IsMHETase mutant with high catalytic activity and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to an IsMHETase mutant with high catalytic activity and application of the IsMHETase mutant. The invention aims to solve the technical problem that the activity of the existing ISMETase is relatively low. The technical scheme of the invention is as follows: the IsMHETase mutant with high catalytic activity is a protein obtained by mutating IsMHETase of which the amino acid sequence is as shown in SEQ ID No.1. The invention also discloses a preparation method of the IsMHETase mutant with high catalytic activity. Six mutants are obtained after screening, and the enzyme activity is improved by 1.13-3.20 times compared with that of a wild type IsMHETase; the IsMHETase mutant obtained by the invention has higher enzyme activity, is more efficient when being used for biodegrading MHET micromolecules, simplifies the degradation steps, reduces the degradation cost, and provides a wide prospect for the application of the IsMHETase mutant in the industrial field.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an IsMHETase mutant with high catalytic activity and application thereof. Background Art

[0002] Plastics are used everywhere in modern society, from food packaging to building materials, from auto parts to medical devices. The widespread use of plastics has brought many conveniences to our lives. However, this convenience is also accompanied by increasingly serious environmental problems. Plastic pollution has become a global crisis, especially in the ocean, where the presence of plastic waste has had a profound impact on the ecosystem. Plastic waste in the ocean not only destroys the underwater landscape, but is also mistakenly eaten by marine organisms, causing damage to the health of these organisms, which in turn affects the entire food chain. The accumulation of plastics on land has also caused many problems, not only affecting the beauty of the environment in cities and villages, but also polluting soil and water resources. The long-term presence of plastics has made these wastes a stubborn disease in the environment, making them difficult to degrade naturally, leading to the destruction of the ecosystem and the loss of biodiversity.

[0003] The accumulation of plastic is very harmful. Accumulated plastic waste not only affects the natural beauty of the environment, but also poses a threat to animals and plants. Large amounts of plastic waste hinder the recovery of natural landscapes and may lead to habitat loss. Animals that accidentally eat plastic may suffer from digestive tract obstruction, malnutrition and even death. For humans, harmful chemicals contained in plastic may enter our bodies through the food chain, and long-term exposure may cause various health problems, including endocrine disorders and cancer risks.

[0004] Although plastic degradation is a natural process, it often has long-term impacts on the environment because traditional plastics degrade extremely slowly. Physical degradation breaks plastics into fragments through ultraviolet rays and weathering, but these fragments still pose a threat to the environment. Chemical degradation often causes secondary harm to the environment. Biodegradation is currently a more ideal solution. First, the biodegradation of plastics consumes less energy, has less environmental harm from its products, and is more environmentally friendly; second, compared with traditional plastics, biodegradable plastics can increase the decomposition rate through cascade reactions, which can significantly reduce the accumulation of waste in a shorter period of time.

[0005] PET (polyethylene terephthalate) is widely used in beverage bottles, food packaging, and fiber materials due to its excellent mechanical strength, chemical resistance, and transparency. However, the long-term stability and durability of PET make it difficult to degrade in the environment, leading to an increasingly serious problem of plastic waste. To solve this problem, researchers are looking for effective methods to accelerate the degradation process of PET. Recently, PETase and MHETase from Ideonella sakaiensis were found to be able to effectively degrade PET. In particular, IsMHETase can catalyze the degradation of MHET (CAS No. 959-26-2, mono-(2-hydroxyethyl)terephthalate, bis(2-hydroxyethyl)terephthalate). As an important intermediate product in the degradation process of PET, the accumulation of MHET will produce intermediate product inhibition, which is one of the rate-limiting steps for further degradation. The role of MHETase is to accelerate the final stage of PET degradation, and the inhibition of PET degradation intermediates is weakened. This discovery provides an important idea for the development of new plastic degradation technologies and opens up a new way to solve the problem of plastic pollution. By utilizing biodegradable enzymes such as MHETase, we hope to improve the degradation efficiency of PET and reduce the negative impact of plastic waste on the environment, thereby promoting the process of plastic recycling and resource recycling.

[0006] Although ISMHETase can degrade MHET, the enzyme activity is still low, making it difficult to directly achieve industrial application of MHET biodegradation. Summary of the invention

[0007] The technical problem to be solved by the invention is that the existing ISMHETase has low activity.

[0008] The technical solution of the present invention is a IsMHETase mutant with high catalytic activity, which is a protein obtained by mutating the IsMHETase with an amino acid sequence as shown in SEQ ID No.1.

