Fermentation liquor of raw land combined with aspergillus niger and application thereof

Abstract

The application discloses a kind of raw soil combined with fermentation liquor of aspergillus niger, and is the fermentation liquor obtained by fermenting aspergillus niger XO-2 on raw soil, specifically, aspergillus niger XO-2 is inoculated on raw soil to carry out fermentation, after fermentation, filtration, and the filtrate is the fermentation liquor of raw soil combined with aspergillus niger.The application separates and screens a strain of aspergillus niger from soil, and the fermentation liquor obtained by combining the aspergillus niger XO-2 with raw soil has a good toxic effect on second instar larvae of meloidogyne hapla chitwood, and can inhibit the hatching of eggs, which is of great significance for enriching plant parasitic nematode biocontrol bacteria resources and developing nematicidal plant and microbial source pesticides or pesticide fertilizers.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular to a fermentation liquor of raw earth combined with Aspergillus niger and application thereof. BACKGROUND

[0002] Nematode disease caused by plant parasitic nematodes is a serious soil-borne disease, which has a wide host range and threatens agricultural production. For a long time, the prevention and control of crop nematode disease mainly relies on chemical control. However, the unreasonable use of chemical agents can easily lead to the increase of nematode resistance, and also easily cause environmental pollution and harm human health. Therefore, actively developing new types of nematicides is an important problem that needs to be solved in production. The research and development of microorganisms and their metabolites have been a research hotspot in recent years. The antagonistic effect of biocontrol fungi on plant nematodes mainly includes capturing nematodes through sticky hyphae (net, knot, ring, etc.), parasitizing nematodes through conidia or appressoria, metabolizing nematodes, and inducing the anti-nematode ability of plants. With the in-depth research, more and more studies on the use of biocontrol fungi (Liang et al., 2019), secondary metabolites (Mwanauta et al., 2014) combined with plant resources to prevent and control plant parasitic nematode disease in agricultural crop management. A number of studies have shown that the combination of biocontrol fungi and plant resources can enhance the nematicidal activity. For example, the combination of Paecilomyces lilacinus and neem reduced the number of citrus puncture nematodes by 78.0%-88.8%, and promoted the yield of citrus (Seenivasan et al., 2020); the combination of Bacillus and bio-organic fertilizer reduced the number of root nodules and increased the fresh weight of the aboveground part of the plant, with a control effect of 81.14% (Chen Fang, 2011). The combination of Glomus fasciculatum and mustard seed cake and neem cake effectively reduced the number of southern root-knot nematode root nodules and improved the yield of mung beans (Jena et al, 2021). Therefore, the development of biocontrol fungi combined with plant resources can not only prevent and control root-knot nematode disease, but also has the function of fertilizer, and can improve the soil environment, which meets the demand of the national green development strategy. SUMMARY

[0003] To solve the above technical problems, the present application provides a strain of Aspergillus niger XO-2 for preventing and controlling plant parasitic nematodes.

[0004] To achieve the above-mentioned purpose, the technical solutions provided by the present application are as follows:

[0005] A fermentation liquor of raw earth combined with Aspergillus niger is a fermentation liquor obtained by fermenting Aspergillus niger XO-2 on raw earth, specifically, Aspergillus niger XO-2 is inoculated on raw earth for fermentation, and after fermentation, the fermentation liquor is filtered to obtain the fermentation liquor of raw earth combined with Aspergillus niger.

[0006] Preferably, the raw soil combined with the fermentation liquor of Aspergillus niger is adjusted to a concentration of 0.4 mg / mL-25 mg / mL with deionized water.

[0007] Preferably, the Aspergillus niger XO-2 is Aspergillus niger XO-2, deposited in the China General Microbiological Culture Collection Center on August 26, 2024, with a preservation number of CGMCC No.41492 and a preservation address of No.3, Beichen West Road, Chaoyang District, Beijing.

[0008] Preferably, the inoculation amount is 1 Aspergillus niger XO-2 cake with a diameter of 9 mm per 5 g of raw soil.

