Separation and identification method of bovine coronavirus

Abstract

The invention relates to the field of separation and culture of bovine coronavirus, in particular to a separation and identification method of bovine coronavirus. The method comprises the following steps: collecting fresh excrement of the diarrhea calf by utilizing a rectum stimulation method, obtaining excrement sample supernate through PBS dilution, vortex oscillation and centrifugation, and screening positive sample supernate through RT-PCR. Carrying out pancreatin treatment on the positive sample solution, inoculating HRT-18 cells, carrying out infection, adding a pancreatin-containing DMEM maintenance solution, and carrying out freeze thawing treatment, centrifugation and virus collection; carrying out subculture on the collected virus liquid, detecting each generation of virus culture by utilizing RT-PCR (Reverse Transcription-Polymerase Chain Reaction), and taking a positive sample for continuous subculture; virus identification is carried out through cytopathic effect observation, RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection, transmission electron microscope observation, indirect immunofluorescence detection and genetic genetic evolution analysis. According to the method, a BCoV positive sample is treated and then inoculated with an HRT-18 cell line, and the bovine coronavirus is successfully separated according to verification.

Description

Technical Field

[0001] The invention relates to the field of bovine coronavirus culture, and in particular to a method for separating and identifying bovine coronavirus. Background Art

[0002] Bovine coronavirus (BCoV) belongs to the order Nidovirales, family Coronaviridae, subfamily Orthocoronavirus, and genus Betacoronavirus. BCoV can cause diarrhea in calves, winter dysentery in adult cattle, and respiratory symptoms in cattle of all ages. BCoV is widely spread in domestic cattle herds, with a high serum positivity rate, but there is no commercial vaccine for BCoV. Due to the difficulty in isolating and culturing BCoV in vitro, research on the etiology, pathogenicity, and pathogenic mechanism of BCoV has lagged behind.

[0003] There are currently two main methods for BCoV isolation. The first method uses authentic cattle without specific pathogens to inoculate virus-positive samples, and collects animal excrement for separation and purification. The second method uses sensitive cell lines to inoculate virus-positive samples for isolation. The cost of obtaining and raising authentic animals is extremely high, which limits the promotion and application of this technology. Currently, sensitive cell lines are mostly used for virus isolation, but there is a problem of low separation success rate.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The object of the present invention is to provide a method for separating and identifying bovine coronavirus, which can successfully separate the bovine coronavirus present in cattle feces and accurately identify the separated bovine coronavirus.

[0006] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0007] One aspect of the present invention relates to a bovine coronavirus Heilongjiang isolate, whose microbial preservation number is: CGMCC No.46087.

[0008] Another aspect of the present invention also relates to a method for isolating and identifying the bovine coronavirus Heilongjiang isolate, comprising the following steps:

[0009] (a) Fresh calf feces were collected by rectal stimulation, resuspended in PBS, vortexed and centrifuged, and the supernatant was collected; the supernatant was tested by RT-PCR using BCoV N gene primers, and the positive supernatant was filtered and sterilized for virus isolation;

[0010] (b) treating the positive supernatant with trypsin and inoculating sensitive cells for infection, then adding DMEM maintenance solution containing trypsin to the reaction system for culture, freezing and thawing, centrifuging and collecting the virus after a period of time; subculturing the collected virus solution, detecting each generation of virus culture by RT-PCR, taking positive samples for further subculture, observing the cytopathic effect of the virus subculture process, and obtaining virus isolates;

[0011] (c) The virus was isolated by transmission electron microscopy observation and indirect immunofluorescence verification, and the virus titer was determined by Reed Muench. The full-length sequence of the BCoV S1 gene was amplified by RT-PCR and compared with the gene sequence of the BCoV strain in the NCBI database to clarify the genetic evolutionary characteristics and genotyping of the isolated strain.

[0012] The isolation and identification method of bovine coronavirus uses RT-PCR to detect fecal samples of diarrheal calves. The BCoV positive fecal samples are inoculated into sensitive cells. During the 14th generation of continuous passage, the cytopathic effect is obvious. The virus titer reaches up to 10 by Reed-Muench method. 5.45 TCID 50 / ml, the isolated bovine coronavirus was identified by RT-PCR, indirect immunofluorescence and transmission electron microscopy, and phylogenetic analysis showed that the virus belonged to the GⅡb genotype.