[0009] Specifically, the mutation sites are amino acids 134, 286, 350, 380, 397 and / or 442.

[0010] Preferably, the mutation sites are K442A, A380Q, W397A, N134A, S286A and / or S350T.

[0011] The present invention also provides a gene encoding the IsMHETase mutant.

[0012] Specifically, the encoding gene of the mutant with the mutation site K442A is shown in SEQ ID No.7.

[0013] Specifically, the encoding gene of the mutant with the mutation site A380Q is shown in SEQ ID No.4.

[0014] Specifically, the encoding gene of the mutant with the mutation site W397A is shown in SEQ ID No.5.

[0015] Specifically, the encoding gene of the mutant with the mutation site N134A is shown in SEQ ID No.2.

[0016] Specifically, the encoding gene of the mutant with the mutation site S286A is shown in SEQ ID No.10.

[0017] Specifically, the encoding gene of the mutant with the mutation site of S350T is shown in SEQ ID No.3.

[0018] The present invention also provides an expression element, a vector or a host containing the IsMHETase mutant or the coding gene.

[0019] Specifically, the vector is a plasmid vector or a viral vector.

[0020] Furthermore, the host is a protein expression host such as Escherichia coli, Bacillus, Streptomyces, cyanobacteria or engineered yeast.

[0021] Particularly, the Escherichia coli is EPI400, BL21 (DE3), Top10 or DH5α.

[0022] Furthermore, the present invention also provides the use of the IsMHETase mutant, the gene encoding the IsMHETase mutant, the expression element, vector or host containing the IsMHETase mutant or the encoding gene in degrading plastics.

[0023] Specifically, the plastic is PET (polyethylene terephthalate).

[0024] The present invention also provides a plastic-degrading product, the main active ingredient of which is the IsMHETase mutant, a gene encoding the IsMHETase mutant, an expression element, a vector or a host containing the IsMHETase mutant or the encoding gene.

[0025] Specifically, the plastic is PET (polyethylene terephthalate).

[0026] The present invention also provides the use of the IsMHETase mutant, the coding gene encoding the IsMHETase mutant, the expression element, vector or host containing the IsMHETase mutant or the coding gene in degrading MHET.

[0027] The present invention also provides a product for degrading MHET, the main active ingredient of which is the IsMHETase mutant, a gene encoding the IsMHETase mutant, an expression element, a vector or a host containing the IsMHETase mutant or the encoding gene.

[0028] The beneficial effects of the present invention are as follows: the present invention obtains 34 mutation hotspots by performing molecular structure evolution, site-directed mutagenesis, protein structure prediction, high-throughput molecular docking and virtual preliminary screening of mutants on the key enzyme IsMHETase in the genetically engineered Escherichia coli that is derived from the previous construction and can degrade MHET, and further screening is carried out in combination with molecular dynamics analysis to obtain 9 mutants (N134A, S350T, A380Q, W397A, W397E, K442A, R116N, R318A, S286A. Among them, the enzyme activity of 6 mutants (N134A, S350T, A380Q, W397A, W397E, K442A) is increased by 1.13 to 3.20 times compared with the wild-type IsMHETase. The IsMHETase mutants obtained by the present invention have higher enzyme activity, are more efficient in biodegrading MHET small molecules, simplify the degradation steps, reduce the degradation cost, and provide broad prospects for its application in the industrial field. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 , Confidence results of MHETase prediction using AlphaFold3. Figure A, The predicted local distance difference test (pLDDT) image is a chart used to represent the accuracy of protein structure prediction. This chart is usually related to model evaluation and visualization in protein structure prediction. The main purpose of the pLDDT image is to evaluate the credibility and confidence of each amino acid residue position in the protein structure prediction. Figure B, Each point in the predicted alignment error (PAE) graph represents an amino acid residue, the horizontal axis represents the position in the protein sequence, and the vertical axis represents the structure prediction error of Alphafold3. Lower PAE values ​​indicate more accurate structure predictions.

[0030] Figure 2 , wild type and some mutants affinity bar graph, the horizontal axis is the wild type and mutant types, and the vertical axis is the affinity after molecular docking.

[0031] Figure 3, agarose gel electrophoresis of the PCR product of the IsMHETase mutant designed by the present invention.

[0032] Figure 4 , wild type and different IsMHETase mutants MHET degradation effects. The horizontal axis is the mutant type, and the vertical axis is the enzyme activity.