[0009] Preferably, the fermentation is carried out at 28°C and 160 r / min for 14-16 days, preferably 15 days.

[0010] Preferably, the filtration is simple filtration with filter paper for solid-liquid separation, and the filtrate is taken.

[0011] Preferably, the raw soil is traditional Chinese medicine raw soil obtained after sterilization at 121°C for 20 min. The raw soil combined with the fermentation liquor of Aspergillus niger is used in the application for preventing and treating nematodes.

[0012] Preferably, the nematode is Meloidogyne enterolobii.

[0013] Compared with the prior art, the application has the following beneficial effects:

[0014] The application screens a strain of Aspergillus niger from soil. The fermentation liquor of the Aspergillus niger XO-2 combined with raw soil has a good toxic effect on second instar larvae of Meloidogyne enterolobii. The nematocidal activity of the fermentation liquor of the Aspergillus niger XO-2 combined with raw soil is significantly improved. At the same time, the fermentation liquor can inhibit egg hatching, which is of great significance for enriching plant parasitic nematode biocontrol resources and developing nematocidal plant and microbial source pesticides or pesticide fertilizers.

[0015] Deposit information

[0016] The Aspergillus niger XO-2 was deposited in the China General Microbiological Culture Collection Center (CGMCC) on August 26, 2024, with a preservation number of CGMCC No.41492. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Fig. 1 is a graph showing the mortality rate (a) and egg hatching inhibition rate (b) of Meloidogyne enterolobii J2 treated with different concentrations of raw soil combined with fermentation liquor of Aspergillus niger for different times.

[0018] Figure 2 The effects of treatment with fermentation broth of Rehmannia glutinosa and Aspergillus niger on the J2(a) and eggs (b) of Root-knot Nematode of Auricularia auricula-judae; Figure 2 In the case of A, it refers to the treatment of fermentation broth from Rehmannia glutinosa combined with Aspergillus niger; Figure 2 In the middle, B refers to water treatment; the scale bar is 50 μm.

[0019] Figure 3 This is the growth status of tomato roots after treatment with fermentation broth of Rehmannia glutinosa and Aspergillus niger. Figure 3 Both AD were inoculated with root-knot nematodes. A: Water control; B: Fermentation broth of Rehmannia glutinosa and Aspergillus niger at 25 mg / mL; C: Fermentation broth of Rehmannia glutinosa and Aspergillus niger at 12.5 mg / mL; D: Abamectin at 15 μg / mL. EG was not inoculated with root-knot nematodes. E: Water control; F: Fermentation broth of Rehmannia glutinosa and Aspergillus niger at 25 mg / mL; G: Fermentation broth of Rehmannia glutinosa and Aspergillus niger at 12.5 mg / mL. The arrows indicate root knots.

[0020] Figure 4 The effects of different concentrations of fermentation broth containing Rehmannia glutinosa and Aspergillus niger on tomato plant morphology (a) and biomass (b).

[0021] Figure 5 This is a morphological diagram of the Aspergillus niger XO-2 strain of the present invention; where A represents the front and back of a colony cultured on a PDA for 1 week. Figure 5 A (left side is reverse, right side is front); B is conidiophore and conidia, Bar = 10 μm. Detailed Implementation

[0022] The following is a detailed description of specific embodiments in conjunction with the accompanying drawings, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Unless otherwise specified, the raw materials and reagents used in the examples are commercially available. The *Eriocheir sinensis* root-knot nematode used in the examples was cultured in our laboratory. The PDA medium was potato sucrose agar medium.