[0013] Furthermore, the cattle feces sample comes from a calf with diarrhea.

[0014] Furthermore, the DMEM maintenance solution includes: 95% DMEM culture medium, 5% to 10% fetal bovine serum, 100 U / mL penicillin and 100 μg / mL streptomycin.

[0015] Furthermore, the method for preparing the cattle feces sample comprises the following steps:

[0016] The mixture of fresh cow feces and PBS buffer solution was vortexed and centrifuged, and the supernatant was taken to obtain the cow feces sample. The centrifugal speed was 7800-8200 r / min, and the centrifugal time was 15-25 min.

[0017] Fresh cow dung is diluted with PBS buffer and then centrifuged to remove most of the impurities in the dung and retain the bovine coronavirus in the supernatant to the greatest extent, facilitating the subsequent separation and identification work.

[0018] The present invention does not specifically limit the method for extracting total RNA from cattle feces samples, and conventional extraction methods in the art can be used to implement the technical solution of the present invention. In some specific embodiments, the total RNA from cattle feces samples is extracted using the Trizol method.

[0019] Further, the reverse transcription is performed using a reverse transcription kit, which includes but is not limited to: PrimeScript TM RT reagent Kit (Takara).

[0020] Furthermore, the amplification system of the RT-PCR is as follows:

[0021] 25μl amplification system: Premix Taq TM 12.5μl, 1μl each of upstream primer and downstream primer, 9.5μl of water, 1μl of template.

[0022] Furthermore, the amplification procedure of the RT-PCR is as follows:

[0023] The first step was 94°C, 3 min; the second step was 98°C, 10 s; the third step was 60°C, 30 s; the fourth step was 72°C, 1 min; the fifth step was 72°C, 7 min; the second to fourth steps were repeated for 30 cycles.

[0024] Furthermore, the gel excision recovery is performed using a gel excision recovery kit, which includes but is not limited to: an Omega gel recovery kit.

[0025] Further, the sequence of the upstream primer of the BCoV N gene is shown in SEQ ID No. 1, and the sequence of the downstream primer is shown in SEQ ID No. 2. This pair of primers can accurately amplify the BCoV N gene, and the amplified fragment length is 699bp.

[0026] SEQ ID No. 1: AGGCTATTCCGACTAGGTTTCCG.

[0027] SEQ ID No. 2: GTCCGTTCTCTGACCACGCTGA.

[0028] The BCoV N gene, or the N gene of the bovine coronavirus, plays an important role in the life cycle and pathogenicity of the virus. The N protein encoded by the N gene is the core protein of the virus, present inside the virus particle, and interacts with the viral genomic RNA to form a helical nucleocapsid. The N protein not only has the ability to assist in enhancing viral RNA replication, but also plays an important role in enhancing cellular immunity. The N gene is highly conserved in BCoV, which makes it an important target for detecting BCoV.

[0029] Furthermore, the vector includes but is not limited to: at least one of a pMD18-T vector, a pGEM-T vector, a pUC18-T vector or a pMD19-T vector.

[0030] Furthermore, the competent cells include but are not limited to: DH5α competent cells.

[0031] Furthermore, the transformed competent cells were coated with ampicillin-resistant LB plates, shaken in ampicillin-resistant LB culture medium, and verified by PCR of the bacterial solution to obtain the positive plasmid.

[0032] Furthermore, the confluence of the sensitive cells is 90% to 100%.

[0033] Furthermore, the sensitive cells include but are not limited to at least one of HRT-18 cells, HRT-18G cells or HCT-8 cells. Common BCoV sensitive cell lines in the art include HRT-18, HRT-18G, HCT-8 and MDBK. In the separation and identification method provided by the present invention, the separation effect of HRT-18 cells, HRT-18G cells and HCT-8 cells is better, especially HRT-18 cells.

[0034] Furthermore, the positive bovine feces sample is filtered through a filter membrane and then subjected to the pancreatic enzyme treatment.

