Penicillium fungus GS218, Penicillium fungus GS218 conidia suspension and preparation method and application thereof
Through the suspension of Penicillium fungus GS218 and its conidia suspension antagonize a variety of plant pathogens, the environmental pollution caused by chemical control is solved, and the significant prevention and control effect on a variety of plant diseases is achieved.
Patent Information
- Application Number
- CN202411306365.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-19
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2044-09-19
AI Technical Summary
The existing technology has problems of environmental pollution and ecological damage in plant disease prevention and control. Chemical control methods bring food residues, and an environmentally friendly and effective biological control technology is needed.
A method for preparing a Penicillium fungus GS218 and its conidia suspension is provided, and it is used to prevent and treat plant diseases by antagonizing a variety of fungal pathogens.
The fungus of Penicillium GS218 of Penicillium significantly inhibits HLB13 Fusarium bruceliaceae, Fusarium sacchariae, Fusarium apicus cucumber specialization and Botrytis auricus, slows down the incidence of plants, and provides effective prevention and treatment of carrot diseases, chili anthrax, chili root rot, cucumber blight and tomato grey mildew.
Smart Images

Figure CN119662414B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microbial strains and applications thereof, and in particular to a Penicillium GS218 fungus, a Penicillium GS218 conidia suspension, and a preparation method and application thereof. Background Art
[0002] Plant diseases, a major limiting factor in agricultural production, pose a serious threat to global agriculture and food security. While traditional chemical pest control methods can control plant diseases to a certain extent, they also lead to environmental pollution, ecological damage, and food residues, sparking interest in sustainable and environmentally friendly plant disease control technologies. With the recent rise of green organic agriculture, the active exploration of biological control technologies to replace or partially replace pesticides has become a research hotspot.
[0003] Endophytes are fungi or bacteria that live within the tissues and organs of healthy plants at certain or all stages of their life. They are commonly found in higher plants, including woody and herbaceous plants, and in both monocots and dicots. Currently, plant endophytes have been exploited as potential microbial pesticides, yield-enhancing bacteria, and as potential biocontrol agents in biocontrol applications.
[0004] As a potential biocontrol fungus, Penicillium has extensive research value in biological control. Actively screening related strains, tapping into microbial resources, and screening out new, highly active, and functionally stable strains are of great significance for the prevention and control of plant diseases. Summary of the Invention
[0005] The present invention aims to address the above-mentioned technical problems by providing a new Penicillium species, GS218, a conidial suspension of this species, and its preparation and use. This strain exhibits antagonism against a variety of fungal pathogens and exhibits significant and stable technical effects in controlling plant diseases, demonstrating broad application value in the field of microbial strain application technology.
[0006] To achieve the above object, the present invention provides the following technical solutions:
[0007] The present invention first provides a Penicillium fungus, which is named Penicillium sp. GS218 and deposited in the China Center for Type Culture Collection on July 3, 2024, with a deposit number of CCTCC NO: M 20241477 and a deposit address of Wuhan University, Wuhan City, Hubei Province, China.
[0008] Based on the above scheme, the Penicillium fungus GS218 was isolated from the fruit of the trifoliate orange at the base of Hunan Horticultural Research Institute, Donghu Street, Furong District, Changsha City, Hunan Province.
[0009] Based on the above scheme, the morphology of the Penicillium fungus GS218 colony is: when cultured on PDA culture medium, the front of the colony is white, the surface is dry and opaque, the hyphae are velvety, the center of the back of the colony is brown, the surrounding area is yellow, the middle is thick, and the edges are thin.
[0010] Based on the above scheme, the PDA culture medium formula is: potato extract powder 6-8g / L, glucose 20-22g / L, agar 20-22g / L, prepared with water, pH 5.6±0.2.
[0011] Based on the above scheme, the ITS rDNA sequence of the Penicillium fungus GS218 is shown as SEQ ID NO.3.
[0012] The present invention also provides a method for preparing a conidia suspension of Penicillium GS218, comprising the following steps:
[0013] The Penicillium fungus GS218 is cultured on a culture medium plate at a constant temperature of 30-35° C. for 5-7 days. After the culture is completed, sterile water is added, the mixture is fully shaken, and the conidia on the culture medium plate are washed off. The conidia are then filtered, and the filtrate is the conidia suspension.