[0033] Figure 5 , visualization of the docking results of the three mutants with the highest enzyme activity. DETAILED DESCRIPTION

[0034] In order to obtain IsMHETase with better activity, the applicant chose to modify the gene by genetic engineering.

[0035] The applicant chose the point mutation method. First, the open source molecular evolution model was used to analyze MHETase. This model is an unsupervised algorithm that combines the structural information of proteins with the protein language model. Through this algorithm, optimization suggestions for the top 33 scoring sites were obtained, and then the bioinformatics platform was used to analyze the amino acid sequences of the mutants after single-point mutations of 33 amino acids to predict their 3D structures. After docking with MHET and sorting the affinity, candidate mutation sites were obtained, and vectors were constructed for the candidate mutation sites. Then, the candidate mutation sites were constructed into vectors and transformed into Escherichia coli. By detecting the activity of IsMHETase in the fermentation product, mutations that improve enzyme activity were determined.

[0036] The present invention is further described below in conjunction with specific embodiments to facilitate a better understanding of the present invention, but the protection scope of the present invention is not limited to the following description.

[0037] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0038] The culture medium formula involved in the embodiment is as follows: LB liquid culture medium (1L) contains: 5g yeast extract, 10g tryptone, 10g NaCl, pH 7.0. The improvement of enzyme catalytic activity can be expressed in specific enzyme activity units (μmol / mg / min per unit time, the number of moles of substrate converted into product by the enzyme catalytic active center per milligram of enzyme molecule). Therefore, the improvement of specific enzyme activity represents the improvement of enzyme catalytic activity.

[0039] Example 1 Determination of mutation hot spots of IsMHETase

[0040] 1. Mutation site prediction

[0041] The prediction is based on a protein modification model published in Science in July 2024. The paper link is: https: / / www.science.org / doi / 10.1126 / science.adk8946; the open source code is: https: / / github.com / varun-shanker / structural-evolution.

[0042] After setting up the model operating environment according to the instructions, the amino acid sequence of MHETase was input into the protein language model enhanced by the ESM-IF1 structural information. Driven by the MHETase structural information, the protein language model can effectively guide the evolution of the MHETase enzyme through the amino acid sequence and protein structure information. The recommended mutation sites and mutation directions are shown in Table 1.

[0043] Table 1 Suggested mutation sites and mutation directions

[0044] S235A H293E M192F K437A W453Y Y197I H467A S196A A181S W466V R411M A553L W397E W397A N134A V341A M433A A119V K256R A310V A380Q T638D D555S S350T A139D S260Q R318A R375S R116N Q458A N195L S286A W397A

[0045] 2. Construction of 3D model of IsMHETase

[0046] The amino acid sequence of MHETase (UniProtKB: A0A0K8P8E7) was obtained, and the Alphafold3 model was run on Google DeepMind's AlphaFold Server to obtain the model with the best PLDDT value for subsequent docking experiments. The Alphafold prediction results are as follows: Figure 1 The pLDDT (Per-Residue Local Distance Difference Test) values ​​are close to greater than 90 in the first 550 or more positions of the protein sequence, indicating a highly reliable structure prediction. PAE (Per-Residue Absolute Error) of the best conformation of MHETase Figure 1 All green in the figure indicates that the prediction error of the protein structure is very small, close to zero. This means that AlphaFold3 is very accurate in predicting the IsMHETase protein structure at most positions. At the same time, the prediction also received a pTm=0.97 (prediction template modeling score), and the pTM score is higher than 0.5, which also means that the overall predicted folding of the complex may be similar to the true structure, reflecting the high accuracy of the entire structure.

[0047] 3. Screening of mutation hotspots

[0048] All sequences (33 in total) after 33 single-point directed mutations of amino acids in MHETase were input, and homology modeling was performed using the wild-type MHETase structure predicted by AlphaFold3 as a template to obtain the 3D structures of the 33 mutants for subsequent experiments.

[0049] Autodock and Autodock Vina software were used to dock each mutant structure with MHET small molecule (CID: 22062452) as the small molecule substrate, and the affinity was ranked. Finally, the top four optimal mutants were obtained, namely: N134A, S350T, A380Q, W397A, W397E, K442A, R116N, R318A, and S286A, which are abbreviated as: R116N, N134A, R318A, S350T and K442A respectively. Figure 2 The following is a bar graph showing the affinity of the wild type, the best mutant, and the remaining mutants; it shows the affinity of the wild type and different IsMHETase mutants for the substrate MHET molecule. Among all the mutants we selected, they all showed a clear advantage in affinity, that is, compared with the wild type (WT) of -1.668 kcal / mol, the affinity of all other selected mutants was higher than that of the wild type.