[0035] Furthermore, the pore size of the filter membrane is 220 nm. Through the filter membrane, impurities in the positive cattle feces sample are further removed, ensuring that the positive cattle feces sample has a certain concentration of virus, which is conducive to the separation of the virus.

[0036] Furthermore, the pancreatic enzyme concentration of the pancreatic enzyme treatment is 48-52 μg / ml.

[0037] Furthermore, the pancreatin treatment time is 55 to 65 minutes.

[0038] Pancreatic enzymes have multiple functions in the process of virus isolation, such as promoting virus replication and infection, improving the success rate of virus isolation, promoting cell lesions and virus release. Treating positive bovine feces samples with pancreatic enzymes under certain concentration and time conditions can promote the replication and infection of bovine coronavirus and improve the success rate of virus isolation.

[0039] Furthermore, the induction time is 55 to 65 minutes. After inoculating sensitive cells, induction for a period of time can promote the pathological changes of sensitive cells, promote the replication and infection of the virus, and improve the success rate of virus isolation.

[0040] Furthermore, in step (b), a DMEM maintenance solution containing pancreatin is added to the reaction system to control the concentration of pancreatin in the reaction system to be 4 to 8 μg / ml. Sensitive cells are difficult to tolerate a culture solution with a pancreatin concentration higher than 10 μg / ml for a long time, so after a certain period of high-concentration pancreatin treatment, the final concentration of pancreatin needs to be reduced to maintain the activity of sensitive cells.

[0041] Furthermore, in step (b), the period of time is 5 to 6 days. Freeze-thaw treatment is performed about 5 days after inoculation to ensure that the bovine coronavirus can fully replicate in the cells, thereby improving the success rate of separation and detection. This process can help ensure the reliability of experimental data and provide accurate virus samples for subsequent research.

[0042] Furthermore, the freeze-thaw treatment is performed 1 to 3 times.

[0043] Furthermore, in steps (a) and (b), the centrifugal speed is 3800-4200 r / min, and the centrifugal time is 8-12 min.

[0044] Centrifugation can remove cell debris and impurities generated during the culture process to prevent the cell state from being affected during the passaging process. A speed or time lower than this may result in more cell debris or impurities remaining.

[0045] Furthermore, the subculture is carried out for 3 to 5 generations.

[0046] Furthermore, the specific method of detecting each generation of virus culture using RT-PCR in step (c) is the same as the RT-PCR operation method in step (a).

[0047] The present invention identifies the obtained virus isolates from the immunological, morphological and molecular biological levels, and the specific means of identification include but are not limited to: indirect immunofluorescence, electron microscopy, detection of virus titer and clear genetic evolution characteristics of isolated strains. Through the above identification means, it is possible to accurately identify whether the obtained virus isolate is a bovine coronavirus, and accurately know its titer and specific genotype.

[0048] Furthermore, the indirect immunofluorescence comprises:

[0049] When the confluence of sensitive cells reaches 70% to 90%, the virus isolate is inoculated, and after 22 to 26 hours, the culture medium is removed and fixed with 3% to 5% tissue fixative for 28 to 32 minutes, passed through a Triton permeable membrane with a concentration of 0.4% to 0.6% for 18 to 22 minutes, and blocked with 0.5% to 2% bovine serum albumin (BSA) for 55 to 65 minutes, and mouse anti-BCoV S1 monoclonal antibody is used as a primary antibody for incubation at room temperature for 1 to 2 hours, and fluorescein-labeled rabbit anti-mouse antibody is used as a secondary antibody for incubation at room temperature in the dark for 55 to 65 minutes, DAPI is added for nuclear staining, and observation is performed under a fluorescent inverted microscope.

[0050] Furthermore, the fluorescein includes at least one of fluorescein isothiocyanate (FITC), rhodamine, amphoteric rhodamine (Texas Red), cyanine dye (Cy), phycoerythrin (PE) or ammonia succinimidyl ester (AMCA).

