Blueromyces stokenii T-12, microbial agent and application of Blueromyces stokenii T-12

Abstract

The invention discloses a Brachybacterium stolonifer T-12, a microbial agent and application, and belongs to the technical field of biological prevention and control. The strain is preserved in the China General Microbiological Culture Collection Center (CGMCC) on December 9, 2024, the preservation address is No.3, No.1 yard, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC No.41659. The Talaromyces Stokes T-12 is a fungus separated from soil and can be well colonized in the soil, it is found for the first time that the fungus has an obvious inhibition effect on sugarcane smut, sugarcane brown streak and sugarcane pokkah boeng for the first time, and the Talaromyces Stokes T-12 can be applied to prevention and treatment of sugarcane smut, sugarcane brown streak and sugarcane pokkah boeng. Particularly, the compound has an excellent prevention and treatment effect on sugarcane smut and has potential application value; and meanwhile, the strain also has certain growth promoting potential, has the capability of producing siderophores, and has wide popularization and application prospects.

Description

Technical Field

[0001] The invention relates to the technical field of biological control, and in particular to a strain of Stahl's blue bacteria T-12, a microbial agent and application thereof. Background Art

[0002] Sugarcane is the most important sugar crop in my country, and is also an important raw material and strategic resource for light industry, chemical industry and energy. Sugarcane pests and diseases are important restrictive factors in sugarcane production, which can cause serious losses in sugarcane yield and quality. Sugarcane smut is a systemic fungal disease caused by Sporisorium scitamineum. Sugarcane smut belongs to heterothallic mating, and its life history goes through two stages: haploid sporophyte and binucleate mycelium. The haploid stage can only grow by budding and does not have infectivity and pathogenicity. Haploid spores of different mating types form binucleate mycelium with infectivity and pathogenicity after sexual mating, leading to disease. The disease is prevalent in all sugarcane-growing countries and is also one of the diseases that causes the most serious economic losses in China's sugarcane production. The economic losses caused by sugarcane smut on dry land and ratoon sugarcane are particularly serious. The incidence of ratoon sugarcane can reach 80% to 90%, causing a 20% to 50% loss in sugarcane yield, and the economic losses caused can reach billions each year. Sugarcane brown streak disease is one of the main leaf fungal diseases in the middle and late stages of sugarcane growth. In my country, the disease has repeatedly broken out and caused disasters, causing serious economic losses. In seriously affected fields, the incidence of brown streak disease is more than 80%, and the general yield reduction is 18% to 35%, and the severe cases can reach more than 40%, and the sugar content of sucrose is reduced by 15% to 30%. Sugarcane tip rot is an important global sugarcane fungal disease. Sugarcane tip rot is distributed and harmed in all sugarcane-growing provinces and regions in China. Especially in recent years, there have been many rainy and humid years, and the large-scale planting of susceptible varieties has led to the outbreak of sugarcane tip rot in my country's sugarcane areas, resulting in serious reductions in production and sugar. The survey results show that the disease is serious in susceptible varieties, often causing a large number of sugarcane stems to die, with an average disease rate of 81.1%, and up to 100% in severe cases; the measured yield loss of sugarcane is an average of 38.42%, and up to 48.5% in severe cases; the sugar content of sugarcane is reduced by an average of 3.14%, and in severe cases it is reduced by up to 4.21%.

[0003] Breeding and planting disease-resistant varieties are the most economical and effective measures to prevent and control fungal diseases of sugarcane. However, due to the complexity and variability of pathogens and the long breeding cycle of sugarcane, there is currently a shortage of varieties with strong disease resistance, excellent agronomic traits, and suitable for large-scale planting. Chemical control is mainly used to control sugarcane fungal diseases during sugarcane planting due to its low cost and quick effect. However, chemical control can easily lead to drug resistance in pathogens, pesticide residues, damage to the ecological environment, and threaten human health. Biological control takes green and environmental protection as its main development concept. With its advantages of environmental friendliness, rich exploitable resources, and low production cost, it has become a hot topic in the current research on plant disease control at home and abroad. As a component of the plant microbial system, biocontrol fungi can promote plant growth through various mechanisms, minimize the ecological threats caused by chemical inputs in soil and crops, and have good prospects. Therefore, screening more biocontrol microorganisms for controlling sugarcane fungal diseases and providing biocontrol fungal resources with good prevention effects for sugarcane fungal diseases are technical problems that need to be solved urgently by those skilled in the art.

