Recombinant CLEC9A gene and application thereof in improving immunity and disease resistance of animals

Abstract

The invention relates to the technical field of animal breeding, in particular to a recombinant CLEC9A gene and application of the recombinant CLEC9A gene in improvement of immunity and disease resistance of animals. The recombinant CLEC9A protein comprises an amino acid sequence as shown in SEQ ID NO. 1 and an amino acid sequence as shown in SEQ ID NO. The recombinant CLEC9A gene comprises a nucleotide sequence as shown in SEQ ID NO. 2; the application comprises improvement of immunity and disease resistance of animals. The recombinant CLEC9A gene is obtained by transforming the pig CLEC9A gene, the recombinant CLEC9A gene can be normally expressed, the expression of antigen treatment and presentation related genes can be remarkably improved when the recombinant CLEC9A gene is over-expressed in pig BMDC cells, meanwhile, the survival and multiplication capacities of the recombinant CLEC9A gene in an LPS induction environment are improved, and the recombinant CLEC9A gene has important significance in the field of animal breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of animal breeding, and in particular to a recombinant CLEC9A gene and application thereof in improving the immunity and disease resistance of animals. Background Art

[0002] At present, in the process of pursuing the economic benefits of pig farming, researchers often focus too much on the selection of yield-related traits and ignore the importance of disease resistance traits. However, with the continuous increase in breeding density and the decrease in animal activity, the disease resistance of pigs has gradually weakened. In addition, the excessive reliance on antibiotics in the breeding process has led to a more serious problem of bacterial resistance. These problems have seriously restricted the efficiency of pig genetic improvement and posed a threat to the healthy development of the pig industry. With the deepening of biotechnology and molecular genetics research, breeding new pig breeds with higher disease resistance has become an important direction at present. This can not only ensure the healthy growth of pigs, but also ensure the safety of pork products. In this context, animal gene modification technology, especially transgenic and gene editing technology, has shown great potential and application prospects. These technologies can conveniently and efficiently carry out specific genetic modification of animals, giving them heritable improved traits, such as improved disease resistance and stress resistance.

[0003] Cell death is an inevitable physiological response in the body's natural and physiological processes, such as embryonic development and tissue renewal, as well as when encountering extreme physical, chemical factors or severe pathological stimulation. For example, after viral infection, due to the self-replication of the virus and other activities, the metabolism of host cells will be severely disturbed, the organelles will be damaged, and eventually cell necrosis will occur. In animal immune recognition, C-type lectin 9 family A member (CLEC9A) plays a key role. As an activatable type II transmembrane receptor, it is highly expressed on dendritic cells, can recognize cell death signals, and promote the cross-presentation of antigens of dead cells to activated cytotoxic T lymphocytes, thereby initiating the body's clearance of dead cells. However, existing studies have not found the expression of CLEC9A in relevant tissues of pigs. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a recombinant CLEC9A gene and its application in improving the immunity and disease resistance of animals.

[0005] The prior art has not found the expression of CLEC9A in the relevant tissues of pigs, which may be due to the inability of the pig CLEC9A gene to express normally. The present invention modifies the pig CLEC9A gene to obtain a recombinant CLEC9A gene, and expressing the recombinant CLEC9A gene in pig dendritic cells can effectively upregulate the expression of genes related to antigen processing and presentation pathways, which shows that the recombinant CLEC9A gene can be used to enhance the immunity and disease resistance of pigs and be used for disease-resistant breeding of pigs.

[0006] In a first aspect, the present invention provides a recombinant CLEC9A protein comprising any one of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID NO.1; (2) The amino acid sequence of the amino acid sequence shown in SEQ ID NO.1 obtained by replacing, inserting or deleting one or more amino acids, and having the same functional protein.

[0007] In a second aspect, the present invention provides a recombinant CLEC9A gene, comprising any one of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO.2; (2) A nucleotide sequence encoding a protein with the same function obtained by replacing, deleting or inserting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO.2; (3) A nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions.

[0008] The present invention further provides a biological material comprising the recombinant CLEC9A gene; the biological material is an expression cassette, a vector or a cell.

[0009] Furthermore, the cells do not have the ability to develop into a complete plant individual or a complete animal individual.

[0010] The present invention further provides a kit comprising the recombinant CLEC9A protein, or the recombinant CLEC9A gene, or the biological material.

[0011] In a third aspect, the present invention provides the use of the recombinant CLEC9A protein, or the recombinant CLEC9A gene, or the biomaterial, or the kit in improving the immunity and disease resistance of animals, or improving the activity of animal cells.

[0012] The present invention further provides the use of the recombinant CLEC9A protein, or the recombinant CLEC9A gene, or the biological material, or the kit in the preparation of a drug for improving the immunity and disease resistance of an animal, or improving the activity of animal cells.

[0013] Furthermore, the improving the immunity and disease resistance of animals includes: improving the antigen processing and presentation ability of animals, or improving the anti-inflammatory ability of animals.

[0014] Furthermore, by increasing the expression level of the recombinant CLEC9A gene, the immunity and disease resistance of animals are improved; The recombinant CLEC9A gene includes the nucleotide sequence shown in SEQ ID NO.2.

[0015] Furthermore, the expression level of the recombinant CLEC9A gene is increased by the following method: The recombinant CLEC9A gene is constructed on a vector to obtain a recombinant plasmid; The recombinant plasmid is transduced into an animal.

[0016] Furthermore, the animal is a pig.

[0017] The present invention has the following beneficial effects: The present invention innovatively constructs a recombinant CLEC9A gene, which is obtained by editing the pig CLEC9A gene in various ways. The expression of the recombinant CLEC9A gene provided by the present invention can significantly enhance the immunity and disease resistance of pig cells, providing a new strategy for improving pig immunity and new material for conducting pig disease resistance breeding research. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 This is the plasmid map of the recombinant CLEC9A plasmid provided in Example 1 of the present invention.

[0020] Figure 2 The embodiment 2 of the present invention provides the method of using fluorescence quantitative PCR (qPCR) to detect the mRNA expression of the recombinant CLEC9A gene in the pig BMDC cells (HL) expressing the recombinant CLEC9A gene and the wild-type pig BMDC cells (NC).

[0021] Figure 3 The immunofluorescence technique provided in Example 2 of the present invention is used to detect the expression of the recombinant CLEC9A protein in 293T cells (HL-Flag) expressing the recombinant CLEC9A gene and 293T cells (NC) transfected with an empty vector.

[0022] Figure 4 This is the pathway situation of significantly enriched differentially expressed genes detected by RNA-seq between pig BMDC cells (HL) expressing the recombinant CLEC9A gene and pig BMDC cells (NC) transfected with an empty vector, as provided in Example 3 of the present invention.

[0023] Figure 5 The method provided in Example 3 of the present invention is to use CCK-8 to detect the cell activity of pig BMDC cells (HL) expressing the recombinant CLEC9A gene and pig BMDC cells (NC) transfected with an empty vector in an LPS stimulation environment. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] The experimental methods involved in the following examples, unless otherwise mentioned, are all conventional methods in the art, for example, reference may be made to experimental manuals in the art, or the conditions recommended in the manufacturer's instructions.

[0026] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources, for example: Example 1

[0027] The present invention provides a construction process of a recombinant CLEC9A gene plasmid, comprising the following steps: The present invention first downloads the porcine CLEC9A gene (accession number: XM_021091240.1) from the NCBI database (http: / / www.ncbi.nlm.nih.gov / ). Since the porcine CLEC9A gene lacks the third exon, and its CDS region lacks a base at the 268th and 544th sites of the 4th and 6th exons, and a stop codon is formed at the 436-438th sites of the 5th exon and the 505-507th sites of the 6th exon, frameshift mutations are caused, making it impossible for pigs to express the CLEC9A functional protein that is conserved among species.

[0028] The present invention edits the base sequence of the CDS region of the porcine CLEC9A gene so that its mutation sites all express the same amino acid as the corresponding position of the human CLEC9A gene (accession number: NM_207345.4). The T base is inserted into the 268th position of the porcine CLEC9A CDS region so that the codon is ATC, which corresponds to ATT isoleucine I at the same position of the human CLEC9A gene, the stop codon at the 436-438th position is changed from TGA to TGG, which corresponds to TGG tryptophan W, the stop codon at the 436-438th position is changed from TAG to CAG, which corresponds to CAA proline P, and T is inserted into the 544th position so that the codon is TAC, which corresponds to TCT serine S. At the same time, the human third exon sequence is introduced to construct a plasmid similar to the human CLEC9A gene, and the coding sequence of the obtained recombinant CLEC9A gene is shown in SEQ ID NO.2, and the protein sequence encoded by the recombinant CLEC9A gene is shown in SEQ ID NO.1.

[0029] The present invention adds a 3×Flag tag sequence before the last stop codon TGA: GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAG for subsequent detection. The recombinant sequence was synthesized by a biological company (Beijing Qingke Biotechnology Co., Ltd.) and constructed on the pcDNA3.1 backbone to obtain the target plasmid, named pcDNA3.1-CLEC9A (HL) -Flag (hereinafter also referred to as recombinant CLEC9A plasmid), and the plasmid map is shown in Figure 1 As shown, the sequencing sequence is SEQ ID NO.3.

[0030] Example 2

[0031] This example further transfects the recombinant CLEC9A plasmid constructed in Example 1, and detects the expression level of the recombinant CLEC9A gene, including the following process: 1. FLT3L-BMDC cell acquisition and culture

[0032] The present invention places pig bone marrow tissue in a 10 cm culture dish containing 10 mL phosphate buffered saline (PBS) (Gibco) and disperses it using the rubber end of a 20 mL syringe piston. The suspension is passed through a filter with a diameter of 70 μm and collected in a 50 mL centrifuge tube. After repeated rinsing with PBS and centrifugation at 1500 rpm for 5 min, the final bone marrow cells are obtained. The cells are resuspended with 12 mL DMEM / F12 culture medium (Gibco), 10% fetal bovine serum, 1% penicillin-streptomycin and 20 ng / mL FLT3L protein (from the Institute of Biophysics, Chinese Academy of Sciences), and the production of FLT3L-BMDC cells (hereinafter also referred to as pig BMDC cells) is maintained in a 10 cm culture dish.

[0033] 2. Plasmid transfection

[0034] The cells were evenly plated in a 24-well cell culture plate containing DMEM / F12 medium containing 10% fetal bovine serum. When the cell density reached 60%, Lipofectamine TM 2000 (Invitrogen) transfection reagent, transfection steps and detection were performed according to the instructions. The transfection system is shown in the table below.

[0035]

[0036] 3. qPCR analysis

[0037] Using the porcine HPRT1 gene as the internal reference gene, RNA extraction, reverse transcription, and fluorescence quantitative PCR were performed on porcine BMDC cells transfected with the recombinant CLEC9A plasmid and wild-type porcine BMDC cells to detect the expression of the recombinant CLEC9A gene. The primers are as follows:

[0038] The qPCR system is as follows:

[0039] Note: ChamQ Universal SYBR qPCR Master Mix is ​​a universal high-sensitivity dye-based quantitative PCR detection kit from Vazyme.

[0040] The qPCR program was as follows: 94°C for 2 min, followed by 94°C for 15 s, 55°C for 15 s, and 72°C for 20 s for 40 cycles. -△△C Methods Analysis of qPCR data.

[0041] The present invention uses qPCR technology to examine the expression level of CLEC9A mRNA in pig BMDC cells transfected with recombinant CLEC9A plasmid. Figure 2 As shown: The recombinant CLEC9A gene can be expressed in porcine BMDC ( Figure 2 ).

[0042] 4. Use immunofluorescence experiment to detect the expression of recombinant CLEC9A plasmid protein.

[0043] The present invention transfects the recombinant CLEC9A plasmid into the 293T cell line as the experimental group, and transfects the pcDNA3.1 into the 293T cell line as the control group, until the confluence reaches about 90%. The cells were fixed with 4% paraformaldehyde (BeyotimeBio) at room temperature for 1 h and permeated with 0.2% Triton X-100 (BeyotimeBio) for 10 min. Then they were washed twice with PBS and blocked with 10% fetal bovine serum (dissolved in PBS) for 20 min. The cells were labeled with primary antibody (Flag, 1:1000) (Abmart) at 4°C overnight. The next day, the cells were washed 3 times with PBS and then stained with Alexa Fluor™ 488 secondary antibody (1:1000) (Solarbio) at room temperature for 1 h. The cell nuclei were stained with 4,6-diamino-2-phenylindole (DAPI) (Calbiochem). Observation was performed using a fluorescence microscope (EchoLaboratories).

[0044] The results are as follows Figure 3 Shown: Immunofluorescence experiments demonstrated that the recombinant CLEC9A gene can express the complete CLEC9A protein that is conserved among species.