[0051] Further, the titer of the virus is detected including:

[0052] HRT-18 cells were inoculated in a 96-well plate, and when the cell confluence reached 90% to 100%, BCoV was inoculated. BCoV was incubated at 37°C for 1 hour at a final concentration of 50 μg / ml trypsin, and then diluted 10-fold using serum-free DMEM with a final concentration of 5 μg / ml trypsin, and 100 μl was inoculated into HRT-18 cells per well. The cell lesions were observed daily until no new lesions appeared, and the titer was determined using the Reed muench method. After testing, the highest virus titers of the 2nd, 4th, 7th, 10th, and 14th generations reached 10 5.45 TCID 50 / ml.

[0053] Furthermore, the genetic evolutionary characteristics of the isolated strains were clarified, including:

[0054] The phylogenetic tree of virus isolates was constructed based on the BCoV S1 gene.

[0055] Furthermore, the sequence of the upstream primer of the BCoV S1 gene is shown in SEQ ID No. 3, and the sequence of the downstream primer is shown in SEQ ID No. 4. The above primer pair can accurately amplify the BCoV S1 gene, and the length of the amplified fragment is 2304 bp.

[0056] SEQ ID No. 3:ATGTTTTTGATACTTTTAATTTCC.

[0057] SEQ ID No. 4:ATGGCTCAAAATTAGTAAACCG.

[0058] The BCoV S1 gene is an important gene in bovine coronavirus, with significant immunogenicity and variability. The S1 protein encoded by the S1 gene is the N-terminal part of the spike protein of BCoV, located on the surface of the virus, and is a key protein for the virus to recognize and bind to host cell receptors. The variation of the S1 protein is closely related to the virulence, antigenicity and host range of the virus. The S1 protein is usually composed of multiple domains, including the receptor binding domain (RBD), which play an important role in the interaction between the virus and the host cell.

[0059] Compared with the prior art, the present invention has the following beneficial effects:

[0060] The bovine coronavirus isolation and identification method provided by the present invention uses RT-PCR to detect feces samples of diarrheal calves, inoculates sensitive cells into BCoV, and during continuous passage for 13 generations, the cytopathic effect is not obvious. After verification by RT-PCR, indirect immunofluorescence, and transmission electron microscopy, a bovine coronavirus is successfully isolated, and phylogenetic analysis shows that the virus belongs to the GⅡb genotype, which is named BCoV / China / HLJ / Helios01. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0062] Figure 1 fecal samples of calves with diarrhea for RT-PCR testing;

[0063] Figure 2 HRT-18 cells were serially passaged for RT-PCR detection of BCoV Helios01;

[0064] Figure 3 Cytopathic effects of HRT-18 cells inoculated with BCoV Helios01 and HRT-18 cells inoculated with 5 μg / ml of trypsin DMEM at a final concentration after 5 days of culture;

[0065] Figure 4 For indirect immunofluorescence detection of BCoV Helios01 infection in HRT-18 cells;

[0066] Figure 5 To examine BCoV Helios01 by transmission electron microscopy;

[0067] Figure 6 The titers of different generations of BcoV Helios01 viruses;

[0068] Figure 7 This is the phylogenetic tree of the BCoV Helios01 S1 gene. DETAILED DESCRIPTION

[0069] The technical scheme of the present invention will be clearly and completely described below in conjunction with the accompanying drawings and specific embodiments, but it will be understood by those skilled in the art that the following described embodiments are part of embodiments of the present invention, rather than all embodiments, and are only used to illustrate the present invention, and should not be considered as limiting the scope of the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If specific conditions are not specified in the embodiments, they are carried out according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified in the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0070] Example 1

[0071] The method for separating and identifying bovine coronavirus provided in this embodiment comprises the following steps:

[0072] 1. Sample Collection and Processing

[0073] Fresh feces of calves with diarrhea in a cattle farm in Qiqihar City, Heilongjiang Province were collected by rectal stimulation method, diluted with PBS at a ratio of 1:5, vortexed for 10 min, centrifuged at 8000 r / min for 20 min, and the supernatant was stored at -80℃.