[0004] Fungi of the genus Talaromyces (Talaromyces spp.) generally have good adaptability to natural environments and adverse conditions. Such fungi play an important role in production practice. Some strains have the ability to solubilize phosphate and produce cellulase, and some strains can be used as pigment-producing bacteria. In addition, some yellow talaromyces and purple talaromyces have application potential in plant disease prevention and control. There is no report in the prior art on the use of Talaromyces stollii to prevent and control fungal diseases of sugarcane. Summary of the invention

[0005] The purpose of the present invention is to provide a strain of Stahl's blue fungus T-12, a microbial agent and an application thereof, so as to solve the problems existing in the above-mentioned prior art. The Stahl's blue fungus T-12 disclosed in the present invention has a significant inhibitory effect on sugarcane smut fungus, sugarcane brown streak fungus and sugarcane tip rot fungus, especially in inhibiting the growth and development of binucleate mycelium of sugarcane smut fungus. In addition, the Stahl's blue fungus T-12 has the potential to promote growth by producing iron carriers.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is a strain of Talaromyces stollii T-12, which was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on December 9, 2024, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No.41659.

[0008] The second technical solution of the present invention is a microbial agent, including the above-mentioned Stahl's blue bacteria T-12.

[0009] The third technical solution of the present invention is the use of the Stahl's blue bacteria T-12 or the microbial agent in preventing and controlling sugarcane diseases.

[0010] A fourth technical solution of the present invention is the use of the Stahl's blue bacteria T-12 or the microbial agent in the preparation of products for preventing and controlling sugarcane diseases.

[0011] A fifth technical solution of the present invention is a method for preventing and controlling sugarcane diseases, using the Stoller's blue bacteria T-12 or the microbial agent to prevent and control sugarcane diseases.

[0012] The sixth technical solution of the present invention is the use of the Stoller's blue bacteria T-12 or the microbial agent in the production of iron carriers.

[0013] The seventh technical solution of the present invention is the use of the Stoller's blue bacteria T-12 or the microbial agent in the preparation of products producing iron carriers.

[0014] The eighth technical solution of the present invention is the use of the Stoller's blue bacteria T-12 or the microbial agent in promoting plant growth.

[0015] Based on the above technical solution, the present invention has the following technical effects:

[0016] The Stahl's blue fungus T-12 disclosed in the present invention is a fungus separated from soil and can be well colonized in the soil. The present invention firstly discovers that the fungus has obvious inhibitory effects on sugarcane smut, sugarcane brown streak and sugarcane tip rot, and can be used to prevent and control sugarcane smut, sugarcane brown streak and sugarcane tip rot, especially has excellent control effect on sugarcane smut, and has potential application value; at the same time, it also has certain growth-promoting potential, has the ability to produce iron carriers, and has broad prospects for promotion and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1This is a diagram showing the antibacterial effect of Stoll's blue fungus T-12 on sugarcane smut, sugarcane brown streak and sugarcane tip rot in indoor plate confrontation culture; A. binucleate mycelium of sugarcane smut (left: treatment, right: control); B. sugarcane brown streak (left: treatment, right: control); C. sugarcane tip rot (left: treatment, right: control).

[0019] Figure 2 This is a diagram of the morphological characteristics of the Stahl's blue bacteria T-12 colony.

[0020] Figure 3 This is a diagram showing the morphological characteristics of conidiophores of Stoll's blue fungus T-12.

[0021] Figure 4 This is the phylogenetic tree of Stoll's blue bacteria T-12.

[0022] Figure 5 The results of Stall's blue fungus T-12 inhibiting the growth and development of binucleate mycelium of sugarcane smut fungus. A is the phenotype of binucleate mycelium of sugarcane smut fungus cultured alone; B is the phenotype of binucleate mycelium of sugarcane smut fungus co-cultured with Stall's blue fungus T-12.

[0023] Figure 6 This is a diagram showing the effect of iron carrier production by Stahl's blue bacteria T-12.

[0024] Figure 7 The biocontrol effect of Stoll's blue fungus T-12 on sugarcane smut. DETAILED DESCRIPTION

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0027] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0028] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0029] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0030] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0031] An embodiment of the present invention provides a strain of Talaromyces stollii T-12, which was deposited in the General Microbiology Center of China National Microbiological Culture Collection Committee on December 9, 2024, with a deposit address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and a deposit number of CGMCC No. 41659.