[0023] Example 1

[0024] The Aspergillus niger XO-2 strain of this invention was isolated and purified from soil in a continuously cropped protected area using a dilution-phase method. Studies have shown that Aspergillus niger XO-2 belongs to the class Deuteromycetes, class Hyphomycetes, order Moniliales, family Moniliaceae, genus Aspergillus, and species Aspergillus niger. Specifically, after culturing the strain on PDA medium for 7 days, the colonies were dark brown with a gray reverse side. Figure 5A); the mycelium has septa, and the top forms a spherical top cyst, which is covered with a layer of stroma and a layer of small stems, the small stems are double-layered, the top cyst is large and spherical, the top cyst of the mycelium at the base of the conidiophore often forms a false root; the conidiospores are spherical or nearly spherical, the wall is rough and has spines, the diameter of the conidiospores is 2.71-3.75 μm (optical microscope image as shown in Figure 5 B). The morphological characteristics are consistent with those of Aspergillus niger. The culture of the fungal strain in PDA medium is extracted by DNA, amplified by using primers ITS1: TCCGTAGGTGAACCTGCGG (5'-3') and ITS4: TCCTCCGCTTATTGATATGC (5'-3'), and sequenced. After alignment analysis of the obtained ITS sequence in the Genebank database, it is found that the similarity with the model strain (ATCC 16888) of Aspergillus niger reaches 99.11%. In combination with morphological identification and molecular identification, the strain of the application is identified as Aspergillus niger, and the strain code is XO-2, and thus named Aspergillus niger XO-2. The ITS accession number of the strain in the Genebank is KR708636.

[0025] Example 2

[0026] Detection of the nematicidal activity of the fermentation liquor of Shengdi combined with Aspergillus niger on J2 of Meloidogyne enterolobii

[0027] 2.1, Extraction, hatching and collection of eggs of M. enterolobii

[0028] M. enterolobii is inoculated on the roots of tomato seedlings at the 4-leaf stage, and after 35 days of cultivation, the tomato roots are taken out, washed gently under tap water to remove the soil on the root surface, and the egg suspension is collected by using the sodium hypochlorite method (Hussey, 1973). The roots with M. enterolobii are placed in a 500 mL beaker, 2% sodium hypochlorite is added to cover the roots, stirred for 30 s, poured into a screen, and the eggs in the 500-mesh screen are collected into a small beaker, and the egg suspension is obtained and placed in a dark environment at 25°C. Fresh J2 hatched within 24 h on the test day are collected for the test.

[0029] 2.2, Preparation of the fermentation liquor of Shengdi and the fermentation liquor of Shengdi combined with Aspergillus niger

[0030] 5 g of Shengdi is placed in a 250 mL triangular flask, 200 mL of water is added, and after stirring uniformly, the mixture is placed in a vertical automatic pressure steam pot, sterilized at 121°C for 20 min, and then placed in a shaking bed for fermentation for 15 d (28°C, 160 r / min). The obtained fermentation liquor of Shengdi is filtered with filter paper.

[0031] Take 5g of raw land and put it into a 250mL flask, add 200mL of water, stir evenly after adding water, then put it into a vertical automatic pressure steam boiler, sterilize at 121°C for 20min, then inoculate 1 Aspergillus niger XO-2 cake in the water in the flask, the cake diameter is 9mm, then ferment at 28°C, 160r / min on a shaker for 15d to obtain a fermentation broth containing biocontrol bacteria, filter with filter paper to obtain the filtrate, which is the raw land combined with Aspergillus niger XO-2 fermentation broth, and store at -20°C until use.

[0032] The above prepared raw land combined with Aspergillus niger fermentation broth (fermentation broth concentration is 25mg / mL according to the concentration of plant material) is subjected to insecticidal activity detection:

[0033] The fresh soybean cyst nematode J2 collected within 24h in 2.1 is transferred to a 96-well plate, about 50 are added to each well. Then 200μL of the above prepared raw land combined with Aspergillus niger fermentation broth and raw land fermentation broth alone are added to each well respectively, with sterile water as a control, four repeats for each concentration, and the whole test is repeated twice. Then the 96-well plate is placed in a constant temperature incubator at 28°C, and the number of dead nematode J2 is recorded after 24, 48 and 72h, and the mortality rate of nematodes is calculated. The standard for detecting nematode death is that the nematodes are stiff and do not move after being stimulated with a needle.

[0034] Mortality rate = (number of dead nematodes / total number of test nematodes) x 100%

[0035] Corrected mortality rate = [(treatment group mortality rate-control group mortality rate) / (1-control group mortality rate)] x 100%

[0036] Table 1 Mortality rate (%) of soybean cyst nematode J2 treated with raw land combined with Aspergillus niger fermentation broth and raw land fermentation broth alone

[0037]

[0038]

[0039] Note: CK is water control. Different letters in the same column indicate significant difference by Duncan's new multiple range test at P<0.05 level.

[0040] As can be seen from Table 1, the raw land combined with Aspergillus niger fermentation broth has significant nematocidal activity: the mortality rate of nematodes treated with raw land fermentation broth alone is 62.95%, and the mortality rate of nematodes treated with raw land combined with Aspergillus niger fermentation broth is 100%, which is significantly improved by 58.86% compared with raw land fermentation broth alone.

[0041] Example 3

[0042] Effect of fermented liquid of Rehmannia glutinosa L. combined with Aspergillus niger on egg hatching of Meloidogyne incognita

[0043] The egg hatching test of 25 mg / mL fermented liquid of Rehmannia glutinosa L. combined with Aspergillus niger was carried out: 2 μL of the egg suspension obtained in 2.1 of Example 2 (about 50 eggs) was added to each well of a 96-well cell culture plate, 198 μL of fermented liquid of Rehmannia glutinosa L. combined with Aspergillus niger, fermented liquid of Rehmannia glutinosa L. alone, and sterile distilled water as a control were added to each well, respectively, each treatment was repeated 4 times, and the test was repeated twice. The number of treated eggs was recorded under an inverted microscope, and the number of hatched J2 was recorded at 3 d, 6 d, 9 d, 12 d, and 15 d, respectively, the cumulative hatching rate and the hatching inhibition rate of nematodes were calculated.

[0044] Results: The fermented liquid of Rehmannia glutinosa L. combined with Aspergillus niger effectively inhibited the hatching of nematode eggs.

[0045] After 15 d of treatment, the hatching inhibition rate of nematode eggs by fermented liquid of Rehmannia glutinosa L. alone was 33.03%, and the hatching inhibition rate of nematode eggs by fermented liquid of Rehmannia glutinosa L. combined with Aspergillus niger was 98.55%, which was 2.98 times that of fermented liquid of Rehmannia glutinosa L. alone.

[0046] Example 4

[0047] Concentration optimization and toxicity analysis of fermented liquid of Rehmannia glutinosa L. combined with Aspergillus niger on Meloidogyne incognita

[0048] Concentration optimization of fermented liquid of plant resources combined with biocontrol bacteria on Meloidogyne incognita

[0049] The fermented liquid of Rehmannia glutinosa L. combined with Aspergillus niger was diluted with sterile water to different concentrations (0.2, 0.4, 0.6, 0.8, 1 mg / mL), and the egg hatching test and nematocidal test were carried out according to Example 2 and Example 3 to optimize the concentration of the fermented liquid, and the Probit method was used for toxicity analysis to obtain the lethal concentration LC50 of nematocidal.

[0050] Fermentation process optimization of fermented liquid of Rehmannia glutinosa L. combined with Aspergillus niger on Meloidogyne incognita

[0051] Orthogonal test design (Table 2) was carried out with fermentation temperature (A1 = 26℃, A2 = 28℃, A3 = 30℃), fermentation speed (B1 = 120 r / min, B2 = 140 r / min, B3 = 160 r / min), and fermentation time (C1 = 10 d, C2 = 15 d, C3 = 20 d) as three factors and three levels to optimize the conditions of the fermented liquid, and the fermented liquid of Rehmannia glutinosa L. combined with Aspergillus niger was prepared according to the operation method of Example 1 to determine the toxic effect on Meloidogyne incognita, and the optimal combination was screened out, and the mortality rate of Meloidogyne incognita treated with the fermented liquid of Rehmannia glutinosa L. combined with Aspergillus niger for 72 h was used as the evaluation standard.