[0045] Example 3

[0046] The present invention further verifies the function of the recombinant CLEC9A gene described in Example 1, including the following process: 1. Use RNA-seq to verify the changes in genes related to antigen processing and presentation after expressing the recombinant CLEC9A gene

[0047] The present invention uses TRIzol ®Total RNA was isolated from cell samples (porcine BMDC cells transfected with recombinant CLEC9A plasmid and porcine BMDC cells transfected with pcDNA3.1 empty vector) using the reagent (Tiangen Biochemical Technology (Beijing) Co., Ltd.) according to the manufacturer's guidelines. The quality and integrity of RNA were assessed using the Nanodrop ND-2000 system (Thermo Scientific) and the Agilent Bioanalyzer 4150 system (Agilent Technologies). Paired-end libraries were prepared using the ABclonal mRNA-seq library preparation kit (Abclonal) according to the manufacturer's instructions and sequenced at 150 bp on an Illumina Novaseq 6000 sequencer (Illumina). Sequencing data were quality controlled, filtered, and mapped to the porcine reference genome (Sus scrofa v11.1, GenBank accession number GCF_00003025.6) using HISAT269v2.1.0. Transcripts per kilobase per million mapped reads (TPM) were calculated for gene expression, and differentially expressed genes (DEGs) analysis was performed using the R package DESeq270v1.16.1 based on a threshold of pvalue < 0.05 and |log2FoldChange| ≥ 1. KEGG enrichment analysis was performed in the R package ClusterProfiler71 v4.0.

[0048] The results of the top five KEGG pathways and corresponding pathway genes that were significantly enriched for differentially up-regulated genes are as follows Figure 4 As shown in the figure. Compared with pig BMDC cells transfected with pcDNA3.1 empty vector, the genes with upregulated expression levels in pig BMDC cells transfected with recombinant CLEC9A plasmid were mainly genes related to antigen processing and presentation. This indicates that the antigen processing and presentation ability of pig BMDC cells transfected with recombinant CLEC9A gene has been enhanced, and antigen processing and presentation ability is the main immune pathway.

[0049] 2. Using CCK-8 detection, it was found that expressing the recombinant CLEC9A gene can significantly enhance the cell activity of pig BMDC cells in the LPS culture environment.

[0050] In the present invention, porcine BMDC cells were inoculated in a 96-well plate and cultured in a basal medium. After 48 h of transfection with the recombinant CLEC9A plasmid and pcDNA3.1 empty vector, the cells were stimulated with lipopolysaccharide (LPS) (BeyotimeBio) for 24 h, and the cell proliferation and activity were detected using a CCK-8 (BeyotimeBio) kit according to the manufacturer's protocol. After incubation for 1 h, the cells were analyzed using a SpectraMax ® The absorbance at 450 nm was measured with an i3x multi-mode microplate reader (Molecular Devices Corporation).

[0051] The results are as follows Figure 5 As shown. Compared with pig BMDC cells transfected with an empty vector, the cell activity of pig BMDC cells expressing the recombinant CLEC9A gene was significantly upregulated, and in the LPS-induced environment, the cell activity of cells expressing the recombinant CLEC9A gene was significantly upregulated. This indicates that the recombinant CLEC9A gene can significantly enhance the survival and proliferation ability of pig BMDC cells in an inflammatory environment caused by bacteria.

[0052] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A recombinant CLEC9A protein, characterized in that: It includes the amino acid sequence shown in SEQ ID NO.

1.

2. A recombinant CLEC9A gene, characterized in that: It includes the nucleotide sequence shown in SEQ ID NO.

2.

3. A biomaterial, characterized in that: The biological material comprises the recombinant CLEC9A gene according to claim 2; the biological material is an expression cassette, a vector or a cell.

4. A kit, characterized in that: The kit comprises the recombinant CLEC9A protein according to claim 1, or the recombinant CLEC9A gene according to claim 2, or the biological material according to claim 3.

5. Use of the recombinant CLEC9A protein according to claim 1, or the recombinant CLEC9A gene according to claim 2, or the biomaterial according to claim 3, or the kit according to claim 4 in improving the immunity and disease resistance of animals, or improving the activity of animal cells.

6. Use of the recombinant CLEC9A protein according to claim 1, or the recombinant CLEC9A gene according to claim 2, or the biomaterial according to claim 3, or the kit according to claim 4 in the preparation of a drug for improving the immunity and disease resistance of an animal, or improving the activity of animal cells.

7. The use according to claim 5 or 6, characterized in that: The improving the immunity and disease resistance of animals includes: improving the antigen processing and presentation ability of animals, or improving the anti-inflammatory ability of animals.

8. The use according to claim 5 or 6, characterized in that: By increasing the expression level of the recombinant CLEC9A gene, the immunity and disease resistance of animals are improved; The recombinant CLEC9A gene includes the nucleotide sequence shown in SEQ ID NO.

2.

9. The use according to claim 8, characterized in that: The expression level of the recombinant CLEC9A gene is increased by the following method: The recombinant CLEC9A gene is constructed on a vector to obtain a recombinant plasmid; The recombinant plasmid is transduced into an animal.

10. The use according to claim 5 or 6, characterized in that: The animal is a pig.

Images