[0032] The embodiment of the present invention also provides a microbial agent, including the Stoller's blue bacteria T-12.

[0033] The embodiment of the present invention also provides the use of the Stahl's blue bacteria T-12 or the microbial agent in preventing and controlling sugarcane diseases.

[0034] The embodiment of the present invention also provides the use of the Stahl's blue bacteria T-12 or the microbial agent in the preparation of a product for preventing and controlling sugarcane diseases.

[0035] In some specific embodiments, the sugarcane diseases include sugarcane diseases caused by sugarcane smut pathogen, sugarcane brown streak pathogen and / or sugarcane tip rot pathogen.

[0036] The embodiment of the present invention also provides a method for preventing and controlling sugarcane diseases, using the Stoller's blue fungus T-12 or the microbial agent to prevent and control sugarcane diseases.

[0037] In some specific embodiments, the sugarcane diseases include sugarcane diseases caused by sugarcane smut pathogen, sugarcane brown streak pathogen and / or sugarcane tip rot pathogen.

[0038] The embodiment of the present invention also provides the use of the Stahl's blue bacteria T-12 or the microbial agent in producing siderophores.

[0039] The embodiment of the present invention also provides the use of the Stahl's blue bacteria T-12 or the microbial agent in the preparation of a product producing siderophore.

[0040] The embodiment of the present invention also provides the use of the Stahl's blue bacteria T-12 or the microbial agent in promoting plant growth.

[0041] According to the test, the Stoller's blue fungus T-12 provided by the present invention can effectively inhibit the growth and development of the dikaryotic mycelium of sugarcane smut fungus when co-cultured with the dikaryotic mycelium of sugarcane smut fungus. In addition, the Stoller's blue fungus T-12 exhibits a good antibacterial effect on sugarcane brown streak fungus and sugarcane tip rot fungus.

[0042] The binucleate mycelium of sugarcane smut pathogen, sugarcane brown streak pathogen and sugarcane tip rot pathogen used in the embodiments of the present invention are pathogens of sugarcane smut, sugarcane brown streak pathogen and sugarcane tip rot, respectively, and are isolated from diseased sugarcane tissues.

[0043] Example 1

[0044] Screening of Stahl's blue bacteria T-12

[0045] 1. Isolation of potential biocontrol bacteria

[0046] Soil samples were evenly collected from the continuous cropping sugarcane fields in Gengma, Yunnan. 10 g of the collected soil samples were weighed, 90 mL of sterile water was added, and the samples were shaken and cultured at 150 rpm for 30 min at room temperature. After that, the supernatant was aspirated and the biocontrol bacteria were isolated on PDA medium using a 10-fold gradient dilution method. 100 μL of soil dilution was evenly applied on each plate and cultured in the dark at 28 °C for 1-2 days. After the colonies grew, fungi with different colony morphology were selected for purification, propagation, and preservation, and named T-12.

[0047] 2. Screening of antagonistic bacteria by plate confrontation method

[0048] The target bacteria are: binucleate mycelium of sugarcane smut pathogen, sugarcane brown streak pathogen and sugarcane tip rot pathogen. Experimental group: strain T-12 and target bacteria were punched into bacterial cakes with a 5mm puncher and placed in the center of a 7cm PDA medium plate, strain T-12 was placed 2cm above the bacterial cake and cultured in a 28℃ constant temperature incubator for 7 days. Blank control group: the three target bacteria, binucleate mycelium of sugarcane smut pathogen, sugarcane brown streak pathogen and sugarcane tip rot pathogen, were punched into 5mm bacterial cakes, placed in the center of a 7cm PDA medium plate and cultured in a 28℃ constant temperature incubator for 7 days.

[0049] The calculation formula is as follows: Inhibition rate (%) = (colony diameter of blank control group - colony diameter of each experimental group) / (colony diameter of blank control group - diameter of bacterial cake) × 100.

[0050] At the end of the experiment, the inhibition rate was calculated. Table 1 shows the experimental results showing the inhibition effect of strain T-12 on three sugarcane pathogens.