[0050] Example 2 Construction of mutants

[0051] Using PCR technology, a specific nucleotide sequence was successfully introduced into the NusA-MHETase-Pcold recombinant DNA vector obtained previously by gene synthesis (see Table 2 for mutation primers) to achieve site-directed mutagenesis (primer synthesis service provided by Shanghai Shenggong Biotechnology Co., Ltd.). Figure 3 As shown, the results indicate that the coding sequence of the mutated protein is obtained.

[0052] The specific conditions of the PCR amplification process are: pre-denaturation at 94°C for 2 minutes, followed by 35 cycles, each cycle including 10 seconds at 98°C, 2 minutes and 30 seconds at 62°C, and 2 minutes at 72°C. After the amplification is completed, a thorough extension is performed at 72°C for 10 minutes.

[0053] Table 2 All primers used for site-directed mutagenesis

[0054]

[0055]

[0056] Sequencing confirmed that the target mutation site was successfully introduced into the NusA-MHETase-Pcold recombinant DNA vector. It was transformed into E. coli ST7 competent cells and cultured on LB agar plates containing 100 μg / mL ampicillin at 37°C for 12 hours to successfully obtain positive clones.

[0057] In order to further obtain more mutant vectors, the transformants were expanded in liquid LB medium, and 9 different NusA-MHETase-Pcold genetically engineered Escherichia coli mutants were successfully constructed.

[0058] The mutants were named N134A, S350T, A380Q, W397A, W397E, K442A, R116N, R318A, and S286A, respectively. The nucleotide sequences of the mutated MHETase genes are listed as follows:

[0059] SEQ ID No.1 Wild-type MHETase amino acid sequence

[0060] MQTTVTTMLLASVALAACAGGGSTPLPLPQQQPPQQEPPPPPVPLASRAACEALKDGNGDMVWPNAATVVEVAAWRDAAPATASAAALPEHCEVSGAIAKRTGIDGYPYEIKFRLRMPAEWNGRFFMEGGSGTNGSLSAATGSIGGGQIASALSRNFATIATDGGHDNAVNDNPDALGTVAFGLDPQARLDMGYNSYDQVTQAGKAAVARFYGRAADKSYFIGCSEGGREGMMLSQRFPSHYDGIVAGAPGYQLPKAGISGAWTTQSLAPAAVGLDAQGVPLINKSFSDADLHLLSQAILGTCDALDGLADGIVDNYRACQAAFDPATAANPANGQALQCVGAKTADCLSPVQVTAIKRAMAGPVNSAGTPLYNRWAWDAGMSGLSGTTYNQGWRSWWLGSFNSSANNAQRVSGFSARSWLVDFATPPEPMPMTQVAARMMKFDFDIDPLKIWATSGQFTQSSMDWHGATSTDLAAFRDRGGKMILYHGMSDAAFSALDTADYYERLGAAMPGAAGFARLFLVPGMNHCSGGPGTDRFDMLTPLVAWVERGEAPDQISAWSGTPGYFGVAARTRPLCPYPQIARYKGSGDINTEANFACAAPP

[0061] Nucleotide after the N134A mutation of SEQ ID No.2

[0062]

[0063] SEQ ID No.3 Nucleotide after S350T mutation

[0064]

[0065] SEQ ID No.4A380Q mutated nucleotide

[0066]

[0067] SEQ ID No.5 Nucleotide after W397A mutation

[0068]

[0069] Nucleotide after SEQ ID No.6W397E mutation

[0070]

[0071] SEQ ID No.7 Nucleotide after K442A mutation

[0072]

[0073] SEQ ID No.8 Nucleotide after R116N mutation

[0074]

[0075] SEQ ID No.9R318A mutated nucleotide

[0076]