[0014] On the basis of the above scheme, the preparation method further comprises: using a hemocytometer to determine the concentration of conidia in the conidia suspension, and then preparing a conidia suspension with a concentration of 1×10 6 -10 9 CFU / mL of conidia suspension.
[0015] On the basis of the above scheme, the culture medium is PDA culture medium.
[0016] Based on the above scheme, the PDA culture medium formula is: potato extract powder 6-8g / L, glucose 20-22g / L, agar 20-22g / L, prepared with water, pH 5.6±0.2.
[0017] On the basis of the above scheme, the filtration is sterilized absorbent cotton filtration.
[0018] The conidia suspension of Penicillium fungus GS218 was prepared according to the above preparation method.
[0019] The present invention also provides a use of the Penicillium fungus GS218 or the conidia suspension of the Penicillium fungus GS218 in inhibiting plant fungal pathogens.
[0020] Based on the above scheme, the plant fungal pathogens include any one of HLB13 Fusarium boothii, Colletotrichum sp., Fusarium solani, Fusarium oxysporumf.sp.cucumerinum, Foc, and Botrytis cinerea.
[0021] Beneficial effects of the present invention:
[0022] The present invention provides a new Penicillium sp. fungus (Penicillium sp.) GS218. Through a plate confrontation experiment, it was found that the new Penicillium sp. fungus has a good antagonistic effect on HLB13 Fusarium brucelli, Colletotrichum spp., Fusarium solani, Fusarium oxysporum cucumber-specific type, and Botrytis cinerea. Through a plant leaf disease resistance experiment, it was further verified that a conidia suspension of the strain can inhibit the growth of HLB13 Fusarium brucelli, Colletotrichum spp., Fusarium solani, Fusarium oxysporum cucumber-specific type, and Botrytis cinerea, significantly slow down the disease development of plants, and has a good preventive and control effect on carrot diseases caused by HLB13 Fusarium brucelli, pepper anthracnose caused by Colletotrichum spp., pepper root rot caused by Fusarium solani, cucumber wilt caused by Fusarium oxysporum cucumber-specific type, and tomato gray mold caused by Botrytis cinerea, thus finding a new direction for the prevention and control of plant diseases. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 The colony morphology of Penicillium sp. GS218 on the front of the plate is shown in Figure 1.
[0024] The formula of PDA medium is as follows: 6 g potato extract powder, 20 g glucose, 20 g agar, dissolved in water, and finally adjusted to 1000 mL, pH 5.6 ± 0.2, and sterilized by autoclaving at 121 °C for 20 min.
[0025] The formula of MEA medium is as follows: 30 g malt extract, 3 g soy peptone, 20 g agar, dilute to 1000 mL with distilled water, adjust the pH to 5.6 ± 0.2, and sterilize by autoclaving at 121 °C for 20 min.
[0026] The formula of CMA medium is as follows: 25 g cornstarch, 20 g agar, distilled water to 1000 mL, pH adjusted to 5.6 ± 0.2, and autoclaved at 121 °C for 20 min;
[0027] The formula of OA medium is as follows: 30 g oatmeal, 0.005 g CuSO4·5H2O, 0.01 g ZnSO4·7H2O, 20 g agar, distilled water to 1000 mL, pH 6.5±0.2, and autoclaved at 121°C for 20 min.
[0028] Figure 2 This is a colony morphology of Penicillium sp. GS218 on the back of a PDA culture medium plate;
[0029] Figure 3 These are scanning electron microscope images of the microscopic morphology of Penicillium sp. GS218, where A and B are detailed images of conidiophores and conidia of GS218;
[0030] Figure 4 Phylogenetic tree analysis of ITS rDNA sequences of Penicillium sp. GS218 constructed by the neighbor-joining method.
[0031] Figure 5 This is a diagram showing the antagonistic effect of Penicillium sp. GS218 on HLB13 Fusarium brucei, wherein A: HLB13 Fusarium brucei; B: a diagram showing the confrontation culture effect of Penicillium sp. GS218 and HLB13 Fusarium brucei.
[0032] Figure 6 This is a diagram showing the antagonistic effect of Penicillium sp. GS218 on Colletotrichum spinulosa, wherein A: Colletotrichum spinulosa; B: a diagram showing the confrontation culture effect of Penicillium sp. GS218 and Colletotrichum spinulosa.
[0033] Figure 7 This is a diagram showing the antagonistic effect of Penicillium sp. GS218 on Fusarium solani, wherein A: Fusarium solani; B: the confrontation culture effect of Penicillium sp. GS218 and Fusarium solani.