[0074] 2. Sample inspection

[0075] Total RNA was extracted from the sample using Trizol and purified by PrimeScript TM RT reagent Kit (purchased from Takara) was used to reverse transcribe into cDNA and Premix Ex Taq TM II (purchased from Takara) is a DNA polymerase, and cDNA is detected by RT-PCR using primers targeting the BCoV N gene. The primer sequences are as follows:

[0076] 5' → 3'

[0077] F:AGGCTATTCCGACTAGGTTTCCG;

[0078] R:GTCCGTTCTTCTGACCACGCTGA.

[0079] The amplified fragment is 699 bp long. Figure 1 As shown, through Figure 1 It can be seen that there are BCoV positive samples in the calf feces samples, and those with brighter bands can be used for subsequent virus isolation.

[0080] The correct band was excised and recovered using the Omega gel recovery kit. The gel recovery product was connected to the pMD-18T vector (purchased from Takara), transformed into DH5α competent cells (purchased from Takara), coated with ampicillin-resistant plates, ampicillin-resistant LB medium, and shaken. After PCR verification of bacterial liquid, the positive bacterial liquid plasmid was extracted by a small extraction kit (purchased from TIANGEN), and after gel verification, it was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing using the Sanger method. The amplified fragment was confirmed to be a BCoV N gene fragment by BLAST, and cDNA was used as a positive control for subsequent detection.

[0081] 3. Virus Isolation

[0082] HRT-18 cells were cultured in a T25 cell culture flask using DMEM medium containing 10% fetal bovine serum, and inoculated when the confluence reached 90%. The positive sample solution was filtered using a 220nm filter membrane, and the sample was pretreated with trypsin at a final concentration of 50μg / ml for 1 hour, and HRT-18 cells were inoculated. After 1 hour of induction, DMEM maintenance solution was added to control the final concentration of trypsin in the reaction system to 5μg / ml. Cytopathic effects were observed, and the cells were frozen and thawed three times after 5 days. The virus was collected by centrifugation at 4000r / min for 10 minutes, and HRT-18 cells were inoculated in the same way. This was blindly propagated for three generations, and the collected viruses were stored at -80°C. Each generation of virus culture was detected using RT-PCR (same method as 2), and RT-PCR positive samples were taken for further propagation. The results are shown as follows Figure 2 and Figure 3 As shown, the target bands appeared in the RT-PCR of the viruses collected in the three generations. The virus caused the cells to show pathological changes such as elongation, deformation and shedding during the passaging process.

[0083] 4. RT-PCR Validation

[0084] Each generation of virus culture was tested by RT-PCR (same method as 2).

[0085] 5. Indirect Immunofluorescence

[0086] HRT-18 cells were inoculated into 24-well cell culture plates, and the BCoV isolate was inoculated when the confluence reached 90%. After 24 hours, the culture medium was removed and fixed with 4% tissue fixative for 30 minutes, 0.5% Triton membrane for 20 minutes, and 1% BSA for 1 hour. Mouse anti-BCoVS1 monoclonal antibody was used as the primary antibody and incubated at room temperature for 1.5 hours. FITC-labeled rabbit anti-mouse antibody was used as the secondary antibody and incubated at room temperature in the dark for 1 hour. DAPI was added for nuclear staining and observed under a fluorescent inverted microscope. The results are shown in Figure 4 As shown, through Figure 4It can be seen that specific green fluorescence was observed in HRT-18 cells infected with BCoV isolates, while there was no fluorescence in the control group, indicating that the BCoV isolates can replicate in HRT-18 cells.

[0087] 6. Transmission electron microscopy

[0088] Take 50μl of sample and drop it on filter paper, clamp the copper mesh and place it on the top of the drop, leave it at room temperature for 30 minutes, drop the negative staining solution on the filter paper, clamp the copper mesh and place it on the top of the negative staining drop for 10 seconds, clamp the copper mesh and place it on clean filter paper, leave it for 2 hours for electron microscopy observation. The results are as follows Figure 5 As shown, through Figure 5 It can be seen that the virus is less than 200nm in diameter, covered with a capsule on the surface, with spikes on the outermost layer. The length of the spikes is about 10nm, and the overall shape is a crown, which is consistent with the morphology of the coronavirus.