[0077] Nucleotide after the SEQ ID No.10 S286A mutation

[0078] ATGCAGACCACCGTGACCACCATGCTGCTGGCGAGCGTTGCGCTGGCGGCGTGCGCGGGTGGCGGTA

[0079] GCACCCCGCTGCCGCTGCCGCAGCAACAGCCGCCGCAACAGGAGCCGCCGCCGCCGCCGGTGCCGC

[0080] TGGCGAGCCGTGCGGCGTGCGAAGCGCTGAAGGATGGTAACGGTGACATGGTGTGGCCGAACGCGG

[0081] CGACCGTGGTTGAGGTTGCGGCGTGGCGTGATGCGGCGCCGGCGACCGCGAGCGCGGCGGCGCTGC

[0082] CGGAGCACTGCGAAGTTAGCGGTGCGATCGCGAAGCGTACCGGTATTGACGGCTACCCGTATGAAATC

[0083] AAATTTCGTCTGCGTATGCCGGCGGAGTGGAACGGTCGTTTCTTTATGGAAGGCGGTAGCGGTACCAA

[0084] CGGCAGCCTGAGCGCGGCGACCGGTAGCATCGGCGGTGGCCAAATTGCGAGCGCGCTGAGCCGTAA

[0085] CTTTGCGACCATTGCGACCGATGGTGGCCACGACAACGCGGTGAACGATAACCCGGACGCGCTGGGT

[0086] ACCGTTGCGTTCGGCCTGGATCCGCAGGCGCGTCTGGACATGGGTTACAACAGCTATGATCAAGTGAC

[0087] CCAGGCGGGCAAGGCGGCGGTTGCGCGTTTCTACGGTCGTGCGGCGGACAAAAGCTATTTTATCGGT

[0088] TGCAGCGAGGGTGGCCGTGAAGGCATGATGCTGAGCCAACGTTTCCCGAGCCACTACGATGGTATCG

[0089] TGGCGGGTGCGCCGGGTTATCAGCTGCCGAAGGCGGGTATTAGCGGCGCGTGGACCACCCAAAGCCT

[0090] GGCGCCGGCGGCGGTGGGTCTGGACGCGCAGGGCGTTCCGCTGATTAACAAAgcgTTTAGCGACGCG

[0091] GATCTGCACCTGCTGAGCCAAGCGATCCTGGGTACCTGCGATGCGCTGGACGGTCTGGCGGATGGCAT

[0092] TGTTGACAACTACCGTGCGTGCCAGGCGGCGTTCGATCCGGCGACCGCGGCGAACCCGGCGAACGGT

[0093] CAAGCGCTGCAATGCGTGGGTGCGAAGACCGCGGACTGCCTGAGCCCGGTGCAAGTTACCGCGATCA

[0094] AACGTGCGATGGCGGGTCCGGTTAACAGCGCGGGCACCCCGCTGTACAACCGTTGGGCGTGGGATGC

[0095] GGGTATGAGCGGCCTGAGCGGTACCACCTATAACCAAGGTTGGCGTTCCTGGTGGCTGGGCAGCTTTA

[0096] ACAGCAGCGCGAACAACGCGCAGCGTGTGAGCGGTTTCAGCGCGCGTAGCTGGCTGGTTGACTTTGC

[0097] GACCCCGCCGGAGCCGATGCCGATGACCCAGGTGGCGGCGCGTATGATGAAGTTCGACTTTGATATCG

[0098] ACCCGCTGAAAATTTGGGCGACCAGCGGTCAATTCACCCAGAGCAGCATGGATTGGCACGGTGCGAC

[0099] CAGCACCGATCTGGCGGCGTTTCGTGACCGTGGTGGCAAGATGATCCTGTACCACGGTATGAGCGAC

[0100] GCGGCGTTCAGCGCGCTGGATACCGCGGACTACTATGAACGTCTGGGTGCGGCGATGCCGGGTGCGG

[0101] CGGGTTTCGCGCGTCTGTTTCTGGTGCCGGGTATGAACCATTGCAGCGGTGGTCCGGGCACCGATCGT

[0102] TTTGACATGCTGACCCCGCTGGTTGCGTGGGTTGAGCGTGGTGAAGCGCCGGATCAAATTAGCGCGT

[0103] GGAGCGGCACCCCGGGTTATTTCGGTGTTGCGGCGCGTACCCGTCCGCTGTGCCCGTACCCGCAGATC

[0104] GCGCGTTATAAAGGTAGCGGCGACATTAACACCGAGGCGAACTTCGCGTGCGCGGCTCCGCCG Example 3 Evaluation of the recombinant expression activity of IsMHETase