[0051] Table 1 Antibacterial effect of strain T-12 on three sugarcane pathogens

[0052]

[0053]

[0054] from Figure 1 As shown in Table 1, strain T-12 has a certain inhibition rate on binucleate mycelium of sugarcane smut pathogen, sugarcane brown streak pathogen and sugarcane tip rot pathogen, especially on binucleate mycelium of sugarcane smut pathogen. It can be seen that strain T-12 has a preventive and control effect on most sugarcane fungal diseases.

[0055] 3. Morphological characteristics of the strain T-12 obtained by screening: T-12 on Chadwick yeast agar (CYA) at 28°C for 7 days has a round colony with a velvety texture and a large amount of flocculent hyphae on the surface; conidia are numerous and bean green; the back of the colony is pale ochre salmon with light yellow in the center. T-12 on malt extract agar (MEA) at 28°C for 7 days has a velvety texture and a large amount of white flocculent hyphae on the surface; conidia are numerous and bean green to sage green; the back of the colony is ochre ( Figure 2 ). Conidiophores have smooth walls; broom branches are arranged in two or three whorls; peduncle base has 3-6 conidiophores per whorl, arranged closely; phialopse is lanceolate, arranged closely, 4-6 conidiophores per whorl, conidia are ellipsoidal, with smooth walls ( Figure 3 ).

[0056] 4. Molecular biological identification of the screened strain T-12: The genomic DNA of T-12 mycelium was extracted using the genomic DNA rapid extraction kit of Tiangen Biochemical Technology Co., Ltd. The extracted DNA was used as a template to amplify its ITS, BenA and RPB2 sequences using the three pairs of primers in Table 2.

[0057] Table 2 Primers for molecular identification of Stahl's blue bacteria

[0058]

[0059] The ITS sequence of strain T-12 is shown in SEQ ID NO.7:

[0060] SEQ ID NO.7: CGAGTGCGGGGCCCTCGTGGCCCAACCTCCCACCCTTGTCTC TATACACCTGTTGCTTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGTTCGTCCCCGGGCCCGCGCCCGCCGAAGCGCTCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCG TGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGCGGTCCCCCCGGGGGCCTGCCCGAAAGGCAGCGGCGACGTCC GTCTGGTCCTCGAGCGTATGGGGCTTTGTCACTCGCTCGGGAAGGACTGGCGGGGGTTGGTCACCACCACAAAATTTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA;

[0061] The BenA sequence of strain T-12 is shown in SEQ ID NO.8:

[0062] SEQ ID NO.8: TAACCAAATCGGTGCTGCTTTCTGGTGAGTTTGACTCGACCC AAACTTTCTATCAATTGTCGCGGCGGCACGCTGACTTGTACAGGCAAATTATCTCTGCTGAGCACGGTCTCGATGGCTCTGGTGTGTAAGTATTTCACAATTCGAATACACCTACTGTCCGAGGTTATCTGATCATCGACAGCTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAACGTCTACTTCAACGAGGTGCGTTTGAAAGTTTCTCGACTCCTGCAGAACAAACACTTATTCAGCTAGGCCTCCGGCAACAAATACGTCCCCCGTGCTGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGTGCTGGTCCCTTTGGTCAGCTCTTCCGTCCCGACAACTTTGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTACACTGAGGG;

[0063] The RPB2 sequence of strain T-12 is shown in SEQ ID NO.9:

[0064] SEQ ID NO.9:CGCTACGCTTTTCCGAACTCTTTTCACCCGTGTTACAAGAGAT CTCACCCGTTACGTCCAACGATGCGTTGAAACAAACCGCGAAGTGGTTCTCAACGTGGGTCTCAAGCCAGCCACCCTTACAGGTGGTTTGAAATATGCTCTCGCTACTGGCAATTGGGGTGAACAGAAGAAGGCAATGAGCTCGAAAGCAGGTGTTTCCCAGGTGCTCAGTCGATACACCTTTGCCTCCACTTTGTCTCATTTGAGACGTACCAATACTCCTATTGGTCGTGATGGAAAAATCGCTAAACCTCGTCAGCTACATAACACGCACTGGGGTTTGGTTTGTCCTGCTGAGACTCCTGAAGGTCAAGCTTGTGGTTTGGTCAAGAACTTGGCTTTGATGTGCTCTATTACAGTGGGCTCTCCCAGTGAGCCTATCGTTGATTTCATGATTCAGAGAAACATGGAAGTGCTTGAGGAATTTGAACCGCTAGTTACGCCTCATGCCACCAAGGTCTTCGTCAATGGTGTTTGGGTTGGTGTTCATCGTGATCCAGCTCACTTGGTCAGCACAGTCCAGTCACTCCGTCGACGGAACATGATTTCACATGAAGTCAGTTTGGTTCGTGACATTCGTGACCGAGAGTTCAAGATCTTTACCGATGCCGGTCGTGTTTGTCGACCACTTTTCGTCATTGACAACGATCCGCGAAGTGAGAACTGCGGATCCTTGGTGCTCAACAAAGATCATATTCGCAGACTTGAAGCAGACCGTGAGCTTCCACCAGATCTCGACCCCGAAGAGCGAAGGGAACAGTATTACGGCTGGGAGGGTCTTGTCAAGTCAGGAGTCATTGAATACGTTGATGCTGAAGAGGAGGAAACCATTATGATTGC CATGTCTCCCGAAGATCTCGAAATCTCGAAACAGCTACAAGCCGGGTATGCTCTGCCTGAAGACAATAGCGACCCAAATAAGCGTGTCCGCTCAGTGCTGAGTCAACGGGCGCATATCTGGACTCACTGTGAGATTCATCCAAGTATGATTCTTGGTATCTGCGCCAGTATCATTC.

[0065] The PCR reaction system and amplification procedure were as follows: 25 μL of PCR reaction system, including 12.5 μL of 2×EasyTag PCR SuperMix (TransGen), 1 μL of forward primer and reverse primer, 1 μL of DNA template, and double distilled water to 25 μL.

[0066] The PCR amplification program was 94°C for 3 min; 94°C for 30 s, 58°C (ITS / BenA) or 50°C (RPB2) for 40 s, 72°C for 1 min, for a total of 35 cycles; 72°C for 10 min; and storage at 4°C.

[0067] The amplified products were detected by 1.2% agarose gel electrophoresis and sent to BGI for sequencing to obtain the sequences of each gene. The original sequences were manually proofread and edited using the biological software Bioedit 7.0.9. The single gene sequences were spliced ​​into a multi-gene sequence combination of BenA-RPB2-ITS using the model strain of the reported species of the genus Talaromyces as a reference, and the NJ phylogenetic tree was constructed using MEGA7.0. Figure 4 It can be seen that strain T-12 and Talaromyces stollii are clustered together, with a support rate of 100%.

[0068] The strain T-12 was identified as Talaromyces stollii by morphological and molecular biological methods and named Talaromyces stollii T-12. Talaromyces stollii T-12 was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 9, 2024, with the deposit address at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 41659.

[0069] Example 2

[0070] Inhibitory Effects of Stahl's Blue Fungus T-12 on the Growth and Development of Dikaryotic Mycelium of Sugarcane Smut Pathogen

[0071] Use a 5mm puncher to punch out bacterial cakes at the colony edges of Stoll's blue fungus T-12 and sugarcane smut fungus binucleate mycelium, and inoculate them onto a PDA plate (Φ=90mm). The two bacterial cakes are 2cm apart. After 5 days of confrontation culture, pick the sugarcane smut fungus binucleate mycelium near the end of Stoll's blue fungus T-12 for microscopic observation. Figure 5 As shown, Stahl's blue fungus T-12 had a significant inhibitory effect on the growth and development of binucleate mycelium of sugarcane smut fungus.

[0072] Example 3

[0073] Detection of the Siderophore Secretion Ability of Stahl's Blue Bacteria T-12

[0074] Siderophore refers to a kind of Fe-binding protein secreted by bacteria into the surrounding environment under iron-deficient conditions. 3+ A substance with a very strong specific chelating effect. The CAS plate method uses chrome azure S (CAS), trivalent iron ions and hexadecyltrimethylammonium bromide (HTDMA) to form a sky blue complex. The culture plate is dyed with CAS dye. When the strain releases trivalent iron ions into the culture plate, the ternary complex is destroyed and turns yellow, that is, a yellow halo appears around the colony. Record the presence or absence of an orange halo on the culture medium. Figure 6 It can be seen that S. stollenii T-12 showed a yellow halo on the CAS plate, indicating that it has great potential in promoting growth.