[0089] 7. Virus Titer Determination

[0090] HRT-18 cells were inoculated in 96-well plates, and the virus was inoculated when the cell confluence reached 90% to 100%. At 37°C, the BCoV virus solution was pretreated with serum-free DMEM medium with a final trypsin concentration of 50 μg / ml for 1 hour. The virus solution was diluted tenfold with serum-free DMEM with a trypsin concentration of 5 μg / ml, and 100 μl was inoculated into HRT-18 cells per well. A non-inoculated control was set up and cultured at 37°C. The number of lesion wells was observed and recorded well by well every day until no new lesion wells appeared, and the virus titer was measured by the Reed muench method. The highest titer of the BCoV isolate reached 10 5.45 TCID 50 / ml, such as Figure 6 As shown, it is shown that the virus titer of the isolate can be determined by observing cytopathic effect, which is convenient for studying the growth characteristics, pathogenicity and neutralizing antibody screening of BCoV strains.

[0091] 8. Genetic evolution analysis

[0092] The full-length primers of BCoV S1 gene were designed by SnapGene, and the full-length of BCoV S1 gene (2304bp) was amplified by PCR. The correct band was excised and recovered by Omega gel recovery kit. The gel recovery product was connected to pMD-18T vector, transformed into DH5α competent cells, plated, shaken, verified by bacterial liquid PCR, extracted positive bacterial liquid plasmid, and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing by Sanger method.

[0093] BCoV S1 gene full-length primers:

[0094] 5' → 3'

[0095] F:ATGTTTTTGATACTTTTAATTTCC;

[0096] R:ATGGCTCAAAATTAGTAAACCG.

[0097] The obtained sequences were compared with the full-length BCoV S1 gene in NCBI using MEGA7, and the phylogenetic tree of the BCoVS1 gene was constructed by the neighbor-joining method, as shown in Figure 7 As shown, through Figure 7 It can be seen that the isolate belongs to the bovine coronavirus GⅡb genotype and is most closely related to the BCoV / ShX310 strain discovered in China in 2021.

[0098] The present invention utilizes RT-PCR to detect feces samples of diarrheal calves, inoculates HRT-18 cells with BCoV, and during continuous passage for 13 generations, isolates a bovine coronavirus through RT-PCR, indirect immunofluorescence, and transmission electron microscopy verification, finds that the virus belongs to the bovine coronavirus GⅡb genotype through phylogenetic analysis, and names it BCoV / China / HLJ / Helios01, and preserves it in the General Microbiology Center of China Microbiological Culture Collection Committee with a preservation number of CGMCC No.46087.

[0099] Example 2

[0100] The difference between this embodiment and embodiment 1 is only in step 3, virus separation, which is as follows:

[0101] HRT-18 cells were cultured in a T25 cell culture flask using DMEM medium containing 10% fetal bovine serum, and inoculated when the confluence reached 93%. The positive sample solution was filtered using a 220nm filter membrane, and the sample was pretreated with pancreatic enzyme at a final concentration of 48μg / ml for 65min, and HRT-18G cells were inoculated. After 55min of induction, DMEM maintenance solution was added to control the final concentration of pancreatic enzyme in the reaction system to 6μg / ml. Cytopathic effects were observed, and the cells were frozen and thawed three times after 5 days, and the virus was collected by centrifugation at 3800r / min for 12min. HRT-18 cells were inoculated in the same way, and three generations were blindly propagated. The collected virus was stored at -80°C. Each generation of virus culture was detected using RT-PCR (same method as 2), and positive samples were taken for further propagation.

[0102] Example 3

[0103] The difference between this embodiment and embodiment 1 is only in step 3, virus separation, which is as follows:

[0104] HRT-18 cells were cultured in a T25 cell culture flask using DMEM medium containing 10% fetal bovine serum, and inoculated when the confluence reached 95%. The positive sample solution was filtered using a 220nm filter membrane, and the sample was pretreated with trypsin at a final concentration of 52μg / ml for 55min, and HCT-8 cells were inoculated. After 65min of induction, DMEM maintenance solution was added to control the final concentration of trypsin in the reaction system to 4μg / ml. Cytopathic effects were observed, and the cells were frozen and thawed three times after 6 days, and the virus was collected by centrifugation at 4200r / min for 12min. HRT-18 cells were inoculated in the same way, and three generations were blindly propagated. The collected virus was stored at -80°C. Each generation of virus culture was detected using RT-PCR (same method as 2), and positive samples were taken for further propagation.