[0105] Induced expression: In this embodiment, a single clone was first selected from an Escherichia coli mutant containing the pPET30a-IsMHETase gene and inoculated into LB liquid culture medium at a ratio of 1:1000. Culture was carried out under shaking conditions of 37°C and 180rpm until the OD600 value reached 0.6-0.8. Subsequently, 0.5mM isopropyl-β-D-thiogalactoside (IPTG) was added to the culture medium to achieve a final concentration of 0.1mM, and culture was continued at 16°C and 180rpm for 18 hours. After the culture was completed, the bacteria were collected by centrifugation and the bacterial solution was resuspended in PBS buffer at pH 7.4 for subsequent experimental operations. This step ensures the efficient induced expression of the target protein, and each treatment was independently repeated three times to ensure the reliability of the results.

[0106] Preparation of MHET stock solution: For subsequent activity evaluation experiments, accurately weigh 10 mg of MHET and dissolve it in 1 mL of dimethyl sulfoxide (DMSO) to prepare a 40 mM MHET stock solution. This step provides a standardized substrate concentration for subsequent enzyme activity evaluation.

[0107] Ultrasonic lysis: Transfer the bacterial solution to be lysed into a 50mL small beaker, ensuring that the total volume is between 20 and 50mL. In order to maintain a low temperature environment and prevent protein inactivation, place the small beaker in a large beaker filled with ice cubes. Use an ultrasonic lysator for lysis, with the power set at 170-190W, and the liquid surface should not shake violently or bubble. Work for 1 second and pause for 3 seconds, with a total duration of 40 minutes. During the lysis process, when the viscosity of the liquid decreases significantly and becomes clear, the lysis is considered complete. If the expected effect is not achieved, the lysis time can be extended by 5 to 10 minutes. This step aims to destroy the cell structure by physical methods, release the proteins in the cells, and prepare for the subsequent purification steps.

[0108] Purification: Take out the pre-cooled nickel column from the 4°C environment and fix it vertically above the conical flask. Open the upper and lower ports of the column and let the alcohol solution in the column drain naturally. Use 1x PBS buffer for equilibration and repeat the operation twice to ensure the column is balanced. Next, prepare 10mM imidazole solution for further equilibration of the nickel column. Add the sample supernatant to the nickel column and incubate it in an ice bath for 45 minutes to promote full contact between nickel ions and the sample. Then, use 30mM imidazole buffer for washing, and control the flow rate to ensure full removal of impurities. Finally, prepare 300mM imidazole solution for protein elution and collect the eluted protein solution. Rinse the nickel column with 1× PBS buffer until the impurities in the column are completely removed. Close the lower port of the nickel column, add 20% ethanol solution for storage, and store it at 4°C. This step achieves efficient purification of the target protein through affinity chromatography technology.

[0109] Degradation: In this step, the protein concentration is first determined using Coomassie Brilliant Blue solution. The total volume of the degradation system is 800 μL, to which 20 μL of 40 mM MHET stock solution is added to bring the MHET concentration in the system to 2 mM. Then, a 100 mM purified protein sample is added to bring the protein concentration in the system to 100 nM, and the remaining volume is filled with PBS. Degrade at 30°C for 30 minutes, followed by inactivation at 90°C for 15 minutes.

[0110] HPLC analysis: HPLC analysis was performed using a Waters E2695 chromatographic system equipped with a Shim-pack GIS column. The mobile phase consisted of a mixture of methanol and acetonitrile, the flow rate was set at 0.5 mL / min, and the detection wavelength was 254 nm. During the chromatographic analysis, a gradient elution was first performed using 95% formic acid and 5% acetonitrile from 0 to 2 minutes. Subsequently, a linear gradient elution was performed, increasing the acetonitrile concentration to 20% over 2 to 14 minutes while maintaining a formic acid concentration of 80%. The system was re-equilibrated to the initial conditions over a period of 14 to 15 minutes. The gradient pump mode was used throughout the chromatographic run. The amount of product from each PET hydrolysis reaction was determined by measuring the total peak area of ​​MHET. This step accurately analyzed the degradation products of IsMHETase by HPLC technology, thereby evaluating its recombinant expression activity.