[0034] Figure 8 These are diagrams showing the antagonistic effect of Penicillium sp. GS218 on the cucumber-specific form of Fusarium oxysporum, wherein A: Fusarium oxysporum cucumber-specific form; B: diagram showing the confrontation culture effect of Penicillium sp. GS218 and Fusarium oxysporum cucumber-specific form.
[0035] Figure 9The diagram shows the antagonistic effect of Penicillium sp. GS218 on Botrytis cinerea, wherein A: Botrytis cinerea; B: confrontation culture effect of Penicillium sp. GS218 and Botrytis cinerea. DETAILED DESCRIPTION
[0036] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, other embodiments obtained by ordinary technicians in this field without making creative efforts are all within the scope of protection of the present invention.
[0037] The bacterial culture medium used in the following examples is as follows:
[0038] The formula of PDA culture medium is as follows: 6 g potato extract powder, 20 g glucose, 20 g agar, dissolved in water, and finally adjusted to 1000 mL, pH 5.6±0.2, and autoclaved at 121°C for 20 min.
[0039] Example 1 Isolation, Purification and Identification of Penicillium sp. GS218
[0040] (1) Isolation and purification of strains
[0041] Fresh, disease-free fruits of the trifoliate orange tree were collected from the Hunan Horticultural Research Institute in Furong District, Changsha City, Hunan Province. After being rinsed with tap water and disinfected with 5% sodium hypochlorite and 75% alcohol, the fruit endophytic fungus was isolated using the dilution spread plate method. The fruit was then cultured on polydimethylsiloxane (PDA) medium in a 30°C incubator for 7 days. The strain was purified using the hyphal tip cutting method and designated GS218. GS218 was cut into 750 μL of sterile glycerol, gently shaken to mix, and stored at -80°C for long-term storage.
[0042] (2) Classification and identification
[0043] Colony morphology of strain GS218: Strain GS218 grew well on PDA medium. After 7 days of incubation at 30°C, colonies formed approximately 3.5 cm in diameter. The front of the colony was white, with a dry, opaque surface and fuzzy hyphae. The back of the colony was brown in the center and surrounded by yellow, with a thick center and thin edges, and the colonies grew densely. Conidia of strain GS218 were spherical, 2-2.5 μm in diameter, with smooth walls and spore stalks measuring (30-40 × 2.5-3) μm. Figure 1 The colony morphology of strain GS218 on the front of the plate on different culture media; Figure 3 This is a scanning electron microscope image of the microscopic morphology of strain GS218.
[0044] The ITS rDNA gene of strain GS218 was sequenced: the ITS rDNA gene was amplified using the universal primers ITS5 / ITS4 for fungi (sequences shown in SEQ ID NO.1 and SEQ ID NO.2). The gene sequence obtained after the PCR product was sent for sequencing (the nucleotide sequence of the ITS rDNA gene is shown in SEQ ID NO.3) was compared and analyzed in NCBI, and a phylogenetic tree was constructed. Figure 4 As shown, strain GS218 shared the highest homology with Penicillium nepalense culture CBS:203.84, with a sequence similarity of 97.28%. A phylogenetic tree constructed using MEGA 7.0 software revealed that strain GS218 and Penicillium nepalense culture CBS:203.84 clustered on the same branch with a confidence level of 100%. Molecular identification of the strains confirmed GS218 as a new species of Penicillium sp., and taxonomically named Penicillium sp. GS218.
[0045] The nucleotide sequence of the universal primer ITS5 is 5 ′ -GGAAGTAAAAGTCGTAACAAGG-3 ′ , as shown in SEQ ID NO.1;
[0046] The nucleotide sequence of the universal primer ITS4 is 5 ′ -TCCTCCGCTTATTGATATGC-3 ′ , as shown in SEQ ID NO.2.