[0105] Although the present invention has been illustrated and described with specific embodiments, it should be appreciated that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Those skilled in the art should understand that the technical solutions described in the above embodiments may be modified, or some or all of the technical features thereof may be replaced by equivalents without departing from the spirit and scope of the present invention. However, these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention. Therefore, this means that all such replacements and modifications within the scope of the present invention are included in the appended claims.

Claims

1. A bovine coronavirus Heilongjiang isolate, characterized in that: Its microbiological deposit number is: CGMCC No.46087.

2. The method for isolating and identifying the bovine coronavirus Heilongjiang isolate according to claim 1, characterized in that: The following steps are involved: (a) Fresh calf feces were collected by rectal stimulation, resuspended in PBS, vortexed and centrifuged, and the supernatant was collected; the supernatant was tested by RT-PCR using BCoV N gene primers, and the positive supernatant was filtered and sterilized for virus isolation; (b) treating the positive supernatant with trypsin and inoculating sensitive cells for infection, then adding DMEM maintenance solution containing trypsin to the reaction system for culture, freezing and thawing, centrifuging and collecting the virus after a period of time; subculturing the collected virus solution, detecting each generation of virus culture by RT-PCR, taking positive samples for further subculture, observing the cytopathic effect of the virus subculture process, and obtaining virus isolates; (c) The virus was isolated by transmission electron microscopy observation and indirect immunofluorescence verification, and the virus titer was determined by Reed Muench. The full-length sequence of the BCoV S1 gene was amplified by RT-PCR and compared with the gene sequence of the BCoV strain in the NCBI database to clarify the genetic evolutionary characteristics and genotyping of the isolated strain.

3. The method for isolating and identifying the bovine coronavirus Heilongjiang isolate according to claim 2, characterized in that: The sequence of the upstream primer of the BCoV N gene is shown in SEQ ID No.1, and the sequence of the downstream primer is shown in SEQ ID No.

2.

4. The method for isolating and identifying the bovine coronavirus Heilongjiang isolate according to claim 2, characterized in that: The pancreatic enzyme concentration of the pancreatic enzyme treatment is 48-52 μg / ml; the pancreatic enzyme treatment time is 55-65 min.

5. The method for isolating and identifying the bovine coronavirus Heilongjiang isolate according to claim 2, characterized in that: The confluence of the sensitive cells is 90% to 100%; The sensitive cells include at least one of HRT-18 cells, HRT-18G cells or HCT-8 cells.

6. The method for isolating and identifying the bovine coronavirus Heilongjiang isolate according to claim 2, characterized in that: The action time is 55 to 65 minutes.

7. The method for isolating and identifying the bovine coronavirus Heilongjiang isolate according to claim 2, characterized in that: Step (b), adding DMEM maintenance solution containing pancreatin to the reaction system, and controlling the concentration of pancreatin in the reaction system to be 4-8 μg / ml; In step (b), the period of time is 5 to 6 days.

8. The method for isolating and identifying the bovine coronavirus Heilongjiang isolate according to claim 2, characterized in that: In steps (a) and (b), the centrifugal speed is 3800-4200 r / min, and the centrifugal time is 8-12 min.

9. The method for isolating and identifying the bovine coronavirus Heilongjiang isolate according to claim 2, characterized in that: The described clear genetic evolutionary characteristics of the isolated strains include: constructing a phylogenetic evolutionary tree of the virus isolates based on the BCoV S1 gene.

10. The method for isolating and identifying the bovine coronavirus Heilongjiang isolate according to claim 2, characterized in that: The sequence of the upstream primer of the BCoV S1 gene is shown in SEQ ID No.3, and the sequence of the downstream primer is shown in SEQ ID No.4.

Images