Rosa chinensis petal color generation regulation gene RhBZ1 and application thereof
Through cloning and bioinformatics analysis of the RhBZ1 gene of micro roses, the problem of insufficient color of micro roses is solved, providing a theoretical basis for regulating the color of petals, and promoting the improvement of color diversity.
Patent Information
- Application Number
- CN202411886967.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-20
- Publication Date
- 2025-03-21
AI Technical Summary
The color of the miniature roses is not rich enough, and there is a lack of research reports on the coloring mechanism of the miniature rose petals.
The gene RhBZ1, which is involved in the anthocyanin glycosylation modification, was cloned, and bioinformatics analysis was conducted to explore the role of RhBZ1 in regulating petal coloration.
Through the research of RhBZ1 gene, the theoretical basis is provided for artificial regulation and molecular improvement of micro roses, which improves the possibility of color diversity.
Smart Images
Figure CN119662676A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of bioengineering, and in particular to a rose petal color regulation gene RhBZ1 and an application thereof. Background Art
[0002] Miniature roses are perennial woody plants of the genus Rosa in the Rosaceae family. They are an important group of modern roses. They are compact, branched, and bloom continuously. They are small and exquisite, and are deeply loved by consumers. They can also be widely used in garden landscape decoration, miniature bonsai production, balcony beautification, etc. Flower color is one of the most important commercial and ornamental traits of ornamental plants, but the flower color of miniature roses is not rich enough. There is no research report on the color of miniature rose petals. Studying the color mechanism of miniature rose petals is of great significance and potential scientific value. Summary of the invention
[0003] The purpose of the present invention is to provide a rose petal color regulation gene RhBZ1 and its application. This study uses the miniature rose 'Poseidon King' introduced from the Netherlands and the flower color mutant 'Queen' discovered and identified during production as test materials, analyzes the difference in flavonoid metabolites in the petals of the two during the blooming period, and then analyzes the expression characteristics of genes related to the flavonoid metabolic pathway to explore the causes of the mutant color differences. The research results can provide a theoretical basis for the artificial regulation and molecular improvement of the flower color of miniature roses.
[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0005] The present invention provides a rose petal color regulation gene RhBZ1, and the nucleotide sequence of the gene RhBZ1 is shown in SEQ ID NO:1.
[0006] Preferably, the amino acid sequence encoded by the gene RhBZ1 is shown in SEQ ID NO:2.
[0007] The present invention provides an application of the RhBZ1 gene in regulating the color of rose petals or in rose breeding. The nucleotide sequence of the RhBZ1 gene is shown in SEQ ID NO: 1.
[0008] The invention provides an expression vector, comprising an initial vector and the RhBZ1 gene.
[0009] Preferably, the initial vector is pMD19-T or pYBA-1332.
[0010] The present invention provides a host transformed or transfected with the expression vector; the host is a microorganism.
[0011] The present invention provides the rose petal color regulating gene RhBZ1, the expression vector or the host for use in regulating the rose petal color or in rose breeding.
[0012] Compared with the prior art, the present invention has the following beneficial effects:
[0013] The present invention cloned the miniature rose gene RhBZ1 involved in anthocyanin glycosylation modification and conducted bioinformatics analysis on it. The gene coding region is 1407 bp long and encodes 468 amino acids. The protein molecular weight is 50649.30 and the atomic formula is C 2290 H 3597 N 595 O 667 S 16 , which is a stable hydrophilic protein. The protein has a total of 63 phosphorylation sites, mainly serine phosphorylation. Analysis showed that it has two transmembrane regions, and the secondary structure is mainly composed of α-helix (28.34%) and random coil (39.10%) as structural elements. The tertiary structure is predicted to have a helix-loop-helix structure. Subcellular localization analysis showed that RhBZ1 was found in the cell membrane, cytoplasm and nucleus.
[0014] The present invention further uses qRT-PCR to detect and study the expression pattern of RhBZ1 in different organs. The analysis results show that the expression level is highest in petals and trace amounts are expressed in stems and leaves. There are also significant differences in the expression of this gene at different stages of flower development. The expression level is low in the bud stage, reaches the highest level in the blooming stage, and decreases in the flower decay stage. It is determined that this gene is a key gene for regulating the color of the mutant petals. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 PCR amplification and electrophoresis detection of RhBZ1; Note: The leftmost amplified band is the marker; the other four bands are the target gene (four repeats).
[0016] Figure 2 The figure shows the coding region of RhBZ1 and its amino acid sequence.
[0017] Figure 3 The phylogenetic tree of UFGT amino acid sequences of miniature roses and other crops;
[0018] Figure 4 The amino acid sequence alignment of UFGTs; Note: The blue markers are the common motifs of glycosyltransferases.
[0019] Figure 5 Prediction of the conserved functional domains of miniature rose RhBZ1 protein.
[0020] Figure 6 Analysis of the hydrophilicity of RhBZ1.
[0021] Figure 7 For RhBZ1 phosphorylation analysis.
[0022] Figure 8 Analysis of the transmembