analysis of biomarkers is rapidly becoming the preferred method for early detection of disease, patient stratification, and monitoring of treatment efficacy. Rapid and highly sensitive detection of changes in biomarkers is often technically impossible or may require cumbersome procedures involving multiple processing steps, requiring large sample volumes and extended diagnostic / prognostic timelines. Samples from patients are often of limited volume and are not suitable for multi-step procedures or processing requiring extended processing times.

[0006] The current method for detecting molecular biomarkers or bioanalytes of interest for diagnostic applications mainly relies on extracting body fluids (e.g., blood, interstitial tissue fluid) from patients. It is from this body fluid sample that specific biomarkers are determined. Recent inventions do not directly sample clinically relevant biomarkers from the application site, but on the contrary, further processing of body fluids is required. Other diagnostic methods such as biopsy that are not based on molecular determination are usually cumbersome and are accompanied by a risk of misdiagnosis due to their inherent visual and subjective properties. However, for local, non-circulating biomarkers, this has generally become the only diagnostic option so far.

[0007] There is a need in the art for better means of detecting and analyzing biomarkers present in subjects suffering from or at risk of developing a variety of diseases or conditions. The present invention satisfies this and other needs. Summary of the invention

[0008] In one aspect, the present invention provides a device for in situ detection or extraction of one or more biomarkers from a subject's tissue or biological sample. The device may include a microneedle array and a plurality of probes specific for the biomarker, wherein the probes are covalently attached to the microneedles. In some of the devices, the probes are specific for different biomarkers, and each different probe is attached to a different microneedle. In some other devices, the same probe for a specific biomarker is attached to two or more microneedles. The microneedles in the device may be made of polymers, metals, ceramics, or any other suitable material.

[0009] In some cases, the present disclosure provides a device for detecting or extracting one or more biomarkers from an in situ tissue or biological sample of a subject, comprising one or more microneedles, and one or more probes specific for the biomarker, wherein the probes are attached to the microneedles via covalent or non-covalent linkages.

[0010] The device may include a first microneedle. The first microneedle may be covalently attached to a first probe, which is specific to a first biomarker. Alternatively, the first microneedle may be non-covalently attached to the first probe. In addition, the first probe may be attached to a plurality of microneedles. In some cases, the present invention provides a device including a first microneedle, wherein the first microneedle is covalently or non-covalently attached to a first probe that is specific to a first biomarker. In some cases, the first biomarker may be a polynucleotide. The first probe may be a polynucleotide complementary to the first biomarker. In other cases, the first biomarker may be a polypeptide, an antibody, a metabolite, or a small molecule. In addition, the first probe may be a polynucleotide, a polypeptide, a protein, an antibody, a small molecule, or a bioreceptor. In some cases, the first needle is formed on a substrate.

[0011] The device can also include a second probe, which is specific to the second biomarker. The second probe can be different from the first probe. The second probe can be covalently or non-covalently attached to the first microneedle. Alternatively, the second probe can be covalently or non-covalently attached to the second microneedle. The second biomarker can be a polynucleotide. The second probe can be a polynucleotide complementary to the second biomarker. The second biomarker can also be a polypeptide, an antibody, a metabolite or a small molecule. In addition, the second probe can be a polynucleotide, a polypeptide, a protein, an antibody, a small molecule, a bioreceptor. In some cases, the first probe specifically binds to the first nucleotide polymorphism and the second probe specifically binds to the second nucleotide polymorphism. In some cases, the first and second probes are different antibodies that are specific to different epitopes of the same biomarker.

[0012] In some cases, the device provides microneedles comprising a polymer, a metal, or a ceramic. The first probe can be covalently or non-covalently attached to the plurality of microneedles. The second probe and the plurality of other probes can be covalently or non-covalently attached to the plurality of microneedles.

[0013] Some devices of the present invention relate to detecting nucleic acid biomarkers. In these devices, the probe that can be conjugated to the microneedle is an oligonucleotide or polynucleotide complementary to the biomarker. Some devices use microneedles made of thermoplastic polymers. The polynucleotide probe in the device can be conjugated to the microneedle by many suitable connections including but not limited to sulfhydryl / amino bifunctional linkers or poly (ethylene glycol) linkers. In some cases, the device of the present invention further comprises a compartment for amplifying and identifying the first and second biomarkers.

[0014] Some other devices of the present invention are specifically designed for detecting peptide or protein biomarkers. In some such devices, the probes immobilized on the microneedles are antibodies specific for the biomarkers. In various embodiments of the present invention, a planar substrate is used to support the microneedle array. The devices of the present invention may also include tools for amplifying the biomarkers detected by the probes.

[0015] The device may include a plurality of microneedles. The plurality of microneedles may include at least one microneedle covalently or non-covalently attached to at least one probe specific for a biomarker. The biomarker may indicate a particular condition, including but not limited to a skin or eye condition. In some cases, the biomarker may indicate a skin condition. In some instances, the skin condition is skin cancer. In other instances, the biomarker may indicate an eye condition. In some instances, the eye condition is eye cancer or eye inflammation.

[0016] In some cases, the present disclosure provides a device comprising a plurality of microneedles, wherein the plurality of microneedles comprises at least one microneedle covalently or non-covalently attached to at least one probe specific for a biomarker, and the biomarker indicates a skin or eye condition. In some cases, the biomarker is a polynucleotide, and the at least one probe is complementary to the biomarker. In some cases, the at least one probe comprises different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker. In some cases, the biomarker is a peptide or polypeptide, and the at least one probe is an antibody specific for the biomarker. In some cases, the at least one probe comprises different antibodies specific for different epitopes of the same biomarker.

[0017] The device of the present invention can comprise multiple probes specific for multiple different biomarkers, wherein the multiple probes are attached to the same or different microneedles. In some cases, at least two different probes are attached to the same microneedle. In some cases, the device comprises at least two identical probes for specific biomarkers, wherein the at least two identical probes are attached to one or more microneedles.

[0018] Alternatively, the biomarker may also be obtained during an intraoperative procedure. The device may also include a sensor that emits an optical signal when the probe detects the biomarker. In some instances, the optical signal of the probe may change when the probe detects the biomarker.

[0019] In another aspect, the present disclosure provides a method for detecting or amplifying one or more biomarkers from an in situ tissue (e.g., skin, bloodstream, tissue) or an ex vivo tissue sample in a subject. The method requires (a) preparing a plurality of microneedles to which a plurality of probes specific for the biomarkers are covalently attached, (b) contacting the microneedles with the subject's tissue or biological sample, and (c) detecting the biomarkers bound to the probes on the microneedles.

[0020] In some cases, the present disclosure provides a method for detecting one or more biomarkers from an in situ tissue or biological sample in a subject, comprising (a) contacting a microneedle with a tissue or biological sample of the subject, wherein the microneedle is attached to a set of probes, and wherein the probes bind to one or more biomarkers in situ; and (b) detecting the one or more biomarkers bound to the probes.

[0021] In some cases, the present disclosure provides a device comprising a plurality of microneedles, wherein the plurality of microneedles comprises at least one microneedle covalently or non-covalently attached to a probe specific for a biomarker, wherein the probe comprises a sensor that emits a light signal when the probe detects the biomarker. In some cases, the light signal of the probe increases when it detects the biomarker. In some cases, the light signal of the probe decreases when it detects the biomarker.

[0022] In some cases, the present disclosure provides methods for detecting one or more biomarkers from an in situ tissue or biological sample in a subject, comprising (a) preparing a device comprising one or more microneedles to which one or more probes specific for the biomarkers are covalently attached; (b) contacting the microneedle device with the tissue or biological sample of the subject; and (c) detecting the biomarkers bound to the probes on the microneedle array.

[0023] In some cases, the present disclosure provides a method for detecting one or more biomarkers from an in situ tissue or biological sample in a subject, comprising: (a) contacting a microneedle device with a tissue or biological sample of the subject, wherein the microneedle device comprises one or more probes specific for the one or more biomarkers, wherein at least one probe comprises a sensor that emits a visual signal when the probe detects the biomarker; and (b) detecting the biomarker based on the visual signal.

[0024] Alternatively, the method may include (a) contacting a microneedle device with a tissue or biological sample of a subject, and at least two probes are specific for the one or more biomarkers, wherein the at least two probes specific for the biomarkers are different, wherein the probes are attached to the microneedles via covalent or non-covalent linkages, and (b) detecting the biomarkers bound to the probes.

[0025] In some cases, the present disclosure provides a method for detecting one or more biomarkers in a tissue of a subject, comprising (a) contacting a microneedle with a tissue of the subject in situ, wherein the tissue comprises an extracellular matrix, wherein the microneedle is covalently attached to a set of probes, and wherein the probes are combined with biomarkers in situ; and (b) destroying the extracellular matrix. In some cases, the extracellular matrix is ​​destroyed by enzymatic activity. In some cases, destroying the extracellular matrix includes applying ultrasonic energy to the extracellular matrix. In some cases, the extracellular matrix is ​​destroyed by electric potential.

[0026] In other examples, the method may include (a) contacting a microneedle device with a sample comprising an extracellular matrix, wherein the microneedles are covalently attached to a set of probes, and wherein the probes bind to the biomarkers in situ; and (b) disrupting the extracellular matrix. Alternatively, the method may include disrupting the cell membrane. In either example, the extracellular matrix or the cell membrane may be disrupted by enzyme activity, ultrasonic energy, or electric potential.

[0027] In yet another example, a method can include: (a) contacting a microneedle device with a tissue or biological sample of a subject, wherein the microneedle device comprises one or more probes specific for the one or more biomarkers; and (b) amplifying the biomarkers.

[0028] The biomarker can be a polynucleotide, and the probe can be a polynucleotide complementary to the biomarker. In some cases, the probe can be a different polynucleotide probe specific for different nucleotide polymorphisms of the same biomarker.

[0029] The biomarker can be a peptide or polypeptide, and the probe can be an antibody specific for the biomarker. In some cases, the probe can be different antibodies specific for different epitopes of the same biomarker.

[0030] In order to detect different biomarkers simultaneously, the probes used in the method can be made specific for different biomarkers. The probes can be attached to different microneedles, or the probes can be attached to the same microneedle. In some other embodiments, at least two microneedles can carry the same probe, or multiple probes can be used to detect specific biomarkers.

[0031] The present disclosure also provides a method for preparing a microneedle device, comprising: (a) obtaining a solution comprising an inorganic salt; (b) adding a probe and a microneedle to the solution; and (c) conjugating the probe to the microneedle within the solution. In some cases, the inorganic salt is sodium chloride. In some cases, the concentration of the inorganic salt is less than 2.5M.

[0032] Any suitable material can be used to make the microneedle array used in these methods. Examples include, but are not limited to, polymers, metals, or ceramics. Some methods of the present invention are intended to detect nucleic acid biomarkers. In these methods, the probe used is an oligonucleotide or polynucleotide molecule having a sequence complementary to the sequence of the biomarker. In some such methods, nucleic acid biomarkers captured by the microneedle device are detected and analyzed by PCR or quantitative real-time PCR (qRT-PCR). In some such methods, the microneedle is made of a polymer, and the probe is attached to the microneedle via a thiol / amino bifunctional linker. Alternatively, the microneedle is made of stainless steel and coated with gold, and the probe is attached to the microneedle via a thiol linker. In some embodiments, the microneedle can be solid. Some other methods of the present invention are intended to detect peptide or polypeptide biomarkers. In these methods, the probe used is a molecule that can specifically bind to a biomarker, such as a monoclonal antibody. After being captured with an antibody conjugated to a microneedle, a peptide or protein biomarker bound to the probe on the microneedle can be detected by adding an oligonucleotide-labeled second antibody and subsequent PCR amplification of the conjugated label.

[0033] In some cases, a method for detecting one or more polynucleotide biomarkers from skin or eye tissue in a subject may include contacting a microneedle device with the skin or eye tissue of the subject. The method may further include contacting the microneedle device with the skin capillaries of the subject. In other cases, the method may include contacting the microneedle device with a tissue or biological sample of the subject during an intraoperative procedure. The tissue or biological sample may be from an organ selected from the group consisting of the brain, heart, breast, liver, pancreas, spleen, bladder, stomach, lung, uterus, cervix, prostate, kidney, intestine, appendix, and colon. The method may also include contacting the microneedle with the edge of the tumor after the tumor is removed from the subject. In some cases, the methods of the present disclosure detect biomarkers present in the blood of the subject.

[0034] The present disclosure also provides a method for conjugating a probe to a microneedle, wherein an inorganic salt is added. Examples of inorganic salts include, but are not limited to, lithium salts, potassium salts, sodium salts, magnesium salts, and calcium salts, which typically have halogen counterions. In some cases, the inorganic salt is sodium chloride. The inorganic salt may be added at a concentration of about 0.1 M to 2.0 M. In addition, the inorganic salt may be added at a concentration of about 0.5 M to 1.5 M.

[0035] Various methods of the invention may further include detecting one or more biomarkers from a reference tissue obtained from a subject. Some devices or methods of the invention are designed to detect and obtain biomarkers from a subject's bloodstream. In these embodiments, the probe-conjugated microneedle array is contacted with the subject's bloodstream by piercing the subject's skin.

[0036] In yet another aspect, the invention provides a kit comprising any device for detecting or extracting the biomarkers described in the present application. The kit may also include a set of reagents for polymerase chain reaction. In some instances, the set of reagents may be used for reverse transcriptase polymerase chain reaction. The kit may also include a holder or written instructions for its use.

[0037] In some cases, the present disclosure provides a kit comprising: (a) a device comprising a plurality of microneedles, wherein the plurality of microneedles comprises at least one microneedle covalently or non-covalently attached to a first probe specific for a biomarker; and (b) a set of reagents for a polymerase chain reaction. In some cases, the kit further comprises a fixture. In some cases, the set of reagents comprises a polymerase, a buffer, and a control sample. In some cases, the kit further comprises written instructions for its use.

[0038] On the other hand, the present invention provides a composition comprising a plurality of microneedles coated with a substance (substrate) capable of destroying an extracellular matrix. In some cases, the substance can be an enzyme. The enzyme can be selected from serine proteases, sulfhydryl proteases and MMPs. Specific enzymes include papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, α-chymotrypsin, α-amylase, DNase, collagenase and sutilain. In an example, the enzyme is hyaluronidase.

[0039] A further understanding of the nature and advantages of the present invention may be realized by reference to the remaining portions of the specification and claims.

[0040] Incorporation by reference

[0041] All publications and patent applications mentioned in this specification are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] The novel features of the present invention are particularly set forth in the appended claims. A better understanding of the features and benefits of the present invention will be obtained by referring to the following detailed description and accompanying drawings (also referred to as "figures") which set forth illustrative embodiments in which the principles of the present invention are utilized, wherein:

[0043] Figure 1 A scheme showing the chemical modification of the polycarbonate surface and the attachment of thiol-modified DNA probes.

[0044] Figure 2 Shown is a polymer surface modified with DNA modified with 5'-Cy5, imaged by confocal microscopy using a Far Red filter. The area in the left part of the image is modified.

[0045] Figure 3 Shown is a stainless steel surface modified with DNA containing fluorescent dUTP bases. Panel A. Fluorescence image of DNA on a steel surface. Panel B. Bright field image showing the surface of a stainless steel sample.

[0046] Figure 4 is an illustration of a surface of a disclosed device having a plurality of microneedles.

[0047] Figure 5 The process of hybridization of a DNA probe coupled to a gold surface with a biomarker is shown.

[0048] Figure 6 A method of providing processing using the apparatus of the present disclosure is shown.

[0049] Figure 7 Shown is the enhanced binding of oligonucleotides to the metal microneedle array surface after adding NaCl to the coupling procedure.

[0050] Figure 8 Shown are qRT-PCR data obtained from homogenized human skin samples using the methods of the invention. DETAILED DESCRIPTION OF THE INVENTION

[0051] Although various embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided only as examples. Without departing from the present invention, those skilled in the art may expect many changes, variations and substitutions. It should be understood that a plurality of alternatives to the embodiments of the present invention described herein may be used for implementing the present invention.

[0052] The present invention provides devices and methods for detecting and obtaining biomarkers, especially molecular biomarkers, from the body of a subject. In some embodiments, a device based on a microneedle array with a single or multiple microneedles is manufactured according to the present invention. The length of the individual microneedles on the array can be varied, for example, from 50 μm to 5 mm. The device can be manufactured by different materials, composite materials and material combinations, including but not limited to metals and metal alloys, inorganic ceramics and polymers. Chemically modify the microneedles to couple probes for biomarkers to the microneedle surface. The specific coupling chemistry depends on the material of the microneedles. Different biomarkers can be detected with homologous probes fixed on the same array or the same microneedle. As an example, for the purpose of combining the desired biomarker with the presented probe, the device can be applied to the patient's anatomical location such as skin, eye, tumor or other tissue. It can be applied by hand (e.g., thumb pressing), an applicator device, and kept in place with or without a strip or tape during sampling. The physical insertion of the microneedle probe can destroy the cell membrane to release genetic material, including biomarkers, so that it can be combined with the probe on the inserted microneedle. Extracellular biomarkers can be directly bound to the probe and do not require sampling from materials released by disrupted cells.

[0053] The time required for the biomarker to bind to the microneedles will depend on many parameters, including but not limited to the prevalent quantity, biodistribution and concentration of the biomarker, tissue architecture, and the physical and chemical dimensions of the microneedle probes (e.g., surface area, number of probes, number of binding sites). The application time can be, for example, less than 10 seconds to 60 minutes. After the microneedle array is removed from the tissue, a variety of different techniques including but not limited to PCR, quantitative PCR, protein PCR, sandwich ELISA, elution mass spectrometry, elution Western blotting, and elution ELISA can be used to determine the biomarkers. The biomarkers can be determined after separation from the microneedles or directly on the microneedles.

[0054] As described in detail in the Examples, a variety of chemistries can be used in the conjugation of the probe to the microneedle, depending on the microneedle and the probe to be coupled. Chemical modification of microneedles made of polymers for covalent attachment of biomolecules can be performed using many connections that have been developed in the art. For example, for microneedles with polycarbonate surfaces, the carbonate monomer contains an aromatic moiety that can be chemically derived after polymerization. Treatment of the microneedles with nitric acid, followed by reduction of the resulting nitro groups, provides an amine handle through which the molecule can be coupled to the polymer backbone. Importantly, this two-step reaction can be performed on a prepared microneedle array without compromising the integrity of the array or individual microneedles. Using this procedure, standard amide bond coupling reagents can be used to attach carboxylic acid-containing probes to the microneedle surface.

[0055] When making microneedles from metals, it is achievable to apply the same principles to metal surfaces as described for polymer surfaces. For example, a stainless steel surface can be coated with gold by sputter coating, thereby providing a chemical handle for attachment. By exploiting the well-characterized affinity of thiol groups for gold surfaces, a divalent cross-linking agent having a thiol group on one end and an amine on the other end can be attached to the metal surface, thereby allowing coupling chemistry of the same probe molecule to the microneedle surface. Suitable methods for chemically modifying other types of microneedle surfaces (e.g., inorganic ceramics) for covalent attachment of biomolecules are also known in the art.

[0056] The invention described herein has broad applicability in many different aspects of diagnosis, including genetic (e.g., mRNA, DNA), protein, hormone, small molecule and cellular biomarkers for diagnosis and disease prognosis. For example, the devices or methods described herein can be used to detect skin-based biomarkers, detect systemic circulating biomarkers, pathogen detection (e.g., bacteria, viruses or parasites), or determine the margins of tumors during surgical tumor resection. As described herein, specific examples of skin-based diagnostic applications of the present invention include detection of biomarkers for cutaneous malignant melanoma, non-melanocytic skin cancer (e.g., basal cell carcinoma, squamous cell carcinoma), autoimmune diseases (e.g., psoriasis), infectious diseases and tropical diseases (e.g., Buruli ulcer, onchocerciasis). Specific examples of non-skin-based diagnostic applications of the present invention include detection of markers for neoplastic diseases, hematological diseases, cardiovascular diseases, Down syndrome, and real-time, rapid biomarker detection during clinical trials.

[0057] The following section provides more detailed guidance for implementing the invention.

[0058] definition

[0059] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The following references provide the skilled artisan with general definitions of many of the terms used in the present invention: Academic Press Dictionary of Science and Technology, Morris (ed.), Academic Press (1st ed. 1992); Oxford Dictionary of Biochemistry and Molecular Biology, Smith et al. (eds.), Oxford University Press (revised edition, 2000); Encyclopaedic Dictionary of Chemistry, Kumar (ed.), Anmol Publications Pvt. Ltd. (2002); Dictionary of Microbiology and Molecular Biology, Singleton et al. (eds.), John Wiley & Sons (3rd ed. 2002); Dictionary of Chemistry, Hunt (ed.), Routledge (1st ed. 1999); Dictionary of Pharmaceutical Medicine, Nahler (ed.), Springer-Verlag Telos (1994); Dictionary of Organic Chemistry, Kumar and Anandand (eds.), Anmol Publications Pvt. Ltd. (2001); Publications Pvt. Ltd. (2002); and A Dictionary of Biology (Oxford Paperback Reference), Martin and Hine (eds.), Oxford University Press (4th edition, 2000). In addition, the following definitions are provided to assist the reader in practicing the present invention.

[0060] Biomarkers broadly refer to any characteristic objectively measured and evaluated as an indicator of a normal biological process, a pathogenic process, or a pharmacological response to a therapeutic intervention. Unless otherwise noted, the term biomarker as used herein refers in particular to a biomarker with a biophysical property that allows them to be measured in a biological sample (e.g., plasma, serum, cerebrospinal fluid, bronchoalveolar lavage fluid, biopsy). Unless otherwise noted, the term biomarker is used interchangeably with "molecular biomarker" or "molecular marker". Examples of biomarkers include nucleic acid biomarkers (e.g., oligonucleotides or polynucleotides), peptide or protein biomarkers, lipids, and lipopolysaccharide markers.

[0061] As used herein, a microneedle device or microneedle array (microarray) refers to a device comprising at least one small piercing element or microneedle to which a diagnostic agent or compound is fixed. The microneedle is capable of piercing a biological barrier (e.g., the stratum corneum of the skin) in a human or other mammalian subject upon contact. Preferably, the device comprises a plurality of such microneedles, e.g., 2, 5, 10, 25, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 2000, 5000, 10000, 20000 or more. By conjugating diagnostic probes to microneedles, the microneedle device of the present invention provides a means for in situ detection of biomarkers in a subject's tissue or biological sample (e.g., bloodstream or skin).

[0062] As used herein, the term "polynucleotide" or "nucleic acid" refers to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length, which contain purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases. The polynucleotides of the embodiments of the present invention include sequences of deoxyribonucleic acid (DNA), ribonucleic acid (RNA) or DNA copies (cDNA) of ribonucleic acid, all of which can be isolated, recombinantly generated or artificially synthesized from natural sources. Another example of a polynucleotide is a polyamide polynucleotide (PNA). Polynucleotides and nucleic acids can exist as single strands or double strands. The backbone of a polynucleotide can contain sugars and phosphate groups as generally found in RNA or DNA, or modified or substituted sugars or phosphate groups. Polynucleotides can contain modified nucleotides, such as methylated nucleotides and nucleotide analogs. The sequence of nucleotides can be interrupted by non-nucleotide components. Polymers composed of nucleotides such as nucleic acids, polynucleotides and polynucleotides can also be referred to as nucleotide polymers in this article.

[0063] The term "oligonucleotide" is defined as a molecule comprising two or more deoxyribonucleotides, preferably more than three deoxyribonucleotides. Its exact size will depend on many factors, which in turn depend on the final function and purpose of the oligonucleotide. As used herein, the term "primer" refers to an oligonucleotide, whether naturally occurring or synthetically generated as in the restriction digest of purification, when placed under the conditions of inducing the synthesis of a primer extension product complementary to a nucleic acid chain, that is, in the presence of nucleotides and inducing agents such as DNA polymerase and at a suitable temperature and pH, it can serve as a starting point for synthesis. The primer can be single-stranded or double-stranded, and must be long enough to initiate the synthesis of the desired extension product in the presence of an inducing agent. The exact length of the primer will depend on many factors, including temperature, primer source and method used. For example, for diagnostic applications, depending on the complexity of the target sequence, an oligonucleotide primer generally comprises 15-25 or more nucleotides, although it may comprise fewer nucleotides. The factors involved in determining the appropriate length of a primer are readily known to those of ordinary skill in the art.

[0064] A polypeptide is a polymer chain comprising amino acid residue monomers linked together by amide bonds (peptide bonds). The amino acid can be an L-optical isomer or a D-optical isomer. Typically, a polypeptide refers to a long polymer of amino acid residues, such as a polymer consisting of at least more than 10, 20, 50, 100, 200, 500 or more amino acid residue monomers. A polypeptide can be a chain of at least two amino acids, peptide mimetics, proteins, recombinant proteins, antibodies (monoclonal or polyclonal), antibody fragments, antigens, epitopes, enzymes, receptors, vitamins or their structural analogs or combinations. However, unless otherwise noted, the term polypeptide as used herein also includes short peptides, which typically include two or more amino acid monomers, but typically do not exceed 10, 15 or 20 amino acid monomers.

[0065] A protein is a long polymer of amino acids linked by peptide bonds and may also contain two or more polypeptide chains. More specifically, the term "protein" refers to a molecule containing one or more chains of amino acids in a specific order; for example, an order determined by the base sequence of nucleotides in a gene encoding the protein. Proteins are essential for the structure, function, and regulation of cells, tissues, and organs of the body, and various proteins have unique functions. Examples are hormones, enzymes, and antibodies. In some embodiments, the terms polypeptide and protein may be used interchangeably.

[0066] As used herein, "biological sample" is a sample of a biological tissue or chemical fluid suspected of containing a biomarker or analyte of interest. The sample can be an in vitro sample or an in vivo sample. The sample includes, for example, body fluids such as whole blood, serum, plasma, cerebrospinal fluid, urine, lymph, and various exocrines of the respiratory tract, intestinal tract and urogenital tract such as tears, saliva, semen, milk, etc.; and other biological fluids such as cell culture suspensions, cell extracts, cell culture supernatants. The sample can also include, for example, tissue biopsies from the lungs, liver, brain, eyes, tongue, colon, kidney, muscle, heart, skin, pancreas, uterus, cervix, prostate, salivary glands, etc. The sample can also be, for example, microbiopsies extracted from a patient and subsequently processed using laser capture microscopy dissection, small samples or even single cells. The sample can be suspended or dissolved in, for example, a buffer, an extractant, a solvent, etc.

[0067] As used herein, the term "tissue" refers to a collection of similar cells and the intracellular material that surrounds them. There are 4 basic tissues in the body: 1) epithelium; 2) connective tissue, including blood, bone, and cartilage; 3) muscle tissue; and 4) nervous tissue.

[0068] In this article, ranges can be expressed as from "about" a specific value and / or to "about" another specific value. When such a range is expressed, another embodiment includes from a specific value and / or to another specific value. Similarly, when a value is expressed as an approximation by using the preceding "about", it should be understood that the specific value constitutes another embodiment. It can be further understood that the endpoints of each range are important both when related to another endpoint and when independent of another endpoint. As used herein, the term "about" refers to a range of ±15% from a specified value within the context of a specific use. For example, about 10 will include a range of 8.5 to 11.5.

[0069] A covalent bond is a chemical bond involving the sharing of electron pairs between atoms. Covalent bonding includes a variety of interactions, including σ-bonding, π-bonding, metal-metal bonding, agostic interactions, and three-center two-electron bonds. Non-covalent interactions differ from covalent bonds in that they do not involve the sharing of electrons. Non-covalent bonds can generally be divided into four categories: electrostatic, π-effect, van der Waals forces, and hydrophobic interactions.

[0070] Biomarkers

[0071] The devices and methods described herein can be used in a variety of diagnostic applications to detect and capture specific biomarkers. Biomarkers can be used in clinical practice to identify the risk of a disease or diagnose a disease, stratify patients, evaluate disease severity or progression, predict prognosis, or guide treatment. In drug development, biomarkers can be used to help determine how a drug works in vivo, to determine the biologically effective dose of a drug, to help evaluate whether a drug is safe or effective, and to help identify patients who are most likely to respond to treatment or patients who are least likely to suffer adverse events when treated with a drug. Biomarkers can sometimes be used as part of the approval process for a drug or treatment to provide information to management decisions.

[0072] In some cases, the methods and devices of the present invention can be used to detect multiple biomarkers in a subject using the microneedle array device described herein and conventionally implemented amplification techniques (e.g., genomic or proteomic techniques). In some cases, a microneedle array device can be used to capture a biomarker or a group of biomarkers, and then one or more additional labeled probes can be used to detect the captured biomarkers, thereby detecting multiple biomarkers from a subject.

[0073] Biomarkers that can be detected using the present disclosure include nucleic acid-based biomarkers (DNA, RNA, mRNA transcripts, genomic DNA, tRNA, siRNA, miRNA, mitochondrial DNA, mitochondrial RNA, exosomal nucleic acids, cell-free DNA or RNA, polynucleotides with mutant genes and polymorphisms), peptides, proteins, lipids, lipid metabolites, and small molecules. Biomarkers include diagnostic biomarkers (e.g., cardiac troponins for the diagnosis of myocardial infarction), disease staging biomarkers (brain natriuretic peptides for congestive heart failure), disease prognosis biomarkers (cancer biomarkers), and biomarkers for monitoring clinical responses to intervention (HbA1c for anti-diabetic treatment). They also include biomarkers used in decision-making in early drug development. For example, pharmacodynamic (PD) biomarkers are markers of specific pharmacological responses, which are particularly meaningful in dose optimization studies. Examples of disease suggestive biomarkers include serum LDL for high cholesterol and blood pressure, the P53 gene and MMP for cancer. Other examples of specific nucleic acid biomarkers and protein biomarkers suitable for detection using the methods and devices of the present invention are described below.

[0074] Some preferred embodiments of the present invention relate to the detection and amplification of nucleic acid biomarkers. Many nucleic acid biomarkers are known in the art. Examples include telomerase reverse transcriptase mRNA as a diagnostic biomarker for hepatocellular carcinoma (Miura et al., Clin. Cancer Res. 11:3205–9, 2005), plasma hnRNP B1 mRNA as a biomarker for lung cancer (Sato et al., J. Cancer Res. Clin. Oncol. 134:1191-7, 2008), GD2 / GM2 synthase mRNA as a biomarker for small cell lung cancer (Chen et al., Lung Cancer. 67:216-20, 2010), serum transforming growth factor-α mRNA as a prognostic biomarker for fulminant hepatitis (Miura et al., Hepatol Int. 2:213-21, 2008), plaque protein-3 mRNA for gastrointestinal cancer (Valladares-Ayerbes et al., Cancer Epidemiol Biomarkers Prev.19:1432-1440, 2010), metallothionein as a biomarker of heavy metal exposure (Yamada et al., Industrial Health 39:29-32, 2001), WT1 mRNA as a biomarker for monitoring minimal residual disease in acute myeloid leukemia (Sakamoto et al., Tohoku J Exp Med. 219:169-76, 2009), and granzyme A mRNA as a biomarker of renal transplant rejection (van Ham et al., Kidney Int'l. August 18, 2010). These biomarkers and a variety of other nucleic acid biomarkers known in the art are suitable for detection using the methods and devices of the present invention. The polynucleotide sequences of these known biomarkers have been described and characterized in the art. Based on their known sequences, probes specific for detecting these biomarkers (e.g., oligonucleotide primers) can be easily designed and synthesized using conventional methods of molecular biology. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY, (3rd ed., 2000); and Brent et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (ringbou ed., 2003).

[0075] In some other embodiments, peptide or protein biomarkers are detected using the devices and methods of the present invention. The methods and devices described herein can be used to detect a variety of peptide or protein biomarkers that have been characterized in the art. Specific examples of peptide or protein biomarkers suitable for the present invention include, but are not limited to, PSA as a biomarker for prostate cancer (Polascik et al., J. Urol. 162: 293-306, 1999), cancer antigen 125 (CA125) as a biomarker for ovarian cancer (Jacobs et al., Lancet 353: 1207–1210, 1999), BC1, BC2 and BC3 as serum biomarkers for detecting breast cancer (Mathelin et al., Breast Cancer Res. Treat. 96: 83-90, 2006), β-defensin-2 protein as a serum biomarker for psoriasis (Patrick et al., PLoS ONE 4:e4725, 2009), C-reactive protein as a biomarker for metastasis of renal cell carcinoma (Johnson et al., Mol. Diagn. Ther. 14:191-3, 2010), high molecular weight melanoma-associated antigen as a biomarker for desmoplastic melanoma (Goto et al., Pigment Cell Melanoma Res. 23:137–140, 2010), telomerase expression as a biomarker for malignant transformation in patients with inflammatory bowel disease (Gonzalo et al., Gastroenterol Hepatol. 33:288-96, 2010), and insulin-like growth factor II mRNA-binding protein 3 (IMP3) as a prognostic biomarker for oral squamous cell carcinoma (Li et al., Head Neck. Jul 22, 2010). Probes (eg, monoclonal antibodies) for detecting these biomarkers can be readily generated using standard immunological techniques (eg, hybridoma technology) or obtained from commercial suppliers (eg, Abnova Corporation, Full Moon BioSystems, and Spring Bioscience).

[0076] Depending on the specific type of biomarker to be detected, the microneedle device described herein can be combined with various methods known in the art for amplification and examination of molecular entities. Many genomic and proteomic technologies are suitable for detection and analysis of protein and nucleic acid markers in the device and method of the present invention. For example, PCR can be used to amplify and examine nucleic acid molecules bound to probes on microneedles. ELISA can be used to analyze peptide or protein markers captured by the microneedle-based device of the present invention. In addition to genomic and proteomic platform biomarker determination techniques, metabolomics, lipidomics (lipidomics) and glycomics technologies can also be used for the identification and detection of biomarkers of other chemical classes. For example, mass spectrometry, chromatography and nuclear magnetic resonance can be used to detect and analyze a variety of biomolecules bound to microneedles.

[0077] Microneedles for attaching diagnostic probes

[0078] The present invention provides a microneedle device with a covalently attached molecular probe for in situ detection and acquisition of biomarkers from a subject. The microneedle-based device comprises one or more microneedles that can penetrate into a biological barrier of a mammal such as the skin or mucous membrane. Typically, the microneedles are non-invasive or minimally invasive. When there are multiple microneedles, the device may also have a planar substrate supporting the microneedles. The substrate may be made of the same material as the microneedles. The substrate may also be made of different materials. The microneedles used in the present invention have a length (height) of typically 20 μm to 1 mm, preferably 50 μm to 500 μm. Figure 4is a diagram of the surface of a device of the present invention comprising a plurality of microneedles. Each "square" in 401 shows a single microneedle. 401 shows a plurality of microneedles on the surface of a device of the present invention, wherein the height of the needles is about 400 μm to about 1000 μm. In some embodiments, the height of the microneedles is about 20 μm to about 50 μm, about 20 μm to about 100 μm, about 20 μm to about 150 μm, about 20 μm to about 200 μm, about 20 μm to about 250 μm, about 20 μm to about 300 μm, about 20 μm to about 350 μm, about 20 μm to about 400 μm, about 20 μm to about 450 μm, about 20 μm to about 500 μm, about 20 μm to about 550 μm, about 20 μm to about 600 μm, about 20 μm to about 650 μm, about 20 μm to about 700 μm, about 20 μm to about 750 μm, about 20 μm to about 800 μm, about 20 μm to about 850 μm, about 20 μm to about 900 μm, about 20 μm to about 950 μm, or about 20 μm to about 1 mm. In some cases, the height of the microneedle is less than 1 μm, less than 5 μm, less than 10 μm, less than 15 μm, less than 20 μm, less than 25 μm, less than 30 μm, less than 35 μm, less than 40 μm, less than 45 μm, less than 50 μm, less than 75 μm, less than 100 μm, less than 150 μm, less than 200 μm, less than 250 μm, less than 300 μm, less than 500 μm, less than 750 μm, less than 1000 μm, less than 2000 μm, less than 3000 μm, less than 4000 μm, less than 5000 μm, less than 7500 μm, or less than 10000 μm. In some cases, the height of the microneedle is greater than 1 μm, greater than 5 μm, greater than 10 μm, greater than 15 μm, greater than 20 μm, greater than 25 μm, greater than 30 μm, greater than 35 μm, greater than 40 μm, greater than 45 μm, greater than 50 μm, greater than 75 μm, greater than 100 μm, greater than 150 μm, greater than 200 μm, greater than 250 μm, greater than 300 μm, greater than 500 μm, greater than 750 μm, greater than 1000 μm, greater than 2000 μm, greater than 3000 μm, greater than 4000 μm, greater than 5000 μm, greater than 7500 μm, or greater than 10000 μm.

[0079] Although the needle-shaped microneedle can be a blunt object, it is preferably a pointed object. In some embodiments, the microneedle has a conical structure with a base diameter of typically 10 μm to 500 μm, preferably 20 μm to 200 μm. 401 shows the surface of a device with multiple microneedles of the present invention, wherein the diameter of the base is less than 10 mm in width. For a device comprising multiple microneedles, the microneedles can be present in rows on the device. In some embodiments, the rows can be spaced at intervals that are almost equal to the spacing of the needles aligned in the row. In some embodiments, the rows can be spaced at irregular intervals.

[0080] The microneedle can have a variety of shapes, for example, the microneedle can be circular, conical, triangular, square, rectangular, pentagonal, hexagonal, heptagonal, octagonal or any other suitable shape. The microneedle can be a sharp microneedle, a blunt microneedle or any combination thereof. For example, a device comprising a plurality of sharp microneedles of the present invention can be used to penetrate the skin of a subject, thereby contacting the probe on the microneedle with, for example, an RNA biomarker. The sharp microneedle can be used to destroy the tissue of a biological sample, such as a cell layer or an outer membrane of a cell. The blunt microneedle can be used to touch the skin surface of a subject, thereby contacting the microneedle with, for example, a cell surface biomarker on the skin. In some cases, the present disclosure provides a microneedle device comprising microneedles having different shapes (e.g., sharp and blunt microneedles).

[0081] In some embodiments, the device of the present invention comprises at least 1 microneedle, at least 100 microneedles, at least 200 microneedles, at least 300 microneedles, at least 400 microneedles, at least 500 microneedles, at least 600 microneedles, at least 700 microneedles, at least 800 microneedles, at least 900 microneedles, at least 1000 microneedles, at least 1100 microneedles, at least 1200 microneedles, at least 1300 microneedles, at least 1400 microneedles, at least 1500 microneedles, at least 1600 microneedles, at least 1700 microneedles, at least 1800 microneedles, at least 1900 microneedles, at least 2000 microneedles, at least 2100 microneedles, at least 2200 microneedles, at least 2300 microneedles, at least 2400 microneedles, at least 2500 microneedles, at least 2600 microneedles, at least 2700 microneedles, at least 2800 microneedles, at least 2900 microneedles, at least 3000 microneedles, at least 3100 microneedles, at least 3200 microneedles, at least 3300 microneedles, at least 3400 microneedles, at least 3500 microneedles, at least 3600 microneedles, at least 3700 microneedles, at least 3800 microneedles, at least 3900 microneedles, at least 4000 microneedles, at least 4100 microneedles, at least 4200 microneedles, at least 4300 microneedles, at least 4400 microneedles, at least 4500 microneedles, at least 4600 microneedles, at least 4700 microneedles, at least 4800 microneedles, at least 4900 microneedles, or at least 5000 microneedles.

[0082] In some embodiments, the device of the present invention comprises at most 10,000 microneedles, at most 5,000 microneedles, at most 2,500 microneedles, at most 2,000 microneedles, at most 1,000 microneedles, at most 500 microneedles, at most 400 microneedles, at most 300 microneedles, at most 100 microneedles, at most 90 microneedles, at most 50 microneedles, at most 40 microneedles, at most 30 microneedles, at most 20 microneedles, at most 15 microneedles, at most 10 microneedles, at most 9 microneedles, at most 8 microneedles, at most 7 microneedles, at most 6 microneedles, at most 5 microneedles, at most 4 microneedles, at most 3 microneedles, at most 2 microneedles, or 1 microneedle.

[0083] In some embodiments, the devices of the present invention comprise from about 1 microneedle to about 100 microneedles, from about 1 microneedle to about 200 microneedles, from about 1 microneedle to about 300 microneedles, from about 1 microneedle to about 400 microneedles, from about 1 microneedle to about 500 microneedles, from about 1 microneedle to about 600 microneedles, from about 1 microneedle to about 700 microneedles, from about 1 microneedle to about 800 microneedles, from about 1 microneedle to about 900 microneedles, from about 1 microneedle to about 1000 microneedles, from about 1 microneedle to about 1100 microneedles, from about 1 microneedle to about 1200 microneedles, from about 1 microneedle to about 1300 microneedles, about 1 microneedle to about 1400 microneedles, about 1 microneedle to about 1500 microneedles, about 1 microneedle to about 1600 microneedles, about 1 microneedle to about 1700 microneedles, about 1 microneedle to about 1800 microneedles, about 1 microneedle to about 1900 microneedles, about 1 microneedle to about 2000 microneedles, about 1 microneedle to about 2100 microneedles, about 1 microneedle to about 2200 microneedles, about 1 microneedle to about 2300 microneedles, about 1 microneedle to about 2400 microneedles, about 1 microneedle to about 2500 microneedles microneedles, about 1 microneedle to about 2600 microneedles, about 1 microneedle to about 2700 microneedles, about 1 microneedle to about 2800 microneedles, about 1 microneedle to about 2900 microneedles, about 1 microneedle to about 3000 microneedles, about 1 microneedle to about 3100 microneedles, about 1 microneedle to about 3200 microneedles, about 1 microneedle to about 3300 microneedles, about 1 microneedle to about 3400 microneedles, about 1 microneedle to about 3500 microneedles, about 1 microneedle to about 3600 microneedles, about 1 microneedle to about 3700 microneedles, about 1 microneedle From about 3800 microneedles, from about 1 microneedle to about 3900 microneedles, from about 1 microneedle to about 4000 microneedles, from about 1 microneedle to about 4100 microneedles, from about 1 microneedle to about 4200 microneedles, from about 1 microneedle to about 4300 microneedles, from about 1 microneedle to about 4400 microneedles, from about 1 microneedle to about 4500 microneedles, from about 1 microneedle to about 4600 microneedles, from about 1 microneedle to about 4700 microneedles, from about 1 microneedle to about 4800 microneedles, from about 1 microneedle to about 4900 microneedles, or from about 1 microneedle to about 5000 microneedles.

[0084] The substrate and microneedle of array can be made of multiple biodegradable or non-biodegradable materials.The example of the material of microneedle or substrate includes poly (methyl methacrylate), silicon, silicon dioxide, ceramic, metal (for example stainless steel, titanium, nickel, molybdenum, chromium and cobalt) and synthetic or natural resin material.Some embodiments use biodegradable polymers, for example polylactic acid, polyglycolide, polylactic acid-polyglycolide copolymer, pullulan, caprolactone (capronolactone), polyurethane or polyanhydride.In some other embodiments, non-degradable materials are used to make microneedle array, for example polymer polycarbonate, synthetic or natural resin material such as polymethacrylic acid, ethylene vinyl acetate, polytetrafluoroethylene, polysulfone or polyoxymethylene.In some embodiments, materials used include polysaccharides such as hyaluronic acid, pullulan, dextran, dextrin or chondroitin sulfate or are coated with this polysaccharide.In some cases, microneedle is made of thermoplastic polymer.

[0085] The substrate and microneedles of the array can be made of a variety of thermoplastic polymers. Non-limiting examples of thermoplastic polymers include acrylic polymers such as poly(methyl methacrylate) (PMMA), nylon, polyethylene, polypropylene, polystyrene, polyvinyl chloride or Teflon. In some cases, the device of the present invention is made using a thermoplastic polymer selected from polycarbonate, poly(methyl methacrylate), polyethylene and polypropylene.

[0086] Non-limiting examples of non-degradable polymers include, for example, silicones, hydrogels such as cross-linked poly(vinyl alcohol) and poly(hydroxyethyl methacrylate), ethylene-vinyl acetate, acyl-substituted cellulose acetate and its alkyl derivatives, partially and completely hydrolyzed olefin-vinyl acetate copolymers, unplasticized polyvinyl chloride, cross-linked homopolymers and copolymers of polyvinyl acetate, cross-linked polyesters of acrylic acid and / or methacrylic acid, polyvinyl alkyl ethers, polyvinyl fluoride, polycarbonate, polyurethane, polyamide, polysulfone, styrene acrylonitrile copolymers, cross-linked poly(ethylene oxide), poly(alkylene), poly(vinylimidazole), polyester, poly(ethylene terephthalate), polyphosphazene and chlorosulfonated polyolefins and combinations thereof. In some embodiments, the polymer comprises ethylene vinyl acetate.

[0087] Non-limiting examples of biodegradable polymers include polyesters such as 3-hydroxypropionate, 3-hydroxybutyrate, 3-hydroxyvalerate, 3-hydroxyhexanoate, 3-hydroxyheptanoate, 3-hydroxyoctanoate, 3-hydroxynonanoate, 3-hydroxydecanoate, 3-hydroxyundecanoate, 3-hydroxydodecanoate, 4-hydroxybutyrate, 5-hydroxyvalerate, polylactide or polylactic acid, including poly (d-lactic acid), poly (1-lactic acid), poly (d, l-lactic acid), polyglycolic acid and polyglycolide, poly (lactic acid-glycolic acid) copolymer, poly (lactide-glycolide) copolymer, poly (ε-caprolactone) and polydioxanone. Polysaccharides including starch, glycogen, cellulose and chitin can also be used as biodegradable materials.

[0088] 402 shows a surface 401 of a device of the present disclosure, which contains a plurality of microneedles to which at least one type of probe has been coupled. 402 can be coupled to, for example, polynucleotide probes, peptide probes, protein probes, or any combination thereof. The probes attached to the microneedles on the device 402 can be covalently or non-covalently coupled to the microneedles. Examples 1 and 2 further describe in detail various methods for covalently coupling probes to surfaces.

[0089] The distance between the centers of two microneedles on the device of the present disclosure can be calculated to determine the density of the microneedles in the device. In some embodiments, the center-to-center distance between two microneedles can be less than 1000 μm, less than 900 μm, less than 800 μm, less than 700 μm, less than 600 μm, less than 500 μm, less than 400 μm, less than 300 μm, less than 200 μm, or less than 100 μm. In some embodiments, the center-to-center distance between two microneedles can be no greater than 100 μm, no greater than 200 μm, no greater than 300 μm, no greater than 400 μm, no greater than 500 μm, no greater than 600 μm, no greater than 700 μm, no greater than 800 μm, no greater than 900 μm, or no greater than 1000 μm.

[0090] The microneedle of the present disclosure can include a plurality of different diameters or base widths. The shape of the base of the microneedle can be, for example, circular, rectangular, triangular, square, pentagonal, hexagonal, heptagonal or other geometric shapes. The microneedle of the present disclosure can have a diameter or base width of not more than 500 μm, not more than 400 μm, not more than 300 μm, not more than 200 μm, not more than 100 μm, not more than 50 μm, not more than 40 μm, not more than 30 μm, not more than 20 μm, not more than 10 μm, not more than 1000 nm, not more than 900 nm, not more than 800 nm, not more than 700 nm, not more than 600 nm, not more than 500 nm, not more than 400 nm, not more than 300 nm, not more than 200 nm or not more than 100 nm.

[0091] The probe can be covalently or non-covalently attached to the microneedle at multiple different depths within the microneedle. 403 shows a microneedle with a height of 600 μm and a width of 200 μm. 404 shows a microneedle with a height of 600 μm and a width of 200 μm and a covalently attached probe at a depth of 10 μm. 405 shows a microneedle with a height of 600 μm and a width of 200 μm and a covalently attached probe at a depth of 500 μm. In some cases, the depth of the probe within the microneedle can be used to determine the depth at which a biomarker can be found in a tissue. In some cases, a device comprising multiple microneedles with multiple probes attached at different depths of different microneedles can be used to determine where a biomarker can be found in a tissue. For example, the device can be used to determine the size or depth of a lesion, such as a cancerous lesion.

[0092] The depth of the probe can be about 10 μm, about 20 μm, about 30 μm, about 40 μm, about 50 μm, about 60 μm, about 70 μm, about 80 μm, about 90 μm, about 100 μm, about 110 μm, about 120 μm, about 130 μm, about 140 μm, about 150 μm, about 160 μm, about 170 μm, about 180 μm, about 190 μm, about 200 μm, about 210 μm, about 220 μm, about 230 μm, about 240 μm, about 250 μm, about 260μm, about 270μm, about 280μm, about 290μm, about 300μm, about 310μm, about 320μm, about 330μm, about 340μm, about 350μm, about 360μm, about 370μm, about 380μm, about 390μm, about 400μm, about 410μm, about 420μm, about 430μm, about 440μm, about 450μm, about 460μm, about 470μm, about 480μm, about 490μm, about 500μm, about 510μm, about 520μm, about 530μm, about 540μm, about 550μm, about 560μm, about 570μm, about 580μm, about 590μm, about 600μm, about 610μm, about 620μm, about 630μm, about 640μm, about 650μm, about 660μm, about 670μm, about 680μm, about 690μm, about 700μm, about 710μm, about 720μm, about 730μm, about 740μm, about 750μm, about 760μm, about 770μm, about 780μm, about 790μm, about 800μm, about 810μm, about 820μm, about 830μm, about 840μm, about 850μm, about 860μm, about 870μm, about 880μm, about 890μm, about 900μm, about 910μm, about 920μm, about 930μm, about 940μm, about 950μm, about 960μm, about 970μm, about 980μm, about 990μm or about 1000μm.

[0093] Optionally, the microneedle device of the present invention may also include an applicator unit that can be used to apply the device to a subject. The applicator unit can control a variety of application parameters, such as the speed of applying the array, the force of applying the array, and / or the angle at which the array impacts the tissue (e.g., skin) of the subject. In addition, the applicator can help process or otherwise transfer the array from the storage unit to the subject. In some embodiments, the applicator can be a single-use, disposable tool that serves as a storage unit and an application tool. Examples of suitable applicators and methods of applying microneedle arrays are disclosed in U.S. Patents 6,293,925 (Safabash et al.), 6,743,211 (Prausnitz et al.), 6,881,203 (Delmore et al.), and 6,855,131 (Trautman et al.) and U.S. Patent Application Publications 2004 / 0181203 (Cormier et al.), 2002 / 0032415 (Trautman et al.), and 2002 / 0087182 (Trautman et al.). The applicator unit can have a plurality of different shapes. In some embodiments, the applicator unit can be, for example, linear, triangular, rectangular or disc-shaped. In some embodiments, the applicator unit is a pen applicator.

[0094] The microneedle array for conjugating diagnostic probes can be easily manufactured using materials and methods known in the art for preparing arrays with microscopic protrusion structures. See, for example, U.S. Patents 7416541, 7332197, 6663820, 6503231, U.S. Patent Application 20100106105 and European Patent Application 2119469A. For example, the microneedle array can be manufactured by wet etching or dry etching using a silicon substrate, precision machining (e.g., discharge machining, laser machining, cutting machining, hot stamping and injection molding) and mechanical cutting using metal or resin. Using such machining methods, the needle portion and the support portion are molded into one. The example of the method for making the needle portion hollow includes a method for performing secondary processing by using laser machining, etc. after manufacturing the needle portion. In some cases, the microneedle of the present disclosure can be a solid (non-hollow) microneedle. In some cases, the microneedle of the present disclosure can be etched to increase the surface area of ​​the microneedle.

[0095] Multiple cell disruption methods may be required to make the biomarkers accessible to the probe. Cells may be disrupted by disrupting the extracellular matrix or disrupting the cell membrane. The device of the present disclosure may cause cell disruption when, for example, at least one microneedle contacts and penetrates a biological sample such as human skin.

[0096] Multiple in situ or ex vivo cells can be broken with a substance. Thus, the present invention further provides a composition comprising multiple microneedles coated with a substance capable of destroying the extracellular matrix. In some cases, the substance is an enzyme. Various enzymes, including but not limited to serine proteases, sulfhydryl proteases and MMPs, can be used in this process. Non-limiting examples of enzymes that can be used for cell and tissue destruction include but are not limited to papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, α-chymotrypsin, α-amylase, DNase, collagenase, sutylase protease, lysozyme, lipase, digestive enzyme, cellulase, mutanolysin or polysaccharidase. In some instances, the enzyme is hyaluronidase.

[0097] Other methods of cell and tissue destruction may include, for example, sonication, electroporation, cryogenic pulverization, physical destruction using pressure, grinding, detergent-based cell lysis, or mechanical shearing of tissue using, for example, a homogenizer. For example, the extracellular matrix or cell membrane may be destroyed by ultrasonic energy or by an electric potential. Applying a solvent to a biological sample may also be used to make the biomarker available for hybridization with a probe.

[0098] The devices of the present disclosure can destroy biological tissue in situ or ex vivo in a minimally invasive manner. For example, the microneedles of the present disclosure can be in contact with the skin in the eye of a subject. The microneedles can gently destroy the membrane of the cell layer in the skin of the eye, thereby providing accessibility of biomarkers in the eye to the probe in the microneedle. In some embodiments, the methods and devices of the present disclosure can be applied to identify and characterize biomarkers from fragile tissues or tissues that are not suitable for surgery. For example, biomarkers present in the eye or brain. In some embodiments, the methods and devices of the present disclosure are applied to the in situ characterization of biomarkers from biological samples that may not be surgically removed in a biopsy, for example, certain types of brain tumors.

[0099] Probe conjugation and assays for amplification and detection of biomarkers

[0100] Microneedles conjugated with probes.

[0101] A plurality of probes can be attached to the microneedle of the present disclosure. In some cases, the probe comprises a polynucleotide (e.g., DNA, RNA, cDNA, cRNA, etc.). The polynucleotide probe is usually designed to bind or hybridize specific polynucleotide biomarkers. The present disclosure also provides methods and devices for detecting peptide or protein biomarkers. In these embodiments, the probe attached to the microneedle can specifically recognize and bind to a target peptide or protein of interest. The probe can be any substance that can bind to a specific peptide or protein biomarker. They can be, for example, a protein (e.g., an antibody, an antigen, or a fragment thereof), a sugar, or a polynucleotide. The polynucleotide can have sequence specificity for a biomarker.

[0102] The probes to be used depend on the one or more biomarkers to be detected. Therefore, depending on the nature and number of biomarkers to be detected, the number of probes immobilized on the microneedles can be 2, 3, 4, 5, 6, 7, 8, 9, 10 or more. In some cases, the total number of probes in the microneedle can be from about 1 probe to about 1,000 probes, from about 1 probe to about 10,000 probes, from about 1 probe to about 100,000 probes, from about 1 probe to about 1,000,000 probes, from about 1 probe to about 10,000,000 probes, from about 1 probe to about 100,000,000 probes, from about 1,000 probes to about 10,000 probes, from about 1,000 probes to about 100,000 probes, from about 1,000 probes to about 1,000,000 probes, from about 1,000 probes to about 10,000,000 probes, from about 1,000 probes to about 10,000,000 probes, from about 1,000 probes to about 10,000,000 probes, from about 10,000 probes to about 1 In some embodiments, the present invention relates to a plurality of probes, such as about 10,000 probes to about 1,000,000 probes, about 10,000 probes to about 10,000,000 probes, about 10,000 probes to about 100,000,000 probes, about 100,000 probes to about 1,000,000 probes, about 100,000 probes to about 10,000,000 probes, about 100,000 probes to about 100,000,000 probes, about 1,000,000 probes to about 10,000,000 probes, about 1,000,000 probes to about 10,000,000 probes, or about 10,000,000 probes to about 100,000,000 probes.

[0103] In some cases, the total number of probes in a microneedle is at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8 ... about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 12000, about 14000, about 16000, about 18000, about 20000, about 30000, about 4000 0, about 50,000, about 60,000, about 70,000, about 80,000, about 90,000, about 100,000, about 200,000, about 300,000, about 400,000, about 500,000, about 600,000, about 700,000, about 800,000, about 900,000, about 1,000,000, about 2,000,000, about 3,000,000, about 4,000,000, about 5,000,000, about 6 , about 7,000,000, about 8,000,000, about 9,000,000, about 10,000,000, about 20,000,000, about 30,000,000, about 40,000,000, about 50,000,000, about 60,000,000, about 70,000,000, about 80,000,000, about 90,000,000 or about 100,000,000 probes.

[0104] In some cases, the total number of probes in a microneedle is less than about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8 ... 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 12000, about 14000, about 16000, about 18000, about 20000, about 30000, about 40000 , about 50,000, about 60,000, about 70,000, about 80,000, about 90,000, about 100,000, about 200,000, about 300,000, about 400,000, about 500,000, about 600,000, about 700,000, about 800,000, about 900,000, about 1,000,000, about 2,000,000, about 3,000,000, about 4,000,000, about 5,000,000, about 6 , about 7,000,000, about 8,000,000, about 9,000,000, about 10,000,000, about 20,000,000, about 30,000,000, about 40,000,000, about 50,000,000, about 60,000,000, about 70,000,000, about 80,000,000, about 90,000,000 or about 100,000,000 probes.

[0105] In addition, as further described herein, probes for biomarkers can be fixed to multiple microneedles in the devices of the present disclosure, particularly for detecting low concentrations of biomarkers. In some cases, a single microneedle contains multiple different probes capable of binding or detecting the same biomarker. In some cases, a single microneedle contains at least two different probes, at least 3 different probes, at least 4 different probes, at least 5 different probes, at least 6 different probes, at least 7 different probes, at least 8 different probes, at least 9 different probes, at least 10 different probes, at least 11 different probes, at least 12 different probes, at least 13 different probes, at least 14 different probes, at least 15 different probes, at least 16 different probes, at least 17 different probes, at least 18 different probes, at least 19 different probes, at least 20 different probes, at least 21 different probes, at least 22 different probes, at least 23 different probes, at least 24 different probes, at least 25 different probes, at least 26 different probes, at least 27 different probes, at least 28 different probes, at least 29 different probes, at least 30 different probes, at least 31 different probes, at least 32 different probes, at least 33 different probes, at least 34 different probes, at least 35 different probes, at least 36 different probes, at least 37 different probes, at least 38 different probes, at least 39 different probes, at least 40 different probes, at least 41 different probes, at least 42 different probes, at least 43 different probes, at least 44 different probes, at least 45 different probes, at least 46 different probes, at least 47 different probes, at least 48 different probes, at least 49 different probes, at least 50 different probes, In some cases, the same microneedle comprises more than 50 different types of probes for the same biomarker.

[0106] In some cases, the same microneedle comprises a plurality of different probes. The different probes can be specific for the same biomarker or for different biomarkers. The microneedle can comprise at least 2 different probes, at least 10 different probes, at least 100 different probes, at least 200 different probes, at least 300 different probes, at least 400 different probes, at least 500 different probes, at least 600 different probes, at least 700 different probes, at least 800 different probes, at least 900 different probes, at least 1,000 different probes, at least 1,100 different probes, at least 1,200 different probes, at least 1,300 different probes, at least 1,400 different probes, at least 1,500 different probes, at least 1,600 different probes, at least 1,700 different probes, at least 1,800 different probes, at least 1,900 different probes, at least 2,000 different probes, at least 2,100 different probes, at least 2,200 different probes, at least 2,300 different probes, at least 2,400 different probes, at least 2,500 different probes, at least 2,600 different probes, at least 2,700 different probes, at least 2,800 different probes, at least 2,900 different probes, at least 3,100 different probes, at least 3,110 different probes, at least 3,120 different probes, at least 3,130 different probes, at least 3,140 different probes, at least 3,150 different probes, at least 3,160 different probes, at least 3,170 different probes, at least 3,180 different probes, at least 3,190 different probes 00 different probes, at least 1,900 different probes, at least 2,000 different probes, at least 2,100 different probes, at least 2,200 different probes, at least 2,300 different probes, at least 2,400 different probes, at least 2,500 different probes, at least 2,600 different probes, at least 2,700 different probes, at least 2,800 different probes, at least 2,900 different probes, at least 3,000 different probes, at least 3,100 different probes, at least 3,200 different probes, at least 3,300 different probes, at least 3,400 different probes, at least 3,500 different probes, at least 3,600 different probes. 00 different probes, at least 3,700 different probes, at least 3,800 different probes, at least 3,900 different probes, at least 4,000 different probes, at least 4,100 different probes, at least 4,200 different probes, at least 4,300 different probes, at least 4,400 different probes, at least 4,500 different probes, at least 4,600 different probes, at least 4,700 different probes, at least 4,800 different probes, at least 4,900 different probes, at least 5,000 different probes, at least 5,100 different probes, at least 5,200 different probes, at least 5,300 different probes, at least 5,400 different probes, at least 5,500 different probes, at least 5,600 different probes, at least 5,700 different probes, at least 5,800 different probes, at least 5,900 different probes, at least 6,000 different probes, at least 6,100 different probes, at least 6,200 different probes, at least 6,300 different probes, at least 6,400 different probes At least 400 different probes, at least 5,500 different probes, at least 5,600 different probes, at least 5,700 different probes, at least 5,800 different probes, at least 5,900 different probes, at least 6,000 different probes, at least 6,100 different probes, at least 6,200 different probes, at least 6,300 different probes, at least 6,400 different probes, at least 6,500 different probes, at least 6,600 different probes, at least 6,700 different probes, at least 6,800 different probes, at least 6,900 different probes, at least 7,000 different probes, at least 7,100 different probes, at least 7,200 different probes, at least 7,300 different probes, at least 7,400 different probes, at least 7,500 different probes, at least 7,600 different probes, at least 7,700 different probes, at least 7,800 different probes, at least 7,900 different probes, at least 8,000 different probes, at least 8,100 different probes, at least 8,200 different probes, at least 7,300 different probes, at least 7,400 different probes, at least 7,500 different probes, at least 7,600 different probes, at least 7,700 different probes, at least 7,800 different probes, at least 7,900 different probes, at least 8,000 different probes, at least 8,100 different probes, at least 8,200 different probes, at least 8,300 different probes, at least 8,400 different probes, at least 8,500 different probes, at least 8,600 different probes, The same probes, at least 8,700 different probes, at least 8,800 different probes, at least 8,900 different probes, at least 9,000 different probes, at least 9,100 different probes, at least 9,200 different probes, at least 9,300 different probes, at least 9,400 different probes, at least 9,500 different probes, at least 9,600 different probes, at least 9,700 different probes, at least 9,800 different probes, at least 9,900 different probes, or at least 10,000 different probes. The microneedles may comprise less than 2 different probes, less than 10 different probes, less than 100 different probes, less than 200 different probes, less than 300 different probes, less than 400 different probes, less than 500 different probes, less than 600 different probes, less than 700 different probes, less than 800 different probes, less than 900 different probes, less than 1,000 different probes, less than 1,100 different probes, less than 1,200 different probes, less than 1,300 different probes, less than 1,400 different probes, less than 1,500 different probes, less than 1,600 different probes, less than 1,700 different probes, less than 1,800 different probes, less than 1,900 different probes, less than 2,000 different probes, less than 2,100 different probes, less than 2,200 different probes, less than 2,300 different probes, less than 2,400 different probes. less than 3,000 different probes, less than 2,500 different probes, less than 2,600 different probes, less than 2,700 different probes, less than 2,800 different probes, less than 2,900 different probes, less than 3,000 different probes, less than 3,100 different probes, less than 3,200 different probes, less than 3,300 different probes, less than 3,400 different probes, less than 3,500 different probes, less than 3,600 different probes, less than 3,700 different probes, less than 3,800 different probes, less than 3,900 different probes, less than 4,000 different probes, less than 4,100 different probes, less than 4,200 different probes, less than 4,300 different probes, less than 4,400 different probes, less than 4,500 different probes, less than 4,600 different probes, less than 4,700 different probes, less than 4,800 different probes, less than 4,900 different probes.800 different probes, less than 4,900 different probes, less than 5,000 different probes, less than 5,100 different probes, less than 5,200 different probes, less than 5,300 different probes, less than 5,400 different probes, less than 5,500 different probes, less than 5,600 different probes, less than 5,700 different probes, less than 5,800 different probes, less than 5,900 different probes, less than 6,000 different probes, less than 6,100 different probes 0 different probes, less than 6,200 different probes, less than 6,300 different probes, less than 6,400 different probes, less than 6,500 different probes, less than 6,600 different probes, less than 6,700 different probes, less than 6,800 different probes, less than 6,900 different probes, less than 7,000 different probes, less than 7,100 different probes, less than 7,200 different probes, less than 7,300 different probes, less than 7,400 different probes less than 7,500 different probes, less than 7,600 different probes, less than 7,700 different probes, less than 7,800 different probes, less than 7,900 different probes, less than 8,000 different probes, less than 8,100 different probes, less than 8,200 different probes, less than 8,300 different probes, less than 8,400 different probes, less than 8,500 different probes, less than 8,600 different probes, less than 8,700 different probes needles, less than 8,800 different probes, less than 8,900 different probes, less than 9,000 different probes, less than 9,100 different probes, less than 9,200 different probes, less than 9,300 different probes, less than 9,400 different probes, less than 9,500 different probes, less than 9,600 different probes, less than 9,700 different probes, less than 9,800 different probes, less than 9,900 different probes, or less than 10,000 different probes. ,

[0107] In some cases, the multiple probes are identical (e.g., identical copies of the same polynucleotide or antibody). In some embodiments, the microneedles can be associated with multiple copies of the same probe (e.g., more than 2, 5, 10, 50, 100, 1000, 5000, 7500, 10000, or 50000 copies of the same probe). For example, the microneedles can contain multiple copies of a polynucleotide probe designed to hybridize to the same polymorphism or biomarker. In some cases, the microneedles can contain multiple copies of an antibody probe designed to bind to the same epitope.

[0108] In some cases, the microneedle comprises a polynucleotide probe. The probe can be designed to detect different biomarkers associated with the same disease, illness or condition. In some cases, the first probe identifies a polymorphism associated with a disease (e.g., DNA polymorphism, RNA polymorphism), while the second probe identifies different polymorphisms associated with the same disease. For example, the first DNA probe on the microneedle can be designed to detect a first polymorphism of an RNA biomarker associated with onchocerciasis (a skin condition). The second DNA probe on the microneedle can be designed to detect a second polymorphism of an RNA biomarker associated with onchocerciasis. The polymorphism can be, for example, a single nucleotide polymorphism (SNP). Genetic and genomic variation can include a single SNP or multiple SNPs. SNP can occur at a single locus or at multiple loci. An individual carrying a specific SNP allele at one locus can predictably carry a specific SNP allele at other loci. The correlation of SNPs can provide association between alleles that make an individual susceptible to a disease or condition. In some cases, different polynucleotide probes are designed to detect different biomarkers associated with different conditions. For example, one probe may detect a biomarker for a disease, while another probe may detect a housekeeping gene or gene product. In some cases, the microneedles are attached to a polynucleotide, a polypeptide, or a mixture of polynucleotides and polypeptides.

[0109] The microneedles can also be associated with multiple different protein or antibody probes. For example, a first antibody probe on a microneedle can be designed to detect a first epitope of an antigen associated with, for example, skin cancer. A second antibody probe can be designed to detect a second epitope associated with the antigen. Alternatively, in some cases, the second antibody probe can detect epitopes associated with different skin conditions.

[0110] In some cases, the present disclosure provides a microneedle device comprising a group of microneedles, wherein each microneedle in the group comprises the same probe or a group of probes. In some embodiments, the same probe is attached to multiple microneedles of the device. The same probe can be attached to, for example, about 1% of the microneedles, about 5% of the microneedles, about 10% of the microneedles, about 15% of the microneedles, about 20% of the microneedles, about 25% of the microneedles, about 30% of the microneedles, about 35% of the microneedles, about 40% of the microneedles, about 45% of the microneedles, about 50% of the microneedles, about 55% of the microneedles, about 60% of the microneedles, about 65% of the microneedles, about 70% of the microneedles, about 75% of the microneedles, about 80% of the microneedles, about 85% of the microneedles, about 90% of the microneedles, about 95% of the microneedles, or about 100% of the microneedles. In some embodiments, the same probe is attached to no more than 5% of the microneedles, no more than 10% of the microneedles, no more than 15% of the microneedles, no more than 20% of the microneedles, no more than 25% of the microneedles, no more than 30% of the microneedles, no more than 35% of the microneedles, no more than 40% of the microneedles, no more than 45% of the microneedles, no more than 50% of the microneedles, no more than 55% of the microneedles, no more than 60% of the microneedles, no more than 70% of the microneedles, no more than 75% of the microneedles, no more than 80% of the microneedles, no more than 85% of the microneedles, no more than 90% of the microneedles, no more than 95% of the microneedles, or no more than 99% of the microneedles.

[0111] In some cases, a group of microneedles may include at least one microneedle attached to a first probe and at least one microneedle attached to a second probe different from the first probe. For example, as described herein, the first probe may be a polynucleotide or polypeptide (e.g., antibody, protein) that specifically binds to a biomarker of a disease or condition, and the second probe may be a polynucleotide or polypeptide that specifically binds to a different biomarker associated with the same disease or condition. In some cases, the first probe may be a polynucleotide or polypeptide (e.g., antibody, protein) that specifically binds to a biomarker of a disease or condition, and the second probe may be a polynucleotide or polypeptide that specifically binds to a different biomarker associated with a different disease, condition, or condition. In some cases, the different diseases, conditions, or conditions are associated with the same organ. For example, the first probe may be associated with a first disease, condition, or condition associated with the skin; and the second probe may be associated with a second disease, condition, or condition associated with the skin or eye. In some cases, the device may include a microneedle array, wherein each microneedle includes a probe that detects a biomarker associated with a different disease, condition, or condition associated with the same organ. The array of microneedles can contain more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 75, 100, 150, 200, 50, or 1000 microneedles associated with different diseases, disorders, or conditions. In some cases, the different diseases, disorders, or conditions are associated with different organs (e.g., more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 organs).

[0112] In some cases, the microneedle device comprises a plurality of microneedle arrays; typically, the plurality of microneedle arrays are suitable for multiple reactions. In some cases, the plurality of arrays comprises two or more microneedle arrays, wherein the arrays are designed to detect different biomarkers. In some cases, the first microneedle array may be designed to detect biomarkers associated with a disease, disorder, or condition, while the second microneedle array is designed to detect different biomarkers associated with the same disease, disorder, or condition. In some cases, the first microneedle array may be designed to detect biomarkers associated with a disease, disorder, or condition, while the second microneedle array may be designed to detect different biomarkers associated with different diseases, disorders, or conditions. In some cases, the first microneedle array may be designed to detect multiple biomarkers associated with a disease, disorder, or condition; and the second microneedle array may be designed to detect multiple biomarkers associated with different diseases, disorders, or conditions. In some cases, the second microneedle array may be designed to detect a control biomarker (e.g., a housekeeping gene), which is a positive control or a negative control.

[0113] In some cases, the methods and devices provided herein can be used to perform multiple reactions with or without fluorescence. For example, each microneedle can be inserted into its own cavity (e.g., pinhole cavity), and the cavity contains unique PCR reagents (e.g., unique probes or primers). PCR reactions can be performed and multiple biomarkers of samples can be analyzed. In some cases, multiple reactions are performed using fluorescently labeled probes or probes that emit different light signals. In some cases, fluorescence is not used.

[0114] The microneedle devices described herein can contain any number of probes; typically, the probes are attached to multiple needles within the device. The probes can be the same or different. In addition, probes for biomarkers can be fixed to multiple microneedles in the device of the present disclosure, particularly for detecting low concentrations of biomarkers. In some cases, the total number of probes in a microneedle device can be from about 1 probe to about 1,000 probes, from about 1 probe to about 10,000 probes, from about 1 probe to about 100,000 probes, from about 1 probe to about 1,000,000 probes, from about 1 probe to about 10,000,000 probes, from about 1 probe to about 100,000,000 probes, from about 1,000 probes to about 10,000 probes, from about 1,000 probes to about 100,000 probes, from about 1,000 probes to about 1,000,000 probes, from about 1,000 probes to about 10,000,000 probes, from about 1,000 probes to about 10,000,000 probes, from about 1,000 probes to about 10,000,000 probes, from about 10,000 probes to about 100,000,000 probes, from about 10,000 probes to about 100,000,000 probes. 100,000 probes, about 10,000 probes to about 1,000,000 probes, about 10,000 probes to about 10,000,000 probes, about 10,000 probes to about 100,000,000 probes, about 100,000 probes to about 1,000,000 probes, about 100,000 probes to about 10,000,000 probes, about 100,000 probes to about 100,000,000 probes, about 1,000,000 probes to about 10,000,000 probes, about 1,000,000 probes to about 100,000,000 probes, or about 10,000,000 probes to about 100,000,000 probes.

[0115] In some cases, the total number of probes in the microneedle device is at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000 , about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 12000, about 14000, about 16000, about 18000, about 20000, about 30000, about 400 00, about 50000, about 60000, about 70000, about 80000, about 90000, about 100000, about 200000, about 300000, about 400000, about 500000, about 600000, about 700000, about 800000, about 900000, about 1,000,000, about 2,000,000, about 3,000,000, about 4,000,000, about 5,000,000, about 6,000,000, about 7,000,000, about 8,000,000, about 9,000,000, about 10,000,000, about 20,000,000, about 30,000,000, about 40,000,000, about 50,000,000, about 60,000,000, about 70,000,000, about 80,000,000, about 90,000,000, or about 100,000,000 probes.

[0116] In some cases, the total number of probes in a microneedle device is less than about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8 ... about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 12000, about 14000, about 16000, about 18000, about 20000, about 30000, about 4000 0, about 50,000, about 60,000, about 70,000, about 80,000, about 90,000, about 100,000, about 200,000, about 300,000, about 400,000, about 500,000, about 600,000, about 700,000, about 800,000, about 900,000, about 1,000,000, about 2,000,000, about 3,000,000, about 4,000,000, about 5,000,000, about 6 , about 7,000,000, about 8,000,000, about 9,000,000, about 10,000,000, about 20,000,000, about 30,000,000, about 40,000,000, about 50,000,000, about 60,000,000, about 70,000,000, about 80,000,000, about 90,000,000 or about 100,000,000 probes.

[0117] In some cases, the microneedle device comprises at least 2 different probes, at least 3 different probes, at least 4 different probes, at least 5 different probes, at least 6 different probes, at least 7 different probes, at least 8 different probes, at least 9 different probes, at least 10 different probes, at least 11 different probes, at least 12 different probes, at least 13 different probes, at least 14 different probes, at least 15 different probes, at least 16 different probes, at least 17 different probes, at least 18 different probes, at least 19 different probes, at least 20 different probes, at least 21 different probes, at least 22 different probes, at least 23 different probes, at least 24 different probes, at least 25 different probes, at least 26 different probes, at least 27 different probes, at least 28 different probes, at least 29 different probes, at least 30 different probes, at least 31 different probes, at least 32 different probes, at least 33 different probes, at least 34 different probes, at least 35 different probes, at least 36 different probes, at least 37 different probes, at least 38 different probes, at least 39 different probes, at least 40 different probes, at least 41 different probes, at least 42 different probes, at least 43 different probes, at least 44 different probes, at least 45 different probes, at least 46 different probes, at least 47 different probes, at least 48 different probes, at least 49 different probes, at least 50 different probes, at least 51 different probes, In some cases, the same microneedle comprises more than 50 different types of probes for the same biomarker.

[0118] In some cases, the microneedle device comprises a plurality of different probes. The different probes can be specific for the same biomarker or for different biomarkers. The microneedle device can comprise at least 2 different probes, at least 10 different probes, at least 100 different probes, at least 200 different probes, at least 300 different probes, at least 400 different probes, at least 500 different probes, at least 600 different probes, at least 700 different probes, at least 800 different probes, at least 900 different probes, at least 1,000 different probes, at least 1,100 different probes, at least 1,200 different probes, at least 1,300 different probes, at least 1,400 different probes, at least 1,500 different probes, at least 1,600 different probes, at least 1,700 different probes, at least 1, At least 800 different probes, at least 1,900 different probes, at least 2,000 different probes, at least 2,100 different probes, at least 2,200 different probes, at least 2,300 different probes, at least 2,400 different probes, at least 2,500 different probes, at least 2,600 different probes, at least 2,700 different probes, at least 2,800 different probes, at least 2,900 different probes, at least 3,000 different probes, at least 3,100 different probes, at least 3,200 different probes, at least 3,300 different probes, at least 3,400 different probes, at least 3,500 different probes, at least 3,600 different probes, at least 3,700 different probes, at least 3,800 different probes, at least 3,900 different probes, at least 4,000 different probes, at least 4,100 different probes, at least 4,200 different probes, at least 4,300 different probes, at least 4,400 different probes, at least 4,500 different probes, at least 4,600 different probes. At least 600 different probes, at least 3,700 different probes, at least 3,800 different probes, at least 3,900 different probes, at least 4,000 different probes, at least 4,100 different probes, at least 4,200 different probes, at least 4,300 different probes, at least 4,400 different probes, at least 4,500 different probes, at least 4,600 different probes, at least 4,700 different probes, at least 4,800 different probes, at least 4,900 different probes, at least 5,000 different probes, at least 5,100 different probes, at least 5,200 different probes, at least 5,300 different probes, at least 5,400 different probes, at least 5,500 different probes, at least 5,600 different probes, at least 5,700 different probes, at least 5,800 different probes, at least 5,900 different probes, at least 6,000 different probes, at least 6,100 different probes, at least 6,200 different probes, at least 6,300 different probes, at least 6,400 different probes At least 400 different probes, at least 5,500 different probes, at least 5,600 different probes, at least 5,700 different probes, at least 5,800 different probes, at least 5,900 different probes, at least 6,000 different probes, at least 6,100 different probes, at least 6,200 different probes, at least 6,300 different probes, at least 6,400 different probes, at least 6,500 different probes, at least 6,600 different probes, at least 6,700 different probes, at least 6,800 different probes, at least 6,900 different probes, at least 7,000 different probes, at least 7,100 different probes, at least 7,200 different probes, at least 7,300 different probes, at least 7,400 different probes, at least 7,500 different probes, at least 7,600 different probes, at least 7,700 different probes, at least 7,800 different probes, at least 7,900 different probes, at least 8,000 different probes, at least 8,100 different probes, at least 8,200 different probes, at least 7,300 different probes, at least 7,400 different probes, at least 7,500 different probes, at least 7,600 different probes, at least 7,700 different probes, at least 7,800 different probes, at least 7,900 different probes, at least 8,000 different probes, at least 8,100 different probes, at least 8,200 different probes, at least 8,300 different probes, at least 8,400 different probes, at least 8,500 different probes, at least 8,600 different probes, The same probes, at least 8,700 different probes, at least 8,800 different probes, at least 8,900 different probes, at least 9,000 different probes, at least 9,100 different probes, at least 9,200 different probes, at least 9,300 different probes, at least 9,400 different probes, at least 9,500 different probes, at least 9,600 different probes, at least 9,700 different probes, at least 9,800 different probes, at least 9,900 different probes, or at least 10,000 different probes. In some cases, the microneedle device can include less than 2 different probes, less than 10 different probes, less than 100 different probes, less than 200 different probes, less than 300 different probes, less than 400 different probes, less than 500 different probes, less than 600 different probes, less than 700 different probes, less than 800 different probes, less than 900 different probes, less than 1,000 different probes, less than 1,100 different probes, less than 1,200 different probes, less than 1,300 different probes, less than 1,400 different probes, less than 1,500 different probes, less than 1,600 different probes, less than 1,700 different probes, less than 1,800 different probes, less than 1,900 different probes, less than 2,000 different probes, less than 2,100 different probes, less than 2,200 different probes, less than 2,300 different probes, or more. different probes, less than 2,400 different probes, less than 2,500 different probes, less than 2,600 different probes, less than 2,700 different probes, less than 2,800 different probes, less than 2,900 different probes, less than 3,000 different probes, less than 3,100 different probes, less than 3,200 different probes, less than 3,300 different probes, less than 3,400 different probes, less than 3,500 different probes, less than 3,600 different probes, less than 3,700 different probes, less than 3,800 different probes, less than 3,900 different probes, less than 4,000 different probes, less than 4,100 different probes, less than 4,200 different probes, less than 4,300 different probes, less than 4,400 different probes, less than 4,500 different probes, less than 4,600 different probes, less than 4,700 different probes, less than 4,800 different probes, less than 4,900 different probes, less than 5,000 different probes, less than 5,100 different probes, less than 5,200 different probes, less than 5,300 different probes, less than 5,400 different probes, less than 5,500 different probes, less than 5,600 different probes, less than 5,700 different probes, less than 5,800 different probes, less than 5,900 different probes, less than 6,000 different probes less than 6,100 different probes, less than 6,200 different probes, less than 6,300 different probes, less than 6,400 different probes, less than 6,500 different probes, less than 6,600 different probes, less than 6,700 different probes, less than 6,800 different probes, less than 6,900 different probes, less than 7,000 different probes, less than 7,100 different probes, less than 7,200 different probes, less than 7,300 different probes, less than 7,400 different probes, less than 7,500 different probes, less than 7,600 different probes, less than 7,700 different probes, less than 7,800 different probes, less than 7,900 different probes, less than 8,000 different probes, less than 8,100 different probes, less than 8,200 different probes, less than 8,300 different probes, less than 8,400 different probes, less than 8,500 different probes, less than 8,600 different probes, less than 8,700 different probes, less than 8,800 different probes, less than 8,900 different probes, less than 9,000 different probes, less than 9,100 different probes, less than 9,200 different probes, less than 9,300 different probes, less than 9,400 different probes, less than 9,500 different probes, less than 9,600 different probes, less than 9,700 different probes, less than 9,800 different probes, less than 9,900 different probes, or less than 10,000 different probes. ,

[0119] Probes for detecting different biomarkers can be obtained commercially or synthesized according to methods known in the art. The probe can be designed according to any suitable method. For example, a computerized search program can be used to design a nucleic acid probe specific for a target biomarker sequence (e.g., mRNA) with minimal cross-hybridization and similar hybridization efficiency. Such exemplary programs include Oligo 5.0 (National Biosciences Inc.), Primer 3 (MIT), and ArrayDesigner (Telechem International Inc.). The nucleotide probe used in the present method can have any suitable length, such as about 15 to about 100 nucleotides. For protein biomarkers, specific probes (antibodies) for detecting biomarkers can be easily generated or commercially obtained. The nucleotide probes or polypeptide probes used in the present method can include a detectable label. Any suitable label can be used. For example, a detectable label can be detected by light, magnetism, machinery, spectroscopy, photochemistry, biochemistry, immunochemistry, radioactivity, or enzyme means. In some embodiments, the detectable label is a fluorescent or chemiluminescent label, such as GFP; a magnetic moiety; a protein, such as avidin, streptavidin; or a peptide tag, such as a histidine tag or a FLAG tag.

[0120] The fixed probe is present on the surface of the microneedle device described herein. The fixed probe can be covalently or non-covalently bound to the surface of the microneedle by methods known in the art or by specific connection methods described in the embodiments herein. For example, the probe can be conjugated to the microneedle via, for example, biotin-avidin or biotin-streptavidin interactions, protein A interactions, protein G interactions, goat anti-mouse Fc interactions, amide bonds, or by any other covalent or non-covalent interactions. The probe can be covalently attached to the microneedle with or without a suitable spacer element such as poly (ethylene glycol) (PEG) between the probe and the microneedle surface. In the implementation of the present invention, the method for fixing antibody probes or nucleotide probes conventionally implemented in the art can be easily adopted and appropriately modified. These methods are described in the art, for example, Mendoza et al., Biotechniques 27:778-786, 1999; Arenkov et al., Anal. Biochem. 278:123-131, 2000; Zhu et al., Nat. Genet. 26:283-289, 2000; MacBeath et al., Science 289:1760-1763, 2000; Jyoung et al., Biosens. Bioelectron. 21:2315-2319, 2006; Lu et al., Anal. Chem. 67:83 87, 1995; Vijayendran et al., Anal. Chem. 73: 471-480, 2001; Nakanishi et al., Anal. Chem. 68: 1695-1700, 1996; Rowe et al., Anal. Chem. 71: 433-439, 1999; Day et al., Bichem. J. 278: 735-740, 1991; Fodor et al., Science 251: 767-773, 1991; Schene et al., Science 270: 467-470, 1995; Lamture et al., Nucl. Acids Res. 22:2121-2125, 1994; Guo et al., Nucl. Acids Res. 22:5456-5465, 1994; and PCT publications WO00 / 22108, WO01 / 75447, and WO02 / 12891.

[0121] The probe can also be modified with a reactive moiety and attached to the gold-coated surface of one or more microneedles. The reactive moiety can be a sulfhydryl group. In some cases, an inorganic salt can be added. Examples of inorganic salts include, but are not limited to, lithium salts, potassium salts, sodium salts, magnesium salts, and calcium salts that typically have halogen counterions. In some cases, the inorganic salt is sodium chloride. The inorganic salt can be present in a concentration of preferably about 0.1M to 2.0M, about 0.2M to 2.0M, about 0.2M to 1.5M, or about 0.5M to 1.5M. In some cases, the concentration of the inorganic salt is less than about 0.1 M, less than about 0.2 M, less than about 0.2 M, less than about 0.3 M, less than about 0.4 M, less than about 0.5 M, less than about 1.0 M, less than about 1.1 M, less than about 1.2 M, less than about 1.3 M, less than about 1.4 M, less than about 1.5 M, less than about 1.6 M, less than about 1.7 M, less than about 1.8 M, less than about 1.9 M, less than about 2.0 M, less than about 2.5 M, less than about 3.0 M, less than about 3.5 M, less than about 4.0 M, or less than about 4.5 M. In some cases, the concentration of the inorganic salt is greater than about 0.1 M, greater than about 0.2 M, greater than about 0.2 M, greater than about 0.3 M, greater than about 0.4 M, greater than about 0.5 M, greater than about 1.0 M, greater than about 1.1 M, greater than about 1.2 M, greater than about 1.3 M, greater than about 1.4 M, greater than about 1.5 M, greater than about 1.6 M, greater than about 1.7 M, greater than about 1.8 M, greater than about 1.9 M, greater than about 2.0 M, greater than about 2.5 M, greater than about 3.0 M, greater than about 3.5 M, greater than about 4.0 M, or greater than about 4.5 M.

[0122] Capturing biomarkers

[0123] Microneedles covalently or non-covalently attached to the probe can be inserted into biological samples in situ, such as human skin, eyes, tissues in surgery, dermal capillaries, etc. Covalently attached to the probe microneedles can also be inserted into ex vivo biological samples, such as tissues extracted during a biopsy. The probe can be hybridized or combined with a biomarker under the physiological conditions of the biological sample for a specific period of time. A temperature range of about 20 to about 40 degrees Celsius, 1 atmosphere, pH 6-8, 1-20mM glucose concentration, atmospheric oxygen concentration, and earth gravity can be examples of physiological conditions for most subjects. The probe can be hybridized or combined with the biological sample for at least 1 minute, at least 2 minutes, at least 3 minutes, at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, at least 25 minutes, at least 30 minutes, at least 45 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 5 hours, at least 10 hours, or at least 24 hours. In some embodiments, the probe can be hybridized to the biological sample for no more than 1 minute, no more than 2 minutes, no more than 3 minutes, no more than 5 minutes, no more than 10 minutes, no more than 15 minutes, no more than 20 minutes, no more than 25 minutes, no more than 30 minutes, no more than 1 hour, no more than 2 hours, no more than 3 hours, no more than 5 hours, or no more than 10 hours. The microneedles with covalently or non-covalently attached probes can be removed from a biological sample such as human skin. The biomarkers hybridized or bound to the probes can be separated from the biological sample by removing the microneedles from the human skin.

[0124] Detection of biomarkers

[0125] Some embodiments of the present invention relate to detecting polynucleotide biomarkers (e.g., mRNA, DNA). In these embodiments, probes (e.g., oligonucleotide probes, polynucleotide probes) for one or more biomarkers can be easily synthesized based on the sequence of the target biomarker. Once the nucleic acid biomarkers are combined with the probes on the microneedle device of the present invention, they are usually subjected to an amplification reaction (e.g., PCR, reverse transcription PCR) or detected by a labeled label. The labeled label can be directly connected to the probe attached to the microneedle, or in some cases, the labeled label is combined with the biomarker after it has been captured by the probe attached to the microneedle.

[0126] Many methods routinely implemented in the art can be easily used to amplify nucleic acid biomarkers obtained from a subject. These methods include, for example, polymerase chain reaction (PCR) or reverse transcription PCR. See generally PCR Technology: Principles and Applications for DNA Amplification (HA Erlich, Freeman Press, NY, NY, 1992); PCR Protocols: A Guide to Methods and Applications (Innis et al., Academic Press, San Diego, CA, 1990); Mattila et al., Nucleic Acids Res. 19, 4967 (1991); Eckert et al., PCR Methods and Applications 1, 17 (1991); PCR (McPherson et al., IRL Press, Oxford); and U.S. Patent No. 4,683,202 (each of which is incorporated by reference for all purposes). Other suitable amplification methods include ligase chain reaction (LCR) (see Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1173 (1989)), and self-maintained sequence replication (Guatelli et al., Proc. Nat. Acad. Sci. USA, 87, 1874 (1990)) and nucleic acid-based sequence amplification (NASBA). The latter two amplification methods involve isothermal reactions based on isothermal transcription, which produce single-stranded RNA (ssRNA) and double-stranded DNA (dsDNA) as amplification products at a ratio of about 30 or 100: 1, respectively. Once amplified, the identity of the captured biomarker can then be easily confirmed by standard techniques such as sequence analysis, electrophoresis, etc.

[0127] Some embodiments of the present invention use PCR to detect biomarkers that are hybridized or otherwise connected to the probe. The amplification of biomarkers by PCR can span several orders of magnitude, sometimes starting from a single or several copies of the target and producing thousands to millions of copies of a specific DNA sequence. PCR can use thermal cycling, which includes repeated heating and cooling cycles of the reaction for DNA melting and enzymatic replication of DNA. These thermal cycling operations can physically separate the two chains in the DNA double helix at high temperatures in a process known as DNA melting. At lower temperatures, each chain can then be used as a template in the DNA synthesis performed by DNA polymerase to selectively amplify the target DNA. The selectivity of PCR may be caused by using primers (short DNA fragments) complementary to the DNA region to be amplified under specific thermal cycling conditions.

[0128] Primers containing sequences complementary to the biomarker of interest can be used together with DNA polymerase to achieve selective and repetitive amplification. As PCR proceeds, the generated DNA can be used as a template for replication, initiating a chain reaction in which the DNA template is exponentially amplified. PCR applications can employ thermostable DNA polymerases, such as Taq polymerase, an enzyme originally isolated from the bacterium Thermus aquaticus. This DNA polymerase can enzymatically assemble new DNA chains from nucleotides, for example by using single-stranded DNA as a template and initiating DNA synthesis using DNA oligonucleotides (also referred to as DNA primers).

[0129] The PCR reaction can be performed directly on the microneedle inserted into the biological sample. For example, the microneedle can be placed in a tube containing the reagents required for the PCR reaction or between two plates (such as a glass slide). Biomarkers can be detached from the needle and released into the PCR tube by a variety of different methods. For example, the microneedle can be heated to release the biomarker from the microneedle, or the biomarker can be spontaneously released from the needle into the PCR solution. The PCR reaction can be performed as described above, and standard procedures such as electrophoresis, real-time PCR and other procedures can be used, such as PCR Technology: Principles and Applications for DNA Amplification (HA Erlich, Freeman Press, NY, NY, 1992), PCR Protocols: A Guide to Methods and Applications (Innis et al., Academic Press, San Diego, CA, 1990) described in the program, to analyze the PCR product. Different PCR methods can be used to analyze the sample, such as standard PCR methods and real-time PCR methods. Real-time PCR (RT-PCR) is a laboratory technique based on PCR that can be used to amplify and simultaneously quantify targeted DNA molecules. Real-time PCR can be combined with reverse transcription to quantify messenger RNA and non-coding RNA in cells or tissues.

[0130] In some embodiments, the device of the present disclosure may be further configured to include at least one compartment capable of performing a PCR reaction. For example, the device of the present disclosure may be configured to include a plurality of microneedles or a microneedle array and a compartment capable of performing a PCR reaction therein.

[0131] The PCR reaction can selectively amplify a biomarker that has been hybridized to a specific microneedle, or the PCR reaction can amplify a set of biomarkers that have been hybridized to multiple microneedles. For example, 402 shows the surface of a device of the present invention containing multiple microneedles that have been contacted with a biological sample. Each "square" in 402 shows a single microneedle, where each individual microneedle contains at least one probe. Each probe in 402 can be hybridized or not hybridized to a biomarker. Each microneedle shown in 402 can be placed in a separate PCR tube and each PCR product can be analyzed separately. Alternatively, the multiple microneedles shown in 402 can be placed in the same PCR tube for simultaneous analysis.

[0132] In some cases, the captured biomarker can be detected by using a labeled probe that can bind to the captured biomarker. In some cases, the labeled probe binds to the biomarker after the biomarker has been captured by a probe attached to a microneedle as described herein. In some cases, the microneedle is directly attached to the probe, which is labeled with a label designed to change its optical signal (or reduce or increase the intensity) when bound to the biomarker.

[0133] The labeled probe may include a label (e.g., a fluorophore, a radioisotope, etc.) that can emit a light signal. The fluorescent moiety can be a fluorescent protein, such as green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP) or a variant thereof. In some cases, the labeled probe includes a label that increases or decreases the light signal when the probe is bound to its target. The fluorescent moiety can be an RNA aptamer combined with a fluorophore. The RNA-fluorophore complex can emit a light signal across the visible spectrum, see Paige et al., Science 333, 6042 (2011). For example, a "Spinach aptamer sequence" is an RNA mimic of a GFP that can be configured to emit a fluorescent light signal when hybridized with a biomarker.

[0134] In some embodiments, a microneedle comprising a set of probes non-covalently or covalently bound therein can be used to detect biomarkers in a subject. For example, the device of the present disclosure can be in contact with the skin of the subject. The device can include a polynucleotide probe containing an RNA-fluorophore portion. The RNA-fluorophore portion can be configured to emit a light signal, such as a fluorescent signal, when hybridized with a biomarker of interest.

[0135] Protein or peptide biomarkers can be detected and quantified by any of the many methods known to those skilled in the art for polypeptide detection. These methods include assay formats such as protein PCR and ELISA. Both local and systemic protein and peptide biomarkers can be measured using the microneedle array device of the present invention. Other methods suitable for this purpose include analytical biochemical methods such as electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), superdiffusion chromatography, mass spectrometry, etc., or various other immunological methods such as fluid or gel precipitin reaction, immunodiffusion (single or double), immunohistochemistry, affinity chromatography, immunoelectrophoresis, radioimmunoassay (RIA), immunofluorescence assay, Western blotting, dipstick, etc. For a general review of immunoassays, see Methods in Cell Biology, Vol. 37: Antibodies in Cell Biology, Asai, ed. Academic Press, Inc. New York (1993); Basic and Clinical Immunology, 7th ed., Stites and Terr, eds. (1991); IMMUNOASSAYS FOR THE 80s. Voller, A. et al. (eds.), Baltimore: University Park Press (1981); Maggio et al., ENZYME-IMMUNOASSAY, Boca Raton: CRC Press pp 172-176 (1980) and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology: Practice and Theory of Immunoassays, vol 15, Elsevier 1985. Reagents for conducting these assays associated with any specific protein or peptide biomarker (eg, antibodies) are readily available from commercial sources or produced by standard and routinely practiced techniques (eg, hybridoma technology for the production of monoclonal antibodies).

[0136] The binding interaction between the probe and the biomarker can be detected using a second detection reagent such as a second antibody. For example, "sandwich ELISA" can be used to detect the binding of a biomarker to an antibody probe. The binding of a biomarker to a probe can be detected using a detection antibody specific for different epitopes of the biomarker. The antibody used in the detection can be an isotype different from the antibody used as a probe, for example, the antibody probe can be an IgG antibody (including any subtype thereof, such as IgG1, IgG2, IgG3 and IgG4), and the second antibody can be IgA, IgM. The detection antibody can be conjugated, for example, with a detectable label such as a fluorescent moiety or a radioactive label. Antibody-based detection methods, such as enzyme-linked immunosorbent assay (ELISA) methods, can be used to detect the binding of a probe to a biomarker.

[0137] Protein and peptide biomarkers can also be determined using protein PCR technology. For example, in these applications, a suitable assay for detecting biomarkers is the PCR-ELISA protocol. The assay uses standard immunoassay procedures. Capture antibodies are attached to the surface of the microneedles of the device. Instead of using a reporter enzyme to develop the assay signal, a secondary antibody is fused to a single-stranded oligonucleotide that can then be amplified using PCR. After the biomarker is inserted and captured, the presence of the biomarker can be detected by adding an oligonucleotide-labeled secondary antibody and subsequent PCR analysis of the conjugated label.

[0138] Diagnostic applications and related kits

[0139] The devices and methods described herein can be used to detect and capture biomarkers in a variety of diagnostic applications. These applications include, for example, the diagnosis of skin diseases, the detection of circulating genetic markers, and the detection of protein or peptide biomarkers. As an example, the device can be conveniently used for the diagnosis of CMM in subjects suspected of having cutaneous malignant melanoma (CMM) or being at risk of developing CMM. In these applications, probes for CMM-specific biomarkers can be coupled with microneedles. Then, a device containing one or more probe-conjugated microneedles can be directly applied to all moles (nevels) on the subject's skin. The device is removed from each mole, and any biomarker captured by the microneedle is subsequently determined in situ on the device or after separation from the device. The device disclosed herein can be used clinically for diagnostic and prognostic applications.

[0140] As another specific application, the devices and methods described herein are used for edge detection during skin cancer excision. In these embodiments, the devices comprise probe-conjugated microneedles of varying lengths. Detection and determination of tumor-specific biomarkers using these devices can inform surgeons about the extent of tumor invasion into the skin, subcutaneous, and subcutaneous spaces. These applications avoid the repeated histopathological examinations currently required to determine margins in skin tumor excisions. In some cases, the method does not include a biopsy of the skin.

[0141] The methods and devices of the present invention can be used for diagnosis and / or treatment of skin conditions. The methods may include contacting a microneedle with skin tissue of a subject. The skin condition can be a benign condition, a pre-malignant condition, or a malignant condition. The skin condition can be a healthy condition. Non-limiting examples of skin conditions include: skin cancers such as melanoma and Mohs skin cancer; onchocerciasis; lupus; rubeola (measles); hemangioma; psoriasis; rosacea; seborrheic eczema; urticaria, vitiligo; warts; necrotizing fasciitis; cutaneous candidiasis; carbuncle; cellulitis; hypohidrosis; impetigo; cutis laxa; decubitus ulcers; erysipelas; dyshidrotic eczema; recurrent mouth ulcers; nevus; herpetic stomatitis; ichthyosis vulgaris; acne; cold blisters; dermatomyositis; molluscum contagiosum; acrodermatitis; sebaceous cysts; seborrheic keratoses; pilonidal sinus; keloids; lichen planus; actinic keratoses; stasis dermatitis; cutaneous corns and calluses; eczema; tinea versicolor; pemphigoid; ulcers; or herpes zoster. The methods and devices of the present invention can be used to diagnose and treat a variety of eye conditions, such as uveitis, dry eye, retinal diseases, glaucoma, inflammatory diseases. The devices of the present invention can be used to stage cancer. Cancer can be staged as stage 0, stage I, stage II, stage III, or stage IV.

[0142] The methods and devices of the present invention can also be used to diagnose and / or treat eye conditions, such as corneal surface inflammation, uveitis, or dry eye. These methods may include contacting the microneedle with an eye tissue of a subject, for example, by contacting the subconjunctival space. The eye condition can be a benign condition, a pre-malignant condition, or a malignant condition. The eye condition can be a health condition. Non-limiting examples of eye conditions include: retinoblastoma; cutaneous or intraocular (ocular) melanoma; retinitis pigmentosa (RP); diabetic retinopathy; glaucoma (including open-angle glaucoma (e.g., primary open-angle glaucoma), angle-closure glaucoma, and secondary glaucoma (e.g., pigmentary glaucoma, pseudoexfoliative glaucoma, and glaucoma caused by trauma and inflammatory diseases)), retinal detachment, age-related or other maculopathy, age-related macular degeneration, photoretinopathy, surgically induced retinopathy, toxic retinopathy, retinopathy of prematurity, retinopathy caused by trauma or penetrating injury to the eye, inherited retinal degeneration, surgically induced retinopathy, toxic retinopathy, retinopathy caused by trauma or penetrating injury to the eye. Specific examples of genetic conditions of interest include, but are not necessarily limited to, Bardet-Biedl syndrome, congenital amaurosis, cone or cone-rod dystrophy, congenital stationary night blindness, macular degeneration, optic atrophy, syndromic or systemic retinopathy, and Usher syndrome.

[0143] The methods and devices of the present invention can be used to monitor the expression of biomarkers during surgical procedures or during cosmetic procedures. The devices and methods disclosed herein can be used, for example, to perform biopsies of delicate tissues such as eye tissue or brain tissue. In some cases, the microneedle device can be contacted with a tissue or biological sample from a subject during an intraoperative procedure. The tissue or biological sample can be obtained from an organ selected from the brain, heart, breast, liver, pancreas, spleen, bladder, stomach, lung, uterus, cervix, prostate, kidney, intestine, appendix, and colon. In further cases, the microneedle can be contacted with the edge of a tumor before or after the tumor is removed from the subject.

[0144] As a further example of the diagnostic application of the present invention, the methods and devices described herein can be used for the detection of systemic and circulating genetic biomarkers in a subject's body fluid (e.g., bloodstream). Many diseases (e.g., Down syndrome) are known to have genetic (e.g., mRNA) biomarkers that circulate in the blood. By extending the length of the microneedles in the device of the present invention, probes for biomarkers can be specifically bound to such biomarkers by piercing and reaching the dermis or subcutaneous capillaries. Any other nucleic acid biomarkers known to be present in the blood can also be detected in a similar manner. For example, the microneedles on the device of the present invention can penetrate the subject's skin in situ and contact the subject's dermal capillaries. The dermal capillaries may be the smallest blood vessels in the subject's body, and the endothelial lining of the dermal capillaries may be about the thickness of one layer of cells. When the device of the present invention is in contact with the subject's skin, the device can penetrate the membrane of one or more dermal capillaries. In some embodiments, the device of the present invention can be used to detect biomarkers circulating in the bloodstream without removing a blood sample from the subject. In some cases, the devices of the present disclosure can detect fetal or maternal biomarkers of a condition, including biomarkers associated with pregnancy. In some cases, the devices of the present disclosure can detect biomarkers circulating in the bloodstream, such as proteins, hormones, vitamins, cofactors, or polynucleotides.

[0145] Non-limiting examples of genetic conditions that can be diagnosed based on polynucleotide biomarkers using the methods and devices of the present invention include: cystic fibrosis, Duchenne muscular dystrophy, hemochromatosis, Tay-Sachs disease, Prader-Willi syndrome, Angelman syndrome, neurofibromatosis, phenylketonuria, Canavan disease, celiac disease, acid beta-glucosidase deficiency, Gaucher disease, Xia-Ma- Figure 3Charcot–Marie–Tooth disease, color blindness, Cri du chat, polycystic kidney disease, craniosynostosis, familial adenomatous polyposis, adrenal gland disorders, amyotrophic lateral sclerosis (ALS), Alzheimer disease, Parkinson disease, anemia, ataxia, ataxia telangiectasia, autism, bone marrow disorders, Bonnevie-Ullrich syndrome, brain disorders, von Hippel-Lindau disease, congenital heart disease, Crohn's disease, dementia, myotonic dystrophy, Fabry disease, fragile X syndrome, galactosemia, hereditary emphysema, retinoblastoma, Pendred syndrome syndrome), Usher syndrome, Wilson disease, neuropathy, Huntington disease, immune system disorders, gout, X-linked spinal-bulbar muscular atrophy, learning disabilities, Li-Fraumeni syndrome, lipase D deficiency, Lou Gehrig's disease, Marfan syndrome, metabolic disorders, Niemann-Pick, Noonan syndrome, osteogenesis imperfecta, Peutz-Jeghers syndrome, Pfeiffer syndrome, porphyria, progeria, Rett syndrome, tuberous sclerosis, speech and communication disorders, spinal muscular atrophy, Treacher Collins syndrome, trisomy and monosomy.

[0146] In some cases, the probes of the present invention can be used to detect the status of the immune system. The devices of the present invention can be used for allergy detection to confirm or exclude allergies. In some cases, the devices of the present invention can be used to analyze allergy panels. Non-limiting examples of immune disorders include HIV, diabetes, Parkinson's disease, Alzheimer's disease, rheumatoid arthritis, lupus, cancer, multiple sclerosis, inflammatory bowel disease, psoriasis, scleroderma, autoimmune thyroid disease, vasculitis, pernicious anemia, severe combined immunodeficiency (SCID), DiGeorge syndrome, hyperimmunoglobulin E syndrome, common variable immunodeficiency, chronic granulomatous disease, Wiskott-Aldrich syndrome, autoimmune lymphoproliferative syndrome (ALPS), hyper-IgM syndrome, leukocyte adhesion deficiency (LAD), NF-κB essential modulator (NEMO) disorder, selective immunoglobulin A deficiency, X-linked agammaglobulinemia, X-linked lymphoproliferative disease, ataxia-telangiectasia, seasonal allergies, mastocytosis, perennial allergies, anaphylaxis, food allergies, allergic rhinitis, and atopic dermatitis.

[0147] In some embodiments, the devices and methods of the present invention can be used to diagnose a variety of biomarkers associated with a variety of cancers. Non-limiting examples of cancer can include: acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphomas, anal cancer, appendix cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain tumors such as cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumor, visual pathway and hypothalamic glioma, breast cancer, bronchial adenoma, Burkitt's lymphoma, carcinoma of unknown primary origin, central nervous system lymphoma, cerebellar astrocytoma , cervical cancer, childhood cancer, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing sarcoma, germ cell tumors, gallbladder cancer, stomach cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, gliomas, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell carcinoma, Kaposi sarcoma, kidney cancer, laryngeal cancer, lip and oral cancer, liposarcoma, liver cancer, lung cancer such as non-small cell and small cell Lung cancer, lymphoma, leukemia, macroglobulinemia, bone deterioration fibrous histiocytoma / osteosarcoma, medulloblastoma, melanoma, mesothelioma, occult primary metastatic squamous neck cancer, oral cancer, multiple endocrine neoplasms syndrome, myelodysplastic syndrome, myeloid leukemia, nasal and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin's lymphoma, non-small cell lung cancer, oral cancer, oropharyngeal cancer, osteosarcoma / malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, pancreatic cancer islet cells, paranasal sinus and nasal cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma tumor, pineal astrocytoma, pineal germ cell tumor, pituitary adenoma, pleuropulmonary blastoma, plasma cell tumor, primary central nervous system lymphoma, prostate cancer, colorectal cancer, renal cell carcinoma, transitional cell carcinoma of the renal pelvis and ureter, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, skin cancer, skin cancer Merkel cell, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, gastric cancer, T-cell lymphoma, laryngeal cancer, thymoma, thymic cancer, thyroid cancer, trophoblastic tumor (pregnancy), cancer of unknown primary site, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom's macroglobulinemia ( macroglobulinemia and Wilms tumor.

[0148] The device of the present disclosure can be used for independent diagnostic methods, or as a companion diagnostic to provide information about therapeutic treatment. The microneedles and methods of the present disclosure provide minimally invasive, rapid and accurate diagnostic methods and treatment methods. In addition, the devices and methods disclosed herein can provide portable, painless and affordable diagnosis to multiple subjects. The subject of the present invention can be of any age, including, for example, elderly adults, adults, teenagers, pre-adolescents, children, toddlers and infants. The subject of the present invention can be a mammal, a bird, a fish, a reptile or an amphibian. Non-limiting examples of subjects include humans, primates, dogs, cats, horses, pigs and mice.

[0149] The subject can provide multiple biological samples for analysis using the microneedles of the present invention. The analysis of the biological samples of the subject can be performed in situ or ex vivo. For example, in situ analysis may include contacting the microneedles of the present invention directly with the skin of the subject. Ex vivo analysis may include contacting the microneedles of the present invention with biopsy tissue. In some embodiments, the biomarker analysis performed using the microneedles and methods of the present invention requires about 1 mg, about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 7 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg or about 100 mg of biological sample.

[0150] In some embodiments, the methods and microneedles of the present invention require no more than about 1 mg to about 5 mg, no more than about 1 mg to about 10 mg, no more than about 1 mg to about 20 mg, no more than about 1 mg to about 30 mg, no more than about 1 mg to about 40 mg, no more than about 1 mg to about 50 mg, no more than about 50 mg to about 60 mg, no more than about 50 mg to about 70 mg, no more than about 50 mg to about 80 mg, no more than about 50 mg to about 90 mg, no more than about 50 mg to about 100 mg, no more than about 100 mg to about 1 g, no more than about 100 mg to about 2 g, or no more than about 100 mg to about 30 g. 00 mg to about 3 g, no more than about 100 mg to about 4 g, no more than about 100 mg to about 5 g, no more than about 100 mg to about 6 g, no more than about 100 mg to about 7 g, no more than about 100 mg to about 8 g, no more than about 100 mg to about 9 g, no more than about 100 mg to about 10 g, no more than about 1 g to about 2 g, no more than about 1 g to about 3 g, no more than about 1 g to about 4 g, no more than about 1 g to about 5 g, no more than about 1 g to about 6 g, no more than about 1 g to about 7 g, no more than about 1 g to about 8 g, no more than about 1 g to about 9 g, or no more than about 1 g to about 10 g of the biological sample.

[0151] In some embodiments, additional assays are used to validate the diagnosis made based on the identification of biomarkers identified using the microneedles and methods of the present disclosure. Non-limiting examples of assays that can validate biomarkers include: a) assays that assess the interaction of proteins with DNA, such as DNA enzyme footprinting assays and gel shift assays; b) assays that assess the integrity of RNA molecules, such as nuclear ligation assays; c) endpoint assays that can quantitatively or qualitatively measure the final result of the assay; d) kinetic assays that can assess the reading of data points at multiple time intervals and compare the kinetics of biological processes; e) semi-quantitative assays that provide a readout that can be quantified in a certain context, such as Western blotting, coagulation and agglutination assays; f) immunoassays that assess the response of antigen-antibody binding reactions; g) enzyme activity assays that test function and activity; h) colony formation assays that can test the ability of cells to proliferate and differentiate; i) counting assays, such as flow cytometry assays; and j) multiple PCR assays, such as real-time PCR.

[0152] In addition, the method of the present disclosure may further include detecting one or more biomarkers from a reference tissue obtained from a subject. For example, the method may include detecting biomarkers from a sample tissue and a reference tissue. The reference tissue may be a benign tissue. In some cases, the reference tissue is a tissue from the same organ or region as the sample tissue. In some cases, the sample tissue includes a tissue suspected of having a disease or condition (e.g., a malignant tumor) and the reference tissue includes a tissue of the same organ known not to have the disease or condition. In some cases, the level of the biomarker in the sample tissue detected can be further compared with the level of the biomarker in the reference tissue detected.

[0153] In some cases, the devices of the present disclosure can be used during surgery to remove a tumor and / or identify tumor margins. The devices of the present disclosure can be used to characterize tissues and tissue margins having different morphologies in situ or ex vivo. For example, in Mohs skin cancer surgery, where tissue is typically removed, sectioned, and evaluated histologically, the margins of a tumor can be analyzed using the devices of the present disclosure. In some cases, the devices of the present disclosure can be used to identify metastases of cancer by analyzing the margins of tissue.

[0154] The devices and methods of the present disclosure can be used to personalize medical applications. A subject can provide a certain amount of, for example, a skin sample to a clinician. The clinician can use the device of the present disclosure to detect a variety of biomarkers associated with the subject's skin. The clinician can use the identified biomarkers to determine the expected therapeutic effect for a specific subject. The devices and methods of the present disclosure can also be used to monitor the subject's response to a specific treatment, for example, by monitoring the increase or decrease in biomarker expression. Clinicians can rely on the increase or decrease in the level of biomarker expression to determine the effectiveness of the treatment. The device of the present invention can be used to quantitatively measure the expression of biomarkers. For example, quantitative PCR can be used to amplify the copy number of biomarkers that have been hybridized with a polynucleotide probe on a microneedle. Microneedles that have not been contacted or hybridized with a biological sample can be used as negative controls. Microneedles with known amounts of standard controls such as housekeeping genes can be used as positive controls for reactions. Quantitative PCR can be performed as described in The PCR Technique: Quantitative PCR, James W. Larrick, June 1997, Eaton Publishing.

[0155] The devices and methods of the present disclosure may be used in biodefense. Biodefense may include detecting the release or spread of biological or chemical substances. These substances may be bacteria, viruses, or toxins, and may be naturally occurring or artificially modified. The devices of the present disclosure may be used to detect a variety of biomarkers associated with pathological agents that may be used in biological warfare.

[0156] Biological and / or chemical warfare agents may include any biological and / or chemical entity that can be used as a weapon, e.g., to cause terror, chaos, disease, discomfort, and / or death. Non-limiting examples of chemical and biological agents include anthrax; smallpox; tularemia; avian influenza; plague; HIV; Ebola virus; foot-and-mouth disease; ricin; neurotoxic organophosphates; cyanide; blistering agents (or blistering agents), such as mustard gas and Lewisite; asphyxiating agents, such as chlorine and phosgene; nerve agents, such as sarin, tabun, soman, and VX; hallucinogens, such as BZ; pesticides, such as parathion, malathion, and azinphos-methyl; and derivatives or combinations thereof.

[0157] The present invention further provides a kit for performing diagnostic applications as described herein. The kit generally comprises a microneedle device containing one or more microneedles. In some kits, the microneedles have been conjugated with probes that are specific for detecting one or more biomarkers. In some other kits, probes for detecting one or more biomarkers and reagents for conjugating them to microneedles are provided as separate components. Some kits of the present invention are intended to be used for detecting and capturing a specific biomarker for a known disease or condition (e.g., plaque protein-3 mRNA for gastrointestinal cancer). In these kits, the microneedles of the device are generally or will be conjugated with the same probe molecule (e.g., an oligonucleotide complementary to a target biomarker). Some other kits of the present invention are designed to detect a variety of biomarkers associated with one or more diseases or conditions. In these kits, different probes for different biomarkers are conjugated to or are prepared to be conjugated to the microneedles of the device. In addition to the microneedle device and the probe, the kit of the present invention may also include other reagents for applying the device to a subject or for analyzing captured biomarkers (e.g., reagents for PCR amplification of biomarkers). The kit may also include instructions for using the kit for the intended diagnostic application (eg, on an instruction sheet within the kit or on the kit's packaging material).

[0158] The device of the present invention can be packaged as a kit. In some embodiments, the kit contains written instructions for using the device to treat a condition such as basal cell carcinoma. The written material can be, for example, a label. The written material can suggest conditions and methods for using the microneedles and additional reagents contained in the kit. The instructions provide the subject and the supervising physician with optimal guidance on achieving optimal detection of the biomarker.

[0159] The kits disclosed herein may comprise a device as described herein and a set of reagents for polymerase chain reaction. The kits disclosed herein may comprise a device as described herein and a set of reagents for ELISA assays. The kits disclosed herein may be designed for identifying a specific condition, such as basal cell carcinoma, or the kits may be designed for simultaneous diagnosis of multiple conditions such as squamous cell carcinoma, Kaposi's sarcoma, melanoma, basal cell carcinoma, and actinic keratosis (a precursor to squamous cell carcinoma). In some cases, the kits disclosed herein may comprise a device of the present invention and written materials. In some cases, the kits disclosed herein may comprise a device of the present invention, a set of probes, and a set of reagents that can be used to connect the probes to microneedles.

[0160] The kit of the present disclosure may include positive and negative controls. The positive control may be, for example, a sample containing a known biomarker. The positive control may be a polynucleotide of a known sequence, such as a polynucleotide of a known SNP associated with basal cell carcinoma. The negative control may be, for example, a scrambled polynucleotide sequence. In some cases, the kit may include reagents (e.g., polypeptides, polynucleotides) of known concentration or amount, which may be used to make a standard curve to quantify the amount of biomarkers present in a tissue or biological sample. Such reagents may also be used together with any of the methods provided herein.

[0161] Animal models

[0162] Many drugs, treatments and cures for diseases can be developed using animal models. Animal models can be live animals used in the study and investigation of diseases. Pharmaceutical development of drugs can include the study of toxicity and adverse side effects that are not detected in cell-based assays. Animal models can be used to evaluate the efficacy, absorption, metabolism, distribution, excretion, toxicity, pharmacology and side effects of drug treatments. The devices and methods of the present invention can be used to identify the response of biomarkers on animal models to drug treatments.

[0163] Animal models can provide guidance for selecting drug compounds for further evaluation. For example, animal models can provide guidance for pharmacokinetic / metabolism studies in humans. Animal models can be used for evaluation of, for example, absorption, distribution, metabolism, excretion, and toxicology (ADMET) parameters to support experimental new drug (IND) applications. Studies in animal models can, for example, lead to the selection of compounds for further evaluation in preclinical and clinical trials.

[0164] Clinical interventions and clinical trials

[0165] The device of the present disclosure can be used in clinical trials. For example, the device of the present disclosure can be used to identify biomarkers in difficult-to-reach tissues or tissues that cannot be excised and removed for biopsy during surgical procedures. For example, the device of the present disclosure can be used to detect biomarkers in cardiovascular tissue, brain tissue, or internal organs exposed to clinicians during surgical procedures. In some cases, the device of the present invention can prevent medical complications that otherwise may occur when clinicians remove tissue from subjects for biopsy. The device of the present disclosure can be used, for example, in routine medical consultations, during surgical procedures, or by subjects at their homes. The device of the present invention can be used, for example, in cardiovascular surgery or ophthalmic surgery.

[0166] The device of the present disclosure can be used in the design of clinical trial protocols. For example, the device of the present disclosure can be used with clinical trials to detect the level of biomarkers and monitor the response of subjects to drug treatment. The device of the present disclosure can provide guidance for the design, implementation and analysis of preclinical development and clinical trials. The present disclosure provides methods for identifying and quantifying biomarkers that can be selected for optimal administration of therapeutically effective compounds.

[0167] The devices disclosed herein can be used to predict the response of subjects to different drug doses in clinical trials. For example, by monitoring the increase or decrease in the level of biomarkers such as biomarkers of retinal diseases in ocular tissues, the methods and devices of the present invention can establish the efficacy of drug treatment for retinal diseases. In some cases, clinical trials of therapeutic agents are conducted or changed based on the detection of biomarkers using the devices disclosed herein. In some cases, the methods and devices disclosed herein can be used to compare treatments evaluated in clinical trials with known standard of care treatments.

[0168] Clinical trials are usually conducted in several steps, including preclinical studies, preparatory studies, safety screening studies, and efficacy evaluation studies. For drugs to be approved and marketed, all milestones specified in the clinical trial protocol must generally be met, including demonstration of efficacy within the proposed confidence interval, and including a significant number of individuals to demonstrate the statistical efficacy of the present invention. Non-limiting examples of the application of the present invention include monitoring multiple biomarkers throughout the clinical trial process. The devices and methods disclosed herein can also be used to monitor how different drug treatments can affect the expression of biomarkers in the early stages of clinical trials (preclinical and Phase I).

[0169] The devices and methods of the present disclosure can also be used to predict changes in potential cellular pathways affected by drug treatment based on the expression levels of identified biomarkers. Non-limiting examples of pharmacodynamic and pharmacokinetic parameters of drug treatments that can affect potential cellular pathways include: a) the amount of drug administered, which can be expressed as dose D; b) the dosing interval, which can be expressed as τ; c) the apparent volume in which the drug is distributed, which can be expressed as the distribution volume V d , where V d =D / C 0 d) the amount of drug in a given volume of plasma, which can be expressed as a concentration C 0 or C ss , where C 0 or C ss =D / Vd; e) half-life of the drug t 1 / 2 , where t 1 / 2 =ln(2) / k e ; f) The rate at which the drug is removed from the body k e , where k e =ln(2) / t1 / 2 =CL / V d ; g) The infusion rate K required to balance the equation in , where K in =C ss .CL; h) The integral of the concentration-time curve after a single dose, which can be expressed as AUC 0-∞ ,in Or in steady state, it can be expressed as AUCτ ,ss ,in The volume of plasma that clears the drug per unit time can be expressed as CL (clearance), where CL = V d .k e =D / AUC; j) The systemically available fraction of the drug, which can be expressed as f, where k) Peak plasma concentration of the drug after administration C max ; l) Drug reaches C max The time taken max m) the lowest concentration of the drug reached before the next dose is administered min ; and n) the peak-to-trough fluctuation within a dosing interval at steady state, which can be expressed as in

[0170] The present invention provides embodiments including but not limited to the following:

[0171] 1. A device comprising a first microneedle, wherein the first microneedle is covalently or non-covalently attached to a first probe specific for a first biomarker.

[0172] 2. The device of embodiment 1, wherein the first biomarker is a polynucleotide, and the first probe is a polynucleotide complementary to the first biomarker.

[0173] 3. The device of embodiment 1, wherein the first biomarker is a polypeptide.

[0174] 4. The device of embodiment 1, wherein the first probe is an antibody specific for the first biomarker.

[0175] 5. The device of embodiment 1, further comprising a second probe specific for a second biomarker, wherein the second probe is different from the first probe.

[0176] 6. The device of embodiment 5, wherein the second probe is covalently or non-covalently attached to the first microneedle.

[0177] 7. The device of embodiment 5, wherein the second probe is covalently or non-covalently attached to the second microneedle.

[0178] 8. The device of embodiment 5, wherein the second biomarker is a polynucleotide and the second probe is a polynucleotide complementary to the second biomarker.

[0179] 9. The device of embodiment 5, wherein the first probe specifically binds to a first nucleotide polymorphism, and the second probe specifically binds to a second nucleotide polymorphism.

[0180] 10. The device of embodiment 5, wherein the second biomarker is a polypeptide.

[0181] 11. The device of embodiment 5, wherein the first and second probes are different antibodies each specific for a different epitope of the same biomarker.

[0182] 12. The device of embodiment 1, wherein the first probe is attached to a plurality of microneedles.

[0183] 13. The device of embodiment 1, wherein the first microneedle comprises a polymer, a metal, or a ceramic.

[0184] 14. The device of embodiment 1, wherein the first microneedle comprises a polymer.

[0185] 15. The device of embodiment 1, wherein the first probe is attached to the first microneedle via a connector.

[0186] 16. The device of embodiment 15, wherein the linker is a thiol / amino bifunctional linker.

[0187] 17. The device of embodiment 15, wherein the linker is a poly(ethylene glycol) linker.

[0188] 18. The device of embodiment 1, wherein the first microneedles are formed on a substrate.

[0189] 19. The device of embodiment 1, further comprising a compartment for amplifying and identifying said first and second biomarkers.

[0190] 20. A device comprising a plurality of microneedles, wherein the plurality of microneedles comprises at least one microneedle covalently or non-covalently attached to at least one probe specific for a biomarker, and the biomarker is indicative of a skin or eye condition.

[0191] 21. The device of embodiment 20, wherein the biomarker is indicative of a skin condition.

[0192] 22. The device of embodiment 21, wherein the skin condition is skin cancer.

[0193] 23. The device of embodiment 20, wherein the biomarker is indicative of an eye condition.

[0194] 24. The device of embodiment 21, wherein the eye condition is eye inflammation or eye cancer.

[0195] 25. The device of embodiment 20, wherein the biomarker is a polynucleotide and the at least one probe is complementary to the biomarker.

[0196] 26. The device of embodiment 25, wherein the at least one probe comprises different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker.

[0197] 27. The device of embodiment 20, wherein the biomarker is a peptide or polypeptide, and the at least one probe is an antibody specific for the biomarker.

[0198] 28. The device of embodiment 27, wherein the at least one probe comprises different antibodies specific for different epitopes of the same biomarker.

[0199] 29. The device of embodiment 20, comprising a plurality of probes specific for a plurality of different biomarkers, wherein the plurality of probes are attached to the same or different microneedles.

[0200] 30. The device of embodiment 29, wherein at least two different probes are attached to the same microneedle.

[0201] 31. The device of embodiment 20, comprising at least two identical probes for specific biomarkers, wherein the at least two identical probes are attached to one or more microneedles.

[0202] 32. The device of embodiment 20, wherein the microneedles comprise a polymer, a metal, or a ceramic.

[0203] 33. The device of embodiment 32, wherein the microneedles comprise a polymer.

[0204] 34. The device of embodiment 20, wherein the probe is attached to the microneedle via a connector.

[0205] 35. The device of embodiment 34, wherein the linker is a thiol / amino bifunctional linker.

[0206] 36. The device of embodiment 34, wherein the linker is a poly(ethylene glycol) linker.

[0207] 37. The device of claim 20, wherein the plurality of microneedles are formed on a substrate.

[0208] 38. The device of embodiment 20, further comprising a compartment for in situ amplification and identification of biomarkers captured by the probes.

[0209] 39. A device comprising a plurality of microneedles, wherein the plurality of microneedles comprises at least one microneedle covalently or non-covalently attached to a probe specific for a biomarker, wherein the probe comprises a sensor that emits a light signal when the probe detects the biomarker.

[0210] 40. The device of embodiment 39, wherein the optical signal of said probe increases when it detects said biomarker.

[0211] 41. The device of embodiment 39, wherein the optical signal of said probe decreases when it detects said biomarker.

[0212] 42. The device of embodiment 39, wherein the biomarker is a polynucleotide and the probe is a polynucleotide complementary to the biomarker.

[0213] 43. The device of embodiment 42, wherein the probes are different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker.

[0214] 44. The device of embodiment 39, wherein the biomarker is a peptide or polypeptide and the probe is an antibody specific for the biomarker.

[0215] 45. The device of embodiment 44, wherein the probes are different antibodies specific for different epitopes of the same biomarker.

[0216] 46. ​​The device of embodiment 39, comprising a plurality of probes specific for a plurality of different biomarkers, wherein the plurality of probes are attached to the same or different microneedles.

[0217] 47. The device of embodiment 39, wherein at least two different probes are attached to the same microneedle.

[0218] 48. The device of embodiment 39, comprising at least two identical probes for specific biomarkers, wherein the identical probes are attached to one or more microneedles.

[0219] 49. The device of embodiment 39, wherein the microneedles are made of polymer, metal or ceramic.

[0220] 50. The device of embodiment 49, wherein the microneedles comprise a polymer.

[0221] 51. The device of embodiment 39, wherein the probe is attached to the microneedle via a connector.

[0222] 52. The device of embodiment 51, wherein the linker is a thiol / amino bifunctional linker.

[0223] 53. The device of embodiment 51, wherein the linker is a poly(ethylene glycol) linker.

[0224] 54. The device of embodiment 39, further comprising a compartment for in situ amplification and identification of biomarkers captured by the probes.

[0225] 55. A kit comprising:

[0226] (a) a device comprising a plurality of microneedles, wherein the plurality of microneedles comprises at least one microneedle covalently or non-covalently attached to a first probe specific for a biomarker; and

[0227] (b) A set of reagents used in polymerase chain reaction.

[0228] 56. The kit of embodiment 55, wherein at least one microneedle is covalently or non-covalently attached to a second probe specific for a different biomarker.

[0229] 57. The kit of embodiment 55, wherein the kit further comprises a fixator.

[0230] 58. The kit of embodiment 55, wherein the biomarker is a polynucleotide and the probe is a polynucleotide complementary to the biomarker.

[0231] 59. The kit of embodiment 58, wherein the probes are different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker.

[0232] 60. The kit of embodiment 55, wherein the set of reagents comprises a polymerase, a buffer, and a control sample.

[0233] 61. The kit of embodiment 55, wherein the kit further comprises written instructions for its use.

[0234] 62. The kit of embodiment 55, comprising a plurality of probes specific for a plurality of different biomarkers, wherein the plurality of probes are attached to the same or different microneedles.

[0235] 63. The kit of embodiment 62, wherein at least two different probes are attached to the same microneedle.

[0236] 64. The kit of embodiment 55, further comprising at least two identical probes for specific biomarkers, wherein the identical probes are attached to one or more microneedles.

[0237] 65. The kit of embodiment 55, wherein the microneedles are made of polymer, metal or ceramic.

[0238] 66. The kit of embodiment 65, wherein the microneedles comprise a polymer.

[0239] 67. The kit of embodiment 55, wherein the probe is attached to the microneedle via a connector.

[0240] 68. The kit of embodiment 67, wherein the linker is a thiol / amino bifunctional linker.

[0241] 69. The kit of embodiment 67, wherein the linker is a poly(ethylene glycol) linker.

[0242] 70. The kit of embodiment 55, further comprising a compartment for in situ amplification and identification of biomarkers captured by the probes.

[0243] 71. The kit of embodiment 55, wherein the probe comprises a sensor that emits a visual signal when the probe detects the biomarker.

[0244] 72. The kit of embodiment 55, wherein contacting the biological sample detects or extracts one or more biomarkers from the skin condition.

[0245] 73. The kit of embodiment 55, wherein contacting the biological sample detects or extracts one or more biomarkers from the eye condition.

[0246] 74. The kit of embodiment 55, wherein the set of reagents is for reverse transcriptase polymerase chain reaction.

[0247] 75. A method for detecting one or more biomarkers from an in situ tissue or biological sample in a subject, the method comprising (a) contacting a microneedle with a tissue or biological sample of the subject, wherein the microneedle is attached to a set of probes, and wherein the probes bind to the one or more biomarkers in situ; and (b) detecting the one or more biomarkers bound to the probes.

[0248] 76. The method of embodiment 75, wherein the one or more biomarkers are polynucleotides and the probes are polynucleotides complementary to the biomarkers.

[0249] 77. The method of embodiment 76, wherein the probes are different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker.

[0250] 78. The method of embodiment 75, wherein the one or more biomarkers are peptides or polypeptides and the probe is an antibody specific for the biomarker.

[0251] 79. The method of embodiment 78, wherein the probes are different antibodies specific for different epitopes of the same biomarker.

[0252] 80. The method of embodiment 75, comprising a plurality of probes specific for a plurality of different biomarkers, wherein the plurality of probes are attached to the same or different microneedles.

[0253] 81. The method of embodiment 80, wherein at least two different probes are attached to the same microneedle.

[0254] 82. The method of embodiment 75, comprising at least two identical probes directed to specific biomarkers, wherein the identical probes are attached to one or more microneedles.

[0255] 83. The method of embodiment 75, wherein the microneedles comprise a polymer, a metal, or a ceramic.

[0256] 84. The method of embodiment 83, wherein the microneedles comprise a polymer.

[0257] 85. The method of embodiment 75, wherein the probe is attached to the microneedle via a connector.

[0258] 86. The method of embodiment 85, wherein the linker is a thiol / amino bifunctional linker.

[0259] 87. The method of embodiment 85, wherein the linker is a poly(ethylene glycol) linker.

[0260] 88. The method of embodiment 75, wherein the detecting comprises contacting the one or more biomarkers with a detectable label.

[0261] 89. The method of embodiment 88, wherein the detectable label is a fluorophore.

[0262] 90. The method of embodiment 75, wherein the detecting comprises amplifying the biomarker.

[0263] 91. The method of embodiment 75, wherein the biomarker bound to the probe on the microneedle is detected by polymerase chain reaction.

[0264] 92. The method of embodiment 75, wherein the biomarker bound to the probe on the microneedle is detected by a polynucleotide-labeled secondary antibody and by PCR amplification of the polynucleotide tag.

[0265] 93. The method of embodiment 75, wherein the biomarker is a small molecule or a metabolite and the probe is a ligand specific for the biomarker.

[0266] 94. A method for detecting one or more biomarkers from an in situ tissue or biological sample in a subject, the method comprising: (a) contacting a microneedle device with the tissue or biological sample of the subject, wherein the microneedle device comprises one or more probes specific for the one or more biomarkers, wherein at least one probe comprises a sensor that emits a visual signal when the probe detects the biomarker; and (b) detecting the biomarker based on the visual signal.

[0267] 95. The method of embodiment 94, wherein the one or more biomarkers are polynucleotides and the probes are polynucleotides complementary to the biomarkers.

[0268] 96. The method of embodiment 95, wherein the probes are different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker.

[0269] 97. The method of embodiment 94, wherein the one or more biomarkers are peptides or polypeptides and the probe is an antibody specific for the biomarker.

[0270] 98. The method of embodiment 96, wherein the probes are different antibodies specific for different epitopes of the same biomarker.

[0271] 99. The method of embodiment 94, comprising a plurality of probes specific for a plurality of different biomarkers, wherein the plurality of probes are attached to the same or different microneedles.

[0272] 100. The method of embodiment 99, wherein at least two different probes are attached to the same microneedle.

[0273] 101. The method of embodiment 94, further comprising at least two identical probes for specific biomarkers, wherein the identical probes are attached to one or more microneedles.

[0274] 102. The method of embodiment 94, wherein the microneedles are made of polymer, metal or ceramic.

[0275] 103. The method of embodiment 102, wherein the microneedles comprise a polymer.

[0276] 104. The method of embodiment 94, wherein the probe is attached to the microneedle via a connector.

[0277] 105. The method of embodiment 104, wherein the linker is a thiol / amino bifunctional linker.

[0278] 106. The method of embodiment 104, wherein the linker is a poly(ethylene glycol) linker.

[0279] 107. The method of embodiment 94, further comprising a system for in situ amplification and identification of biomarkers captured by the probes.

[0280] 108. The method of embodiment 94, wherein the detecting comprises contacting the one or more biomarkers with a detectable label.

[0281] 109. The method of embodiment 108, wherein the detectable label is a fluorophore.

[0282] 110. The method of embodiment 94, wherein the detecting comprises amplifying the biomarker.

[0283] 111. The method of embodiment 94, wherein the biomarker bound to the probe on the microneedle is detected by polymerase chain reaction.

[0284] 112. The method of embodiment 94, wherein the biomarker bound to the probe on the microneedle is detected by a polynucleotide-labeled secondary antibody and by PCR amplification of the polynucleotide tag.

[0285] 113. The method of embodiment 94, wherein the biomarker is a small molecule or a metabolite and the probe is a ligand specific for the biomarker.

[0286] 114. The method of embodiment 94, wherein the one or more biomarkers are associated with a skin condition.

[0287] 115. The method of embodiment 94, wherein the one or more biomarkers are associated with an eye condition.

[0288] 116. The method of embodiment 94, wherein the microneedles are etched to increase the surface area of ​​the microneedles.

[0289] 117. A composition comprising a plurality of microneedles coated with an agent capable of disrupting the extracellular matrix.

[0290] 118. The composition of embodiment 117, wherein the agent is an enzyme.

[0291] 119. The composition of embodiment 117, wherein the enzyme is selected from the group consisting of serine proteases, thiol proteases, MMPs, papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, α-chymotrypsin, α-amylase, DNase, collagenase, and sutiranase.

[0292] 120. The composition of embodiment 117, wherein the enzyme is hyaluronidase.

[0293] 121. A method for detecting one or more biomarkers in a tissue of a subject, the method comprising (a) contacting a microneedle with the tissue of the subject in situ, wherein the tissue comprises an extracellular matrix, wherein the microneedle is covalently attached to a set of probes, and wherein the probes bind to the biomarkers in situ; and (b) disrupting the extracellular matrix.

[0294] 122. The method of embodiment 121, wherein the extracellular matrix is ​​disrupted by enzymatic activity.

[0295] 123. The method of embodiment 121, wherein disrupting the extracellular matrix comprises applying ultrasonic energy to the extracellular matrix.

[0296] 124. The method of embodiment 121, wherein the extracellular matrix is ​​disrupted by an electric potential.

[0297] 125. A method for detecting one or more biomarkers from an in situ tissue of a subject, the method comprising (a) contacting a microneedle with the tissue, wherein the tissue comprises a cell membrane, wherein the microneedle is attached to a set of probes, and wherein the probes bind to the biomarkers in situ, and (b) disrupting the cell membrane.

[0298] 126. The method of embodiment 125, wherein the cell membrane is disrupted by enzymatic activity.

[0299] 127. The method of embodiment 125, wherein disrupting the cell membrane comprises applying ultrasonic energy to the cell membrane.

[0300] 128. The method of embodiment 125, wherein the cell membrane is disrupted by an electric potential.

[0301] 129. A method for preparing a microneedle device, the method comprising:

[0302] (a) obtaining a solution comprising an inorganic salt;

[0303] (b) adding probes and microneedles to the solution; and

[0304] (c) conjugating the probe to the microneedle in the solution.

[0305] 130. The method of embodiment 129, wherein the inorganic salt is sodium chloride.

[0306] 131. The method of embodiment 129, wherein the concentration of the inorganic salt is less than 2.5M.

[0307] 132. A method for detecting one or more biomarkers in a subject, the method comprising contacting a microneedle device with skin or ocular tissue of the subject.

[0308] 133. The method of embodiment 132, wherein the one or more biomarkers are associated with a skin or eye condition.

[0309] 134. The method of embodiment 132, wherein the biomarker is a polynucleotide.

[0310] 135. The method of embodiment 132, wherein the biomarker is present in the blood of the subject.

[0311] 136. A method for detecting one or more biomarkers in a subject, the method comprising contacting a microneedle device with skin capillaries of the subject.

[0312] 137. The method of embodiment 136, further comprising contacting the microneedle device with a blood sample from the subject.

[0313] 138. A method for detecting one or more polynucleotide biomarkers from in situ tissue in a subject, the method comprising contacting a microneedle device with tissue of the subject during an intraoperative procedure.

[0314] 139. The method of embodiment 138, wherein the tissue is from an organ selected from the group consisting of brain, heart, breast, liver, pancreas, spleen, bladder, stomach, lung, uterus, cervix, prostate, kidney, intestine, appendix, thyroid and colon.

[0315] 140. The method of embodiment 138, wherein the tissue of the subject comprises benign tissue.

[0316] 141. The method of embodiment 138, wherein the tissue of the subject comprises suspected malignant tissue.

[0317] 142. The method of embodiment 138, wherein the microneedle device contacts malignant tissue and benign tissue adjacent to the malignant tissue.

[0318] 143. The method of embodiment 138, wherein the microneedle device contacts benign tissue adjacent to malignant tissue.

[0319] 144. The method of embodiment 138, wherein the microneedle device contacts a tumor.

[0320] 145. The method of embodiment 138, further comprising determining a surgical margin of the tumor.

[0321] 146. The method of embodiment 75, 94, 121, 125, 129, 132, 136 or 138, further comprising detecting one or more biomarkers from a reference tissue obtained from the subject.

[0322] 147. The device of embodiment 14, wherein the polymer is a thermoplastic polymer.

[0323] 148. The device of embodiment 14, wherein the thermoplastic polymer is selected from the group consisting of polycarbonate, poly(methyl methacrylate), polyethylene, and polypropylene. Example

[0324] The following examples are provided to further illustrate the present invention without limiting its scope. Example 1. Using polycarbonate Immobilized probe detects ssDNA in solution

[0325] This example describes polycarbonates functionalized with DNA probes and their use to specifically capture ssDNA from solution.

[0326] Attachment of DNA probes to polycarbonate: The surface of polycarbonate was first nitrated and reduced to introduce amino groups for further attachment of commercially available thiol / amino bifunctional linkers ( Figure 1 ). The DNA with 3' thiol modification was then coupled to a linker tethered to polycarbonate.

[0327] Visualization of 5'-Cy5 modified DNA attached to polycarbonate: To visualize DNA on the polycarbonate surface, DNA modified with a Cy5 at the 5' and a thiol at the 3' was attached using the above chemistry. The monolayer of 5'Cy5-DNA was imaged using confocal microscopy ( Figure 2 ), showing successful functionalization of the surface. In vitro capture of ssDNA on polycarbonate modified with specific DNA probes: To test the ability of DNA probes attached to polycarbonate to specifically capture (hybridize) ssDNA from solution, polycarbonate discs were modified with DNA probes complementary to a region of circular single-stranded DNA (ssDNA, approximately 3.4 kb in size). After incubation of the modified disc with the ssDNA solution, the disc was washed thoroughly, and the hybridized ssDNA was released from the disc by high temperature denaturation and quantified by quantitative PCR (qPCR). The amount of DNA captured on polycarbonate modified with the specific DNA probe is expressed as a ratio to the amount captured on polycarbonate modified with the linker alone - background control ( Figure 1 ).

[0328] The results obtained from this study are summarized in Table 1. The data show that the ssDNA target was successfully enriched on the specific probe at all ssDNA concentrations tested (concentrations varied by more than 6 logs).

[0329] Table 1. Capture efficiency expressed as the ratio of DNA recovery from disks with specific probes to DNA recovery from disks modified with linkers alone.

[0330]

[0331] The materials and methods used in this study are described in detail below.

[0332] Polycarbonate derivatization: Polycarbonate was derivatized in 30% HNO 3 The nitrated polycarbonate (step 1) was immersed in 10% NaBH 4 The amino-modified polycarbonate (step 2) was immersed in a solution of 6.4 mM sulfo-GMBS (Pierce) in PBS pH 7.2 and shaken at room temperature for 1.5 hours, and then washed thoroughly with water.

[0333] Deprotection of DNA thiol groups: DNA was purchased from IDT and had a thiol modification C3 SS at the 3' end. To deprotect the thiol modification, 5 μL of a 100 μM DNA aqueous solution was treated with 25 μL of 100 mM 2-mercaptoethanol in PBS pH 8.1 at room temperature for 30 minutes. To purify the deprotected DNA, 600 μL of PN buffer from the Qiagen Nucleotide Removal Kit was added to the reaction mixture, followed by isopropanol (250 μL). The solution was applied to a silica column of the Qiagen Nucleotide Removal Kit and washed according to the instructions of the kit, followed by elution with 35 μL of PBS pH 7.2. Attachment of DNA to polycarbonate: The solution of the deprotected thiol-modified DNA (step 4) was immediately applied to the polycarbonate modified with a maleimide linker (step 3) and incubated at 37°C in a humid atmosphere for 45 minutes, then washed thoroughly with water and air-dried.

[0334] Visualization of Cy5-modified DNA: Using the above chemistry, 25-mer DNA modified with one Cy5 at the 5' end and a thiol modification at the 3' end was attached to the surface of polycarbonate. After extensive washing with water and drying, the polycarbonate was mounted on a microscope slide and imaged with a confocal microscope using a far-infrared filter. The edges of the DNA-modified areas on the surface were located and imaged, clearly showing the effect of the monolayer modification of DNA labeled with Cy5.

[0335] Capture of ssDNA on polycarbonate functionalized with specific DNA probe: A DNA probe with a thiol modification at 3' (5'-CAAGTTTGCCTTTAGCGTCAGACTGTATTTTTTTT / ThioMC3 / -3') (SEQ ID NO: 1) was attached to a polycarbonate disk using the above procedure (steps 1-4). The disk for the negative control experiment was modified with the linker only (steps 1-3). The disk was immersed in a solution of circular ssDNA isolated from filamentous phage in SSC buffer 3x (150mM NaCl, 15mM sodium citrate) (see Table 1 for DNA concentration) and incubated at 37°C for 10 minutes. The disk was then washed with three wash buffers. Wash buffer 1: 1x SSC + 0.03% SDS; Wash buffer 2: 0.2x SSC, Wash buffer 3: 0.05xSSC. After washing, the disks were immersed in a minimal volume of sterile distilled water and heated at 90°C for 2 minutes, after which the still warm water was removed from the disks. ssDNA in aliquots of the aqueous solution was quantified by qPCR using primers specific for the p3 gene of filamentous bacteriophage.

[0336] Example 2. Conjugation of DNA probes to stainless steel surfaces

[0337] This example describes the attachment of a DNA oligomer probe containing a 3' thiol modification to a gold coated stainless steel surface. Attachment of DNA Probe to Gold Coated Stainless Steel: Gold surfaces are easily modified by attaching thiol-derivatized single-stranded DNA. The sulfur atoms in the thiolated DNA form covalent bonds with gold. Visualization of DNA on Gold Coated Stainless Steel: To visualize the DNA on the gold coated stainless steel sample surface, a fill-in PCR reaction was performed using fluorescently labeled dUTP to synthesize the complementary strand of the single-stranded DNA. The resulting double-stranded oligomer contains Alexa Multiple copies of 488-5-dUTP, which fluoresces in the green channel similar to fluorescein. Fluorescence microscopy confirmed the successful functionalization of the gold-coated stainless steel surface ( Figure 3 ).

[0338] The materials and methods used in this study are described in detail below.

[0339] Deprotection of DNA thiol groups and conjugation to stainless steel: DNA was purchased from IDT and had a thiol modification C3 SS at the 3' end. To deprotect the thiol modification, 5 pL of a 100 pM DNA aqueous solution was treated with 25 pL of 100 mM 2-mercaptoethanol in PBS pH 8.1 at room temperature for 30 minutes. To purify the deprotected DNA, 600 pL of PN buffer from the Qiagen Nucleotide Removal Kit was added to the reaction mixture, followed by isopropanol (300 pL). The solution was applied to a silica column of the Qiagen Nucleic Acid Removal Kit and washed according to the instructions of the kit, followed by elution with 24 pL of TE buffer (10 mM Tris; 1 mM EDTA) pH 7.2.

[0340] The deprotected thiol-modified DNA solution was immediately applied to the gold surface of a piece of stainless steel (approximately 5 mm x 2.5 mm). The solution was incubated at 37°C in a humid atmosphere for 16-20 hours, then washed extensively with water and subsequently air-dried.

[0341] Filling reaction for amplifying fluorescent signals: A 75 bp single-stranded DNA oligomer with thiol derivatization at the 3' end (5'-GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCGC CTGTGGGCGACTAAATTCCGTTAAAGCCGGC / ThiolMC3 / -3') (SEQ ID NO: 2) was attached to the gold-coated surface of the stainless steel sample. After washing and drying, the stainless steel sample was placed in a 0.5 mL tube. 48.5 pL dH 2 0 and 1.5 pL 10 pM of a primer complementary to the 3' end of the thiol-derivatized DNA. The mixture was incubated at 55°C for 2 minutes to allow the primer to anneal to the single-stranded DNA. The mixture was then allowed to return to room temperature.

[0342] Then, the Alexa The following components were added to the mixture in step 3: 2 pL of 10 mM dNTP mixture (dATP, dGTP, dCTP), 7.5 pL of 10X Klenow fragment buffer (New England Biolabs), 9.5 pL of dH 2 O, 4 pL of 1 mM 488-5-dUTP and 2 pL of Klenow fragment (New England Biolabs). The reaction was incubated at 37° C. for 30 minutes. The stainless steel sample was removed from the tube, washed thoroughly with water and air dried.

[0343] Alexa Visualization of modified DNA: Once the stainless steel sample had dried, it was mounted onto a microscope slide and imaged with a fluorescent microscope using a green filter. The edges of the DNA-modified areas on the stainless steel were located and imaged, clearly demonstrating the conjugation of the DNA to the gold-coated surface.

[0344] Example 3. Enhanced Binding of Oligonucleotides to Metal Microneedle Array Surfaces

[0345] To further promote the attachment of the DNA oligomer probes containing 3' thiol modifications to the gold-coated stainless steel surface, NaCl titration was introduced. The protocol in Example 2 above was performed with increasing concentrations of NaCl. The amount of ssDNA coupled to the surface increased proportionally to the amount of NaCl added, and an approximately 10-fold increase ( Figure 7 ). The quantification of DNA bound to the gold surface was determined using the Quanti-iT Green ssDNA Reagent Kit (Invitrogen).

[0346] Example 4. Diagnostic Methods

[0347] Lack of diagnosis of melanoma is a significant problem for dermatologists. The consequences of a missed diagnosis can be devastating to the patient, costly to insurance companies, and traumatic to the physician, so early detection of melanoma is critical. However, the invasive nature of standard biopsy procedures can prevent physicians from performing biopsies on apparently benign tissue. Figure 5 and Figure 6 Non-invasive diagnosis of melanoma using the apparatus and methods of the present disclosure is shown. 501-505 describe the surface of 603 in more detail.

[0348] Figure 5A process is shown whereby a DNA probe designed to detect a biomarker for melanoma is hybridized with a desired biomarker. 501 shows a single DNA probe attached to the gold surface of a microneedle. The DNA probe in 501 contains a single nucleotide polymorphism that selectively hybridizes with melanoma-associated RNA. As described in Example 2, the DNA probe in 501 is covalently attached to the gold surface of the microneedle. 505 shows bright field and fluorescent field images of the surface of the device of the present invention, comprising a plurality of microneedles with covalently attached DNA probes. When the device contacts the skin of a subject, the microneedle gently disrupts the cell membrane of the skin being contacted. This process exposes the probe on the microneedle to polynucleotide, peptide and protein biomarkers within the cell. The probe on the microneedle can be hybridized in situ with the biomarker under physiological conditions for a specified period of time 502, for example, the probe can be hybridized at physiological body temperature (about 37°C) for about 30 minutes. Reverse transcriptase-PCR (RT-PCR) assay 503 can be used to convert the hybridized RNA into DNA. Standard PCR protocol 504 can be used to amplify the product of 503.

[0349] Figure 6 An overview of a method of providing treatment with the device of the present invention is shown. 601 shows a clinician performing a visual inspection of a subject's skin. Clinician 601 may determine that skin 602 or a portion of skin appears healthy or unhealthy. The clinician may touch the subject's skin with the device of the present invention, thereby contacting the probes for biomarkers with the subject's skin in a non-invasive manner. 603 is an illustration of the surface of the device, which is Figure 5 604 shows a PCR assay performed to amplify the hybridized biomarker. 605 shows the clinician returning the analysis results to the subject.

[0350] Example 5. In vivo testing of modified polymer microneedle arrays

[0351] This example describes the in vivo detection of mouse actin using a modified polymer microneedle array described in this application. Polycarbonate microneedles were modified with mouse actin ssDNA probes, and the microneedle samples coupled to the ssDNA probes were also coated with hyaluronidase. Mice were treated with ssDNA-modified polycarbonate microneedles (n=4; A / J, SwissWebster). The microneedle array was applied to the shaved hind limbs of the mice using thumb pressure and kept in place for about 10 seconds. Then, the mRNA bound to the array was reverse transcribed directly on the microneedle surface into cDNA by flipping the array on a glass slide, sealing the space between the needle seat and the glass slide with oil, and placing the glass slide on a 50°C heat block for 30 minutes. The reaction mixture was then transferred from the glass slide to a PCR tube and amplified using conventional PCR techniques. The cycling program was performed as follows: 94°C for 1 minute; 40 cycles of 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 60 seconds; 68°C for 5 minutes. Samples were visualized by gel imaging and quantified using densitometry.

[0352] A significant increase in the amount of mRNA separated from the microneedle containing the probe was observed. The difference between the sample containing the ssDNA probe and the unmodified microneedle array was about 2-3 times, while the difference between the sample containing the ssDNA probe and the unmodified array was about 8 times. This shows that not only the microneedle extracts the target from the skin, but also the destruction of the extracellular matrix can promote the extraction process, thereby resulting in a higher yield. Many enzymes, including but not limited to serine proteases, sulfhydryl proteases and MMPs, may be useful in this process. Other specific examples of enzymes include but are not limited to papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, α-chymotrypsin, α-amylase (amlyase), DNase, collagenase and sutilanase.

[0353] Example 6. Isolation of target mRNA from homogenized human skin

[0354] This example describes the isolation of target mRNA from homogenized human skin. Excess human skin containing both cancerous and benign tissue was obtained from the Scripps Clinic, which was excised during Mohs micrographic surgery. The skin was homogenized and total RNA was extracted using the following procedure. TM Skin was homogenized at setting 6.0 for 25 s using MP Biomedical FastPrep-24 and Lysing Matrix D beads (approximately 30-40 mg tissue / tube). RNA was then extracted using a Qiagen RNA Extraction Kit (Qiagen TM) Total RNA was isolated from the homogenate according to the manufacturer's instructions. A DNA probe having a sequence complementary to human β-actin was conjugated to a gold-coated stainless steel microneedle, placed in a solution of RNA isolated from homogenized skin, and incubated for a period of time at room temperature or 37°C. The stainless steel strip was separated from the solution and the bound mRNA was reverse transcribed into cDNA, which was then amplified and analyzed using qRT-PCR. As a result, only the microneedles coupled to the β-actin probe and then amplified using the appropriate β-actin probe produced measurable amounts of the target ( Figure 8 ). In this example, a non-specific DNA sequence was conjugated to the microneedle surface; a BMP-4: Taqman probe was used for a non-actin target; and an Actb-human-1: β-actin sequence was conjugated to the microneedle surface.

[0355] Example 7. Detection of mRNA from a mouse skin mRNA library using a microneedle array

[0356] In these experiments, mRNA from mouse skin was collected (Zyagen TM ) to isolate the target mRNA. The total concentration of mRNA in the aggregate was 250 μg / mL. Then, a gold-coated stainless steel microneedle array with probe ssDNA coupled thereto was added to the mRNA library (5 μL in 20 μL water) and incubated at 37°C for about 10 minutes. The array was then gently washed and allowed to air dry briefly. The reverse transcriptase reaction mixture (3 μL 10x reverse transcriptase buffer, 6 μL 25 mM MgCl 2 , 3μL0.1M DTT, 1.5μL RNase OUT TM , 13 μL DEPC water, 2 μL 10 mM dNTP mixture) was added to the tube containing the microneedle array and incubated at 42°C for 2 minutes, followed by the addition of 1.5 μL SuperScriptII TM Reverse transcriptase was used to synthesize cDNA. The reaction was cycled through the following program: 42°C for 50 minutes, 70°C for 15 minutes, and then on ice for about 15 minutes. RNase H was then added to each reaction (1.5 μL) and the reaction was incubated at 37°C for 20 minutes. 20x TaqMan TM Assay primers (1.5 μL) and 2x TaqMan TM The gene expression mixture (15 μL) was subjected to TaqMan TM PCR amplification. The reaction had a total volume of 30 μL. After four cycles, 5 μL of the solution was removed and used as a template for TaqMan TM qRT-PCR (40 cycles).

[0357] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, those skilled in the art will readily appreciate, based on the teachings of this invention, that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

[0358] All publications, databases, GenBank sequences, patents, and patent applications cited in this specification are herein incorporated by reference as if each were specifically and individually indicated to be incorporated by reference.

Claims

1. A device for detecting or extracting one or more mRNA biomarkers from an in situ tissue or biological sample of a subject, the device comprising two or more microneedles covalently attached to one or more nucleic acid probes capable of hybridizing with mRNA biomarkers associated with psoriasis. 2 . The device according to claim 1 , wherein the height of the two or more microneedles ranges from 400 μm to 1000 μm. 3 . The device according to claim 1 , wherein the height of the two or more microneedles ranges from 400 μm to 2000 μm. The device of claim 1 , wherein the two or more microneedles have a height less than 2000 μm.

5. The device of claim 1, wherein the base of the two or more microneedles is no larger than 500 μm. The device according to claim 1 , wherein the base of the two or more microneedles is square in shape.

7. The device of claim 1, wherein the one or more nucleic acid probes comprise DNA nucleotides.

8. The device of claim 1, wherein the one or more nucleic acid probes are between 15 and 100 nucleotides in length.

9. The device of claim 1, wherein the device is capable of extracting one or more mRNA biomarkers detectable by polymerase chain reaction (PCR).

10. The device of claim 9, wherein the PCR is quantitative real-time PCR (qRT-PCR).

11. The device of claim 1, wherein the device is capable of extracting one or more mRNA biomarkers detectable by genomic sequencing analysis.

12. The device of claim 1, wherein the device comprises at least 25 microneedles.

13. The device of claim 1, wherein the device comprises at least 50 microneedles.

14. The device of claim 1, wherein a center-to-center distance between two adjacent microneedles of the two or more microneedles is no greater than 1000 μm. 15 . The device of claim 1 , wherein a center-to-center distance between two adjacent microneedles of the two or more microneedles is no greater than 400 μm.

16. The device of claim 1, wherein the one or more nucleic acid probes comprise one or more polynucleotides complementary to different mRNA biomarkers.

17. The device of claim 1, wherein the one or more nucleic acid probes comprise one or more polynucleotides complementary to the same mRNA biomarker.

18. The device of claim 1, wherein the two or more microneedles are formed on a substrate.

19. The device of claim 1, wherein the mRNA biomarker is derived from in situ skin tissue.

20. The device of claim 1, wherein the mRNA biomarker is derived from biopsied skin tissue.

21. A method for extracting one or more biomarkers from a subject, the method comprising: (a) preparing a microneedle device comprising one or more microneedles to which one or more probes are covalently attached, wherein the one or more probes are polynucleotides complementary to one or more biomarkers of the subject; (b) contacting the microneedle device with skin tissue of the subject, thereby hybridizing the one or more probes with the one or more biomarkers of the subject; as well as (c) extracting biomarkers hybridized to the one or more probes, wherein the one or more probes are covalently attached to the one or more microneedles, wherein at least one biomarker is a polynucleotide.

22. A device comprising a first microneedle, wherein the first microneedle is covalently or non-covalently attached to a first probe specific for a first biomarker.

23. The device of claim 22, wherein the first biomarker is a polynucleotide and the first probe is a polynucleotide complementary to the first biomarker.

24. The device of claim 22, wherein the first biomarker is a polypeptide.

25. The device of claim 22, wherein the first probe is an antibody specific for the first biomarker.

26. The device of claim 22, further comprising a second probe specific for a second biomarker, wherein the second probe is different from the first probe.

27. The device of claim 26, wherein the second probe is covalently or non-covalently attached to the first microneedle.

28. The device of claim 26, wherein the second probe is covalently or non-covalently attached to the second microneedle.

29. The device of claim 26, wherein the second biomarker is a polynucleotide and the second probe is a polynucleotide complementary to the second biomarker.

30. The device of claim 26, wherein the first probe specifically binds to a first nucleotide polymorphism and the second probe specifically binds to a second nucleotide polymorphism.

31. The device of claim 26, wherein the second biomarker is a polypeptide.

32. The device of claim 26, wherein the first and second probes are different antibodies each specific for a different epitope of the same biomarker.

33. The device of claim 22, wherein the first probe is attached to a plurality of microneedles.

34. The device of claim 22, wherein the first microneedle comprises a polymer, a metal, or a ceramic.

35. The device of claim 22, wherein the first microneedle comprises a polymer.

36. The device of claim 22, wherein the first probe is attached to the first microneedle via a connector.

37. The device of claim 36, wherein the linker is a thiol / amino bifunctional linker.

38. The device of claim 36, wherein the linker is a poly(ethylene glycol) linker.

39. The device of claim 22, wherein the first microneedle is formed on a substrate.

40. The device of claim 22, further comprising compartments for amplifying and identifying the first and second biomarkers.

41. The device of claim 22, wherein the center-to-center distance of the first microneedles is greater than 400 μm.

42. The device of claim 22, wherein the center-to-center distance of the first microneedles is greater than 200 μm and less than 1000 μm.

43. The device of claim 28, wherein the center-to-center distance of the second microneedles is greater than 400 μm.

44. The device of claim 28, wherein the center-to-center distance of the second microneedles is greater than 200 μm and less than 1000 μm.

45. A device comprising a plurality of microneedles, wherein the plurality of microneedles comprises at least one microneedle covalently or non-covalently attached to at least one probe specific for a biomarker, and the biomarker is indicative of a skin or eye condition.

46. ​​The device of claim 45, wherein the biomarker is indicative of a skin condition.

47. The device of claim 46, wherein the skin condition is skin cancer.

48. The device of claim 45, wherein the biomarker is indicative of an eye condition.

49. The device of claim 46, wherein the eye condition is eye inflammation or eye cancer.

50. The device of claim 45, wherein the biomarker is a polynucleotide and the at least one probe is complementary to the biomarker.

51. The device of claim 50, wherein the at least one probe comprises different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker.

52. The device of claim 45, wherein the biomarker is a peptide or polypeptide and the at least one probe is an antibody specific for the biomarker.

53. The device of claim 52, wherein the at least one probe comprises different antibodies specific for different epitopes of the same biomarker.

54. The device of claim 45, comprising a plurality of probes specific for a plurality of different biomarkers, wherein the plurality of probes are attached to the same or different microneedles.

55. The device of claim 54, wherein at least two different probes are attached to the same microneedle.

56. The device of claim 45, comprising at least two identical probes for specific biomarkers, wherein the at least two identical probes are attached to one or more microneedles.

57. The device of claim 45, wherein the microneedles comprise a polymer, a metal, or a ceramic.

58. The device of claim 57, wherein the microneedles comprise a polymer.

59. The device of claim 45, wherein the probe is attached to the microneedle via a connector.

60. The device of claim 59, wherein the linker is a thiol / amino bifunctional linker.

61. The device of claim 59, wherein the linker is a poly(ethylene glycol) linker.

62. The device of claim 45, wherein the plurality of microneedles are formed on a substrate.

63. The device of claim 45, further comprising a compartment for in situ amplification and identification of biomarkers captured by the probes.

64. A device comprising a plurality of microneedles, wherein the plurality of microneedles comprises at least one microneedle covalently or non-covalently attached to a probe specific for a biomarker, wherein the probe comprises a sensor that emits a light signal when the probe detects the biomarker.

65. The device of claim 64, wherein the optical signal of the probe increases when it detects the biomarker.

66. The device of claim 64, wherein the optical signal of the probe decreases when it detects the biomarker.

67. The device of claim 64, wherein the biomarker is a polynucleotide and the probe is a polynucleotide complementary to the biomarker.

68. The device of claim 67, wherein the probes are different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker.

69. The device of claim 64, wherein the biomarker is a peptide or polypeptide and the probe is an antibody specific for the biomarker.

70. The device of claim 69, wherein the probes are different antibodies specific for different epitopes of the same biomarker.

71. The device of claim 64, comprising a plurality of probes specific for a plurality of different biomarkers, wherein the plurality of probes are attached to the same or different microneedles.

72. The device of claim 64, wherein at least two different probes are attached to the same microneedle.

73. The device of claim 64, comprising at least two identical probes for specific biomarkers, wherein the identical probes are attached to one or more microneedles.

74. The device of claim 64, wherein the microneedles are made of a polymer, a metal, or a ceramic.

75. The device of claim 74, wherein the microneedles comprise a polymer.

76. The device of claim 64, wherein the probe is attached to the microneedle via a connector.

77. The device of claim 76, wherein the linker is a thiol / amino bifunctional linker.

78. The device of claim 76, wherein the linker is a poly(ethylene glycol) linker.

79. The device of claim 64, further comprising a compartment for in situ amplification and identification of biomarkers captured by the probes.

80. A composition comprising a plurality of microneedles coated with an agent capable of disrupting an extracellular matrix.

81. The composition of claim 80, wherein the agent is an enzyme.

82. The composition of claim 80, wherein the enzyme is selected from the group consisting of serine proteases, thiol proteases, MMPs, papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, α-chymotrypsin, α-amylase, DNase, collagenase, and sutiranase.

83. The composition of claim 80, wherein the enzyme is hyaluronidase.

84. A method for preparing a microneedle device, the method comprising: (a) obtaining a solution comprising an inorganic salt; (b) adding probes and microneedles to the solution; and (c) conjugating the probe to the microneedle in the solution.

85. The method of claim 84, wherein the inorganic salt is sodium chloride.

86. The method of claim 84, wherein the concentration of the inorganic salt is less than 2.5M.

Images