[0047] The nucleotide sequence of the ITS rDNA gene is shown in SEQ ID NO.3:
[0048] CTGTGCGATGGACGCAATGATTCCTTCCGCAGTGTACACTTATCGAAGCCTTTGCAGCCACGCAAGTGGTAGACCCGGCACGACTCTAAACAAGGCCAGTCGCGATGCAAGTCGGCACCCGCCGGCGACACTTTCGAATTGACGGGGACACCCTAAAGCCGATCGCACCAACCCGCGGCGGGAAACCGCCCGGGGGCCCGTGGTAATGACACGGGGGATGGTAATAGACGATCCGGATACTTCTGCGGCGCCGCCGTAGAGACCATGGGCAATCCGCAGCGAAGCCTCTAAGTCCCCCCGCCGGGATACGAGGAACGTCCACAGACTAAGTGGAAGTGGGTGGGGGACTCCGTTCCCCCGCTTAAGATATAGTCGGGCCCCCCGGGAGACCGGGGGGGTGAGTACACTGCAACTCTGAAACAAACCCGTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGCAAGGCCGCCGGGGGGCTTCCGTCCCCGGGCCCGCGCCCGCCGAAGACACCTGTGAACGCTGTATGAAGATTGCAGTCTGAGCGAAAAGCTAAATTTATTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCTCGTCCCCCGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCTGCCGACACCATCAATCTTTTTTCCAGGTGACCTCGGATCAGGT
[0049] Example 2 Antagonistic Experiment of Penicillium sp. GS218 against HLB13 Fusarium brucei, Colletotrichum spinosum, Fusarium solani, Fusarium oxysporum cucumber-specific type, and Botrytis cinerea
[0050] The plate confrontation method was used: HLB13 Fusarium brucei, Colletotrichum spinulosum, Fusarium solani, Fusarium oxysporum cucumber-specific type, and Botrytis cinerea were inoculated in the center of the PDA culture medium plate, and Penicillium sp. GS218 was inoculated 2 cm away from the center of the culture medium using the cross method; the control group was not inoculated with Penicillium sp. GS218, and the culture was kept at 30℃ for 7 days. The width of the inhibition zone was measured, and each group was treated with 3 replicates. The results are shown in the figure. Figure 5-9 and as shown in Table 1.
[0051] Inhibition rate (%) = (control colony diameter - treated colony diameter) / control colony diameter * 100%
[0052] Table 1 Inhibitory effect of Penicillium sp. GS218 on HLB13 Fusarium brucei, Colletotrichum spinosum, Fusarium solani, Fusarium oxysporum cucumber-specific type and Botrytis cinerea
[0053]
[0054] The results are as follows Figure 5-9 As shown in Table 1, Penicillium sp. GS218 had a significant antagonistic effect on HLB13 Fusarium brucelli, Colletotrichum spp., Fusarium solani, Fusarium oxysporum cucumber-specific type, and Botrytis cinerea, with inhibition rates of 56.57%, 60.75%, 60.38%, 51.37%, and 60.86%, respectively, indicating that Penicillium sp. GS218 had a good antagonistic effect on HLB13 Fusarium brucelli, Colletotrichum spp., Fusarium solani, Fusarium oxysporum cucumber-specific type, and Botrytis cinerea.
[0055] Example 3 Preparation of Penicillium sp. GS218 conidia suspension
[0056] Penicillium sp. GS218 was cultured on PDA medium at 30°C for 7 days, and then 10 mL of sterile water was added and shaken thoroughly to elute the conidia. The conidia fell into the sterile water and were filtered with sterilized absorbent cotton. The filtrate was the conidia suspension of the strain. The concentration of conidia in the conidia suspension was measured by a hemocytometer and was 1×10 9CFU / mL. Then, add sterile water to dilute as needed to prepare a conidia concentration of 1×10 5 CFU / mL, 1×10 6 CFU / mL, 1×10 7 CFU / mL, 1×10 8 CFU / mL, 1×10 9 CFU / mL of conidia suspension.
[0057] Example 4 Disease resistance test of Penicillium sp. GS218 conidia suspension in plant leaves
[0058] Healthy carrot, pepper, cucumber, and tomato leaves with similar growth were selected, rinsed with sterile water, and air-dried. They were placed in an inoculation basin and moistened with wet absorbent cotton. All leaves were pierced with sterile cotton swabs. Five treatment groups were set according to the spraying concentration of Penicillium sp. GS218 conidia: T1 (1×10 5 CFU / mL), T2(1×10 6 CFU / mL), T3 (1×10 7 CFU / mL), T4 (1×10 8 CFU / mL) and T5 (1×10 9 Each treatment group was treated with the same volume of spore suspension sprayed. After a 10-minute wait, leaves were inoculated with HLB13 Fusarium brucei, Colletotrichum spinosum, Fusarium solani, Fusarium oxysporum cucumber-specific, and Botrytis cinerea, corresponding to the plant species and disease (carrot disease, pepper anthracnose, pepper root rot, cucumber wilt, and tomato gray mold). A control group (CK) was evenly sprayed with sterile water. Six leaves per treatment were used as a replicate, and three replicates were performed. The leaves were then covered with plastic wrap and incubated in a 28°C incubator with alternating light and dark conditions for 7 days. Disease development was observed regularly, and the disease severity, disease index, and endophyte control efficacy were recorded. The disease index and control efficacy were calculated as follows: disease index = Σ(number of diseased plants × corresponding disease level) / total number of plants × highest disease level × 100; control efficacy = (control disease index - treatment disease index) / control disease index × 100%. The results are shown in Table 2.