[0111] After the above experimental verification, the degradation effects of all mutants are as follows Figure 4 As shown. After single-point mutations were made to the mutation hotspots of the wild type (WT), a series of mutants such as K442A, A380Q, W397A, N134A, S286A, and S350T all showed higher enzyme activity than the wild type (WT). This phenomenon may be attributed to the positive effects of these mutation sites on the microenvironment of the enzyme active center or the overall conformation of the enzyme, thereby optimizing the interaction between the enzyme and the substrate. However, not all mutations bring positive effects. The mutants W397T, R318A, and R116N showed lower enzyme activity compared to the wild type (WT), which may be due to the adverse effects of mutations at these sites on the stability of the enzyme or the substrate binding ability. As shown in Table 3, the activity of these mutants is about 1.12 to 3.2 times higher than that of the wild type. This significant improvement shows that the catalytic efficiency of the enzyme can be effectively enhanced through carefully designed single-point mutations. This directed optimization strategy can not only improve the performance of enzymes in specific industrial applications, but also help to deeply understand the molecular mechanism of enzyme activity regulation. As Figure 5 As shown in the figure, three mutants with the highest enzyme activity were selected for visualization after molecular docking to further explore the enhancing effect of these mutations on enzyme activity. Through this analysis, the interaction between the mutation site and the substrate binding pocket can be intuitively observed, as well as how these interactions affect the overall conformation and function of the enzyme. These findings provide valuable information for future enzyme engineering and help design more efficient and stable biocatalysts to meet the needs of industrial production.

[0112] Table 3

[0113] name Amino acid mutation site IU / mL multiple WT - 17.4333 1 K442A Lys442Ala 55.5567 3.19 A380Q Ala380Gln 45.8500 2.63 W397A Trp397Ala 39.0967 2.24 N134A Asn134Ala 25.8867 1.48 S286A Ser286Ala 20.4333 1.17 S350T Ser350Thr 19.9087 1.14 W397E Trp397Glu 15.7100 0.90 R318A Arg318Ala 14.6933 0.84 R116N Arg116Asn 11.3887 0.65

Claims

1. A IsMHETase mutant with high catalytic activity, characterized in that: The mutant is a protein obtained by mutating the IsMHETase with the amino acid sequence shown in SEQ ID No.

1.

2. The IsMHETase mutant with high catalytic activity according to claim 1, characterized in that: The mutation sites are amino acids 134, 286, 350, 380, 397 and / or 442; Preferably, the mutation sites are K442A, A380Q, W397A, N134A, S286A and / or S350T.

3. The coding gene of the IsMHETase mutant according to claim 1 or 2.

4. The coding gene according to claim 3, characterized in that: One of the following characteristics: a. The coding gene of the mutant with the mutation site K442A is shown in SEQ ID No.7; b. The coding gene of the mutant with the mutation site A380Q is shown in SEQ ID No.4; c. The coding gene of the mutant with the mutation site W397A is shown in SEQ ID No.5; d. The coding gene of the mutant with the mutation site N134A is shown in SEQ ID No. 2; e. The coding gene of the mutant with the mutation site S286A is shown in SEQ ID No.10; f. The encoding gene of the mutant with the mutation site of S350T is shown in SEQ ID No.

3.

5. An expression element, vector or host containing the IsMHETase mutant according to claim 1 or 2, or the encoding gene according to claim 3 or 4.

6. The expression element, vector or host according to claim 5, characterized in that At least one of the following is met: 1) The vector is a plasmid vector or a viral vector; 2) Alternatively, the host is a protein expression host such as Escherichia coli, Bacillus, Streptomyces, cyanobacteria or engineered yeast; 3) Preferably, the Escherichia coli is EPI400, BL21 (DE3), Top10 or DH5α.

7. Use of the IsMHETase mutant according to claim 1 or 2, the coding gene of the IsMHETase mutant according to claim 3 or 4, the expression element, vector or host according to claim 5 or 6 in degrading plastics; Preferably, the plastic is PET (polyethylene terephthalate).

8. A degradable plastic product, characterized in that: Its main active ingredients are the IsMHETase mutant described in claim 1 or 2, the coding gene of the IsMHETase mutant described in claim 3 or 4, and the expression element, vector or host described in claim 5 or 6; preferably, the plastic is PET (polyethylene terephthalate).

9. Use of the IsMHETase mutant according to claim 1 or 2, the coding gene of the IsMHETase mutant according to claim 3 or 4, the expression element, vector or host according to claim 5 or 6 in degrading MHET.

10. A product for degrading MHET, characterized in that: The main active ingredients are the IsMHETase mutant described in claim 1 or 2, the coding gene of the IsMHETase mutant described in claim 3 or 4, and the expression element, vector or host described in claim 5 or 6.

Images