[0052] Table 2 Optimization of fermentation conditions of Shengdi combined with Aspergillus niger fermentation broth by orthogonal design

[0053]

[0054] Results:

[0055] When the J2 of M. enterolobii was treated with the fermentation broth of Shengdi combined with Aspergillus niger, the mortality rate increased with the increase of the concentration of the fermentation broth and the extension of time. When the concentration was 0.2 mg / mL, the mortality rate of J2 was 2.57%, 2.97%, and 4.49% at 24, 48, and 72 h, respectively. When the concentration was 0.4, 0.6, 0.8, and 1 mg / mL, the mortality rate was 49.98%, 79.01%, 91.50% at 24 h, and 61.07%, 83.62%, 96.72% at 72 h, respectively (a). The toxic effects of the fermentation broth of Shengdi combined with Aspergillus niger at different concentrations on J2 of M. enterolobii were significantly different (P<0.05). After treatment with the fermentation broth of Shengdi combined with Aspergillus niger, the dead worms showed vacuoles, which was significantly different from the control (b). Figure 1 Figure 2

[0056] The fermentation broth of Shengdi combined with Aspergillus niger had an inhibitory effect on the egg hatching of M. enterolobii at different concentrations. The inhibitory effect of the fermentation broth of Shengdi combined with Aspergillus niger on the egg hatching of M. enterolobii increased gradually with the increase of the concentration. When the concentration of the fermentation broth of Shengdi combined with Aspergillus niger was 0.2 mg / mL, the inhibition rate of egg hatching of M. enterolobii was 26.05% at 15 d. When the concentration of the fermentation broth of Shengdi combined with Aspergillus niger was 0.4, 0.6, 0.8, and 1 mg / mL, the inhibition rate of egg hatching was significantly higher than that of 0.2 mg / mL, which was 49.31%, 74.85%, 89.17%, and 95.39%, respectively (b). The inhibition rates of egg hatching of M. enterolobii at different concentrations of the fermentation broth of Shengdi combined with Aspergillus niger were significantly different (P<0.05). After treatment with the fermentation broth of Shengdi combined with Aspergillus niger, the eggs showed vacuoles, which was different from the control (b). Figure 1 Figure 2

[0057] The virulence analysis of the fermentation broth of Shengdi combined with Aspergillus niger on M. enterolobii showed that the regression equation was y=1.534+5.288x at 72 h, and when the mortality rate of M. enterolobii reached 50%, the lethal concentration of the drug was 0.513 mg / mL, and the 95% confidence limit was 0.347-0.659 mg / mL (Table 3).

[0058] ​​​​The regression equations of the fermented liquid of Rehmannia glutinosa combined with Aspergillus niger treating root-knot nematode eggs of Ceratobrachis cajanus for 3, 6, 9, 12 and 15 days were y = 1.289 + 5.215x, y = 1.401 + 2.573x, y = 1.529 + 3.832x, y = 1.586 + 3.223x, and y = 1.638 + 3.529x, the median concentrations of inhibiting egg hatching were 0.566, 0.285, 0.399, 0.322 and 0.343 mg / mL, and the 95% confidence limits were 0.491-0.622, 0.211-0.347, 0.346-0.447, 0.279-0.361 and 0.310-0.375 mg / mL (Table 4).

[0059] Table 3 Toxicity analysis of the fermented liquid of Rehmannia glutinosa combined with Aspergillus niger on J2 of Ceratobrachis cajanus

[0060]

[0061] Table 4 Median concentration analysis of the fermented liquid of Rehmannia glutinosa combined with Aspergillus niger on hatching inhibition of eggs of Ceratobrachis cajanus

[0062]

[0063]

[0064] According to the killing effect of the fermented liquid of Rehmannia glutinosa combined with Aspergillus niger on Ceratobrachis cajanus under different conditions of orthogonal test, the primary and secondary order affecting the nematicidal activity of the fermented liquid of Rehmannia glutinosa combined with Aspergillus niger was fermentation temperature > fermentation time > fermentation speed, and the optimal fermentation conditions were fermentation temperature of 30℃, fermentation speed of 160 r / min and fermentation time of 15 days, the 72h mortality rate of Ceratobrachis cajanus reached 99.63% (Table 5), and the nematicidal activity of the fermented liquid of Rehmannia glutinosa combined with Aspergillus niger increased by 19.13% compared with that before optimization.