[0075] Example 4

[0076] The efficacy of Stahl's blue fungus T-12 in controlling sugarcane smut in barrels

[0077] 4.1. Sugarcane planting: Sugarcane with good growth, many sugarcane nodes and abundant seed buds were selected as the research object. The sugarcane variety was Yunzhe 08-1609. The middle part of the sugarcane was cut into single bud segments and soaked in a water bath at 50℃ for 2 hours. The seed buds were planted in pots with a diameter of 30 cm and a height of 20 cm containing a 1:1:1 (ordinary soil: nutrient pond mud: matrix soil) mixed soil. Three sugarcane buds were planted in each pot and placed in a greenhouse for cultivation. Watering was done regularly to prevent sudden drought from affecting the growth of sugarcane.

[0078] 4.2. Sugarcane inoculation: Activate the T-12 strain and the binucleate mycelium of sugarcane whip smut fungus respectively, and culture overnight until OD 600 =2.5 for standby use. After one month of cultivation, the height of sugarcane seedlings was about 30-40cm. Sugarcane seedlings with good growth and uniform size were selected for inoculation. The treatment methods of the experimental groups are shown in Table 3. Thirty sugarcane seedlings were selected for inoculation in each group of experiments. The inoculation volume was 1mL of the treatment solution. The inoculation solution was injected into the sugarcane stem from the sugarcane stem 3-5cm above the ground using a syringe. After inoculation, the sugarcane was cultivated for 3-5 months until most of the sugarcane in the control group became diseased. The disease situation of sugarcane in different treatments was investigated. At the harvest time, the sugarcane stems were cut to measure the yield.

[0079] 4.3. Prevention effect investigation: The disease situation of sugarcane was investigated 4 months after inoculation, the number of sugarcane infected with sugarcane smut under different treatments was recorded, and the incidence rate was calculated.

[0080] Incidence rate (%) = number of diseased sugarcane plants / total number of sugarcane plants × 100.

[0081] The control effect of the test group on sugarcane smut was calculated according to the formula.

[0082] Control effect (%) = (incidence of the control group - incidence of the treatment group) × 100 / incidence of the control group.

[0083] Table 3 Treatments of barrel planting experiment

[0084]

[0085] From Table 3 and Figure 7 It can be seen that Stoll's blue fungus T-12 can significantly inhibit the infection of sugarcane smut fungus on sugarcane, reduce the incidence of sugarcane smut, and reduce the inhibitory effect of sugarcane smut fungus on sugarcane growth.

[0086] As can be seen from the above examples, the Talaromyces stollii T-12 provided by the present invention has a significant inhibitory effect on sugarcane smut, sugarcane brown streak and sugarcane tip rot, especially in inhibiting the growth and development of binucleate mycelium of sugarcane smut. The strain also has a growth-promoting effect and has the ability to produce siderophores, and can be used as an efficient disease-resistant growth-promoting strain resource.

[0087] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A strain of Talaromyces stollii T-12, characterized in that: The strain was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 9, 2024. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No.41659.

2. A microbial agent, characterized in that: The invention comprises the Stahl's blue bacteria T-12 as described in claim 1.

3. Use of the Stahl's blue bacteria T-12 according to claim 1 or the microbial agent according to claim 2 in preventing and controlling sugarcane diseases.

4. Use of the Stahl's blue bacteria T-12 according to claim 1 or the microbial agent according to claim 2 in the preparation of products for preventing and controlling sugarcane diseases.

5. The use according to claim 3 or 4, characterized in that: The sugarcane diseases include sugarcane diseases caused by sugarcane smut pathogen, sugarcane brown streak pathogen and / or sugarcane tip rot pathogen.

6. A method for preventing and controlling sugarcane diseases, characterized in that: The Stollenbacterium T-12 described in claim 1 or the microbial agent described in claim 2 is used to prevent and control sugarcane diseases.

7. The method according to claim 6, characterized in that The sugarcane diseases include sugarcane diseases caused by sugarcane smut pathogen, sugarcane brown streak pathogen and / or sugarcane tip rot pathogen.

8. Use of the Stahl's blue bacteria T-12 according to claim 1 or the microbial agent according to claim 2 in producing siderophores.

9. Use of the Stahl's blue bacteria T-12 according to claim 1 or the microbial agent according to claim 2 in the preparation of a product producing siderophore.

10. Use of the Stahl's blue bacteria T-12 as claimed in claim 1 or the microbial agent as claimed in claim 2 in promoting plant growth.

Images