[0059] Table 2 Disease index and relative control effect of carrot diseases, pepper anthracnose, pepper root rot, cucumber wilt and tomato gray mold
[0060]
[0061]
[0062]
[0063] According to the analysis in Table 2, after treatment with Penicillium sp. GS218 conidia suspension, the disease index of crops such as carrots, peppers, cucumbers, and tomatoes was significantly lower than that of the control group. Different concentrations of Penicillium sp. GS218 conidia suspensions all had certain control effects on carrot diseases caused by HLB13 Fusarium brucei, pepper anthracnose caused by Colletotrichum spinulosum, pepper root rot caused by Fusarium solani, cucumber wilt caused by the cucumber-specific form of Fusarium oxysporum, and tomato gray mold caused by Botrytis cinerea. Moreover, as the concentration of Penicillium sp. GS218 conidia in the suspension gradually increased, its overall control effect on crop diseases showed an overall trend of first increasing and then decreasing. Among them, the T4 treatment, i.e., the GS218 conidia concentration was 1×10 8 When the concentration of conidia suspension was 1.577 CFU / mL, the conidia suspension of Penicillium sp. GS218 had the best control effect on different crop diseases, including carrot disease caused by HLB13 Fusarium brucei, pepper anthracnose caused by Colletotrichum spinulosum, pepper root rot caused by Fusarium solani, cucumber wilt caused by the cucumber-specific type of Fusarium oxysporum, and tomato gray mold caused by Botrytis cinerea.
Claims
1. A Penicillium fungus ( Penicillium sp. )GS218, characterized in that The Penicillium fungus was deposited in the China Center for Type Culture Collection on July 3, 2024, with the deposit number: CCTCC NO: M 20241477, and the deposit address: Wuhan University, Wuhan City, Hubei Province, China.
2. A method for preparing a conidia suspension of Penicillium GS218, comprising the following steps: The Penicillium fungus GS218 according to claim 1 is cultured on a culture medium plate at a constant temperature of 30-35° C. for 5-7 days. After the culture is completed, sterile water is added, the mixture is fully shaken, the conidia on the culture medium plate are washed off, and then filtered. The filtrate is a conidia suspension.
3. The preparation method according to claim 2, characterized in that The preparation method further comprises: using a hemocytometer to determine the concentration of conidia in the conidia suspension, and then preparing a suspension with a conidia concentration of 1×10 6 -10 9 CFU / mL of conidia suspension.
4. The preparation method according to claim 2, characterized in that The culture medium is PDA culture medium.
5. The preparation method according to claim 4, characterized in that The PDA culture medium is formulated as follows: 6-8 g / L potato extract, 20-22 g / L glucose, and 20-22 g / L agar, prepared with water, with a pH of 5.6±0.
2.
6. The preparation method according to claim 2, characterized in that The filtration is performed through sterilized absorbent cotton.
7. A conidia suspension of Penicillium GS218 obtained according to the preparation method according to any one of claims 2 to 6.
8. Use of the Penicillium GS218 according to claim 1 or the Penicillium GS218 conidia suspension according to claim 7 in inhibiting plant fungal pathogens; the plant fungal pathogens include Fusarium brucei ( Fusarium boothii ), Fusarium solani ( Fusarium solani ), Fusarium oxysporum cucumber-specific type ( Fusarium oxysporum f. sp. cucumerinum ), Botrytis cinerea ( Botrytis cinerea )
Citation Information
Patent Citations
Method for regulating and controlling diversity of fungi in airport soil by waste and old colloidal particle-filled matrix
CN108315383A
Plant endophytic fungus Penicillium adalendum JSNL-ZJ87 strain, biocontrol inoculant and application of biocontrol inoculant
CN118256358A