[0065] Table 5 72h mortality rate of J2 of Ceratobrachis cajanus treated by the fermented liquid of Rehmannia glutinosa combined with Aspergillus niger under different fermentation temperatures, shaking speed and fermentation time

[0066]

[0067]

[0068] K1, K2 and K3 columns represent the corrected mortality rate sum under the conditions of temperature, speed and fermentation days from small to large in turn;

[0069] k1, k2 and k3 are the average numbers of K1, K2 and K3 respectively;

[0070] R represents the range value of k1, k2 and k3.

[0071] Note: The concentration of shengdi combined with the fermentation broth of Aspergillus niger was 0.8 mg / mL.

[0072] Example 5

[0073] Shengdi combined with the fermentation broth of Aspergillus niger for controlling Meloidogyne javanica in pot experiment

[0074] The pot experiment was carried out in a greenhouse, and tomato seedlings (Israel F1) were used as experimental materials. First, the tomato seeds were surface sterilized with 0.1% sodium hypochlorite for 1 min, washed with sterile tap water three times, then placed on sterile filter paper and kept moist, and germinated at 28°C. The germinated seeds were sown in seedling trays, and the tomato seedlings were transplanted to small pots (10 cm x 10 cm x 9 cm) containing 800 mL of sterilized substrate at the 3-5 leaf stage, and then transferred to the greenhouse for growth. A 1 cm deep hole was punched around the roots, and 2000 ± 14.79 eggs of Meloidogyne javanica were inoculated per pot of tomato, and the egg suspension obtained in 2.1 of Example 2 was injected. Two days later, the prepared shengdi combined with the fermentation broth of Aspergillus niger was used to irrigate the tomato seedlings, 20 mL of shengdi combined with the fermentation broth of Aspergillus niger was used to irrigate each pot of tomato seedlings, and the concentration of shengdi combined with the fermentation broth of Aspergillus niger in each treatment group was set to 25 mg / mL and 12.5 mg / mL, and abamectin (purchased from Shanghai Maikelin Biochemical Technology Co., Ltd.) was used as a control, with a concentration of 15 μg / mL according to the field application amount. After 7 days, irrigation was carried out again, with 6 replicates for each treatment, and two independent repeated experiments were carried out. This experiment was carried out under normal management conditions, and regular watering was carried out in the later stage to keep the soil moist. After 60 days of culture, the data of each treatment were collected, and the plant height, root length, root fresh weight, shoot fresh weight, shoot dry weight, root knot number, and egg number were recorded, and the tomato roots were dyed using sodium hypochlorite-acid fuchsin staining method.

[0075] Results:

[0076] The fermentation broth of shengdi combined with Aspergillus niger could inhibit the reproduction of Meloidogyne javanica on tomato. After treatment with the nematicide abamectin, the root system developed healthily with only a small amount of root knots, while after treatment with the fermentation broth of shengdi combined with Aspergillus niger, a small amount of root knots appeared, but the development was still good, which was the same as the root system after treatment with the nematicide, and the root system of the water control group was full of root knots. Figure 3Treatment of tomatoes with different concentrations of fermentation broth containing Rehmannia glutinosa and Aspergillus niger significantly reduced the reproduction rate of root-knot nematodes (P<0.05). All treatments significantly reduced the number of root knots. The number of root knots after treatment with 25 mg / mL and 12.5 mg / mL fermentation broth containing Rehmannia glutinosa and Aspergillus niger, 15 μg / mL abamectin, and the water control group were 79.84, 80.0, 18.4, and 124.19, respectively. Compared with the water control group, the number of root knots decreased by 35.71%, 35.58%, and 85.18% after treatment with 25 mg / mL fermentation broth, 12.5 mg / mL fermentation broth, and 15 μg / mL abamectin, respectively. The effect of fermentation broth containing Rehmannia glutinosa and Aspergillus niger reached 41.77%–41.92% of that of abamectin. The number of nematode eggs in tomatoes treated with 25 mg / mL Rehmannia glutinosa combined with Aspergillus niger, 12.5 mg / mL, abamectin, and water control groups were 57833.33, 58071.43, 28783.33, and 189000, respectively. The number of nematode eggs in the treatment groups was significantly reduced, with egg inhibition rates of 69.40%, 62.05%, and 84.77% compared to the control. The fermentation broth of Rehmannia glutinosa combined with Aspergillus niger achieved 73.19%–81.87% of the effect of abamectin. After treating tomatoes with fermentation broth of Rehmannia glutinosa combined with Aspergillus niger (25 mg / mL), avermectin, and water (control group), the number of root nematodes was 246.00, 360.75, 28.00, and 597.50 per plant, respectively (P<0.05), representing a decrease of 58.83%, 39.12%, and 95.31% compared to the control group (Table 6). The fermentation broth of Rehmannia glutinosa combined with Aspergillus niger achieved 41.05%–61.72% of the effect of avermectin. The nematode Pf / Pi ratio was significantly reduced by 69.39% after treatment with the fermentation broth of Rehmannia glutinosa combined with Aspergillus niger (25 mg / mL) compared to the water control (Table 7). Treatment with the fermentation broth of Rehmannia glutinosa combined with Aspergillus niger significantly reduced the reproductive rate of root-knot nematodes in *Eriocaulon buergerianum*.

[0077] After treatment of tomatoes with the fermentation broth of Rehmannia glutinosa and Aspergillus niger, there were no significant differences in plant height (length), root fresh weight, and aboveground fresh weight compared with the control group (P<0.05), indicating that the fermentation broth of Rehmannia glutinosa and Aspergillus niger had no effect on tomato growth. Figure 4 Note: CK: Water control without nematodes; CK+: Water control with nematodes; different letters on the same colored column represent significant differences at the P<0.05 level according to Duncan's new multiple range test.

[0078] Table 6. Effects of different concentrations of fermentation broth containing *Rehmannia glutinosa* and *Aspergillus niger* on the number of root knots and eggs of *Auricularia auricula-judae*.

[0079]

[0080] Note: CK+ is the water control inoculated with nematodes. Different letters in the same column indicate significant differences at the P<0.05 level using Duncan's new multiple range method.

[0081] Table 7 Effect of different concentrations of Radix Rehmanniae combined with Aspergillus niger fermented broth on the reproduction of Meloidogyne javanica

[0082]

[0083] Note: CK+ is water control inoculated with nematodes. The same column different letters represent Duncan's new multiple range test at P<0.05 level.

[0084] The foregoing description of specific exemplary embodiments of the application has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the application to the precise form disclosed, and various modifications and variations are possible in light of the above teachings. It is intended that the embodiments be chosen and / or described to best explain the principles of the application and its practical application, and to thereby enable others skilled in the art to best utilize the application and various embodiments with various modifications as are suited to the particular use contemplated. It is intended that the scope of the application be defined by the claims and their equivalents.

Claims

1. Application of raw land combined with Aspergillus niger in the prevention and treatment of nematodes, characterized in that: The aforementioned Aspergillus niger is Aspergillus niger (Aspergillus niger) Aspergillus niger XO-2, deposited on August 26, 2024 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41492, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; the nematode described is *Heliotropium indicum* root-knot nematode.

2. Use according to claim 1, characterized in that: The Aspergillus niger XO-2 is inoculated on the raw land for fermentation, and after fermentation, the fermentation liquor of the raw land combined with the Aspergillus niger is obtained by filtering.

3. Use according to claim 2, characterized in that: The concentration of the fermentation liquor of the raw land combined with the Aspergillus niger is 0.4 mg / mL-25 mg / mL.

4. Use according to claim 2, characterized in that: The fermentation is carried out at 28 ℃ and 160 r / min for 14-16 days.

5. Use according to claim 2, characterized in that: The fermentation is carried out at 28 ℃ and 160 r / min for 15 days.

6. Use according to claim 2, characterized in that: The filtering is carried out by using filter paper.

7. Use according to claim 2, characterized in that: The raw land is traditional Chinese medicine raw land, which is obtained after sterilization at 121 ℃ for 20 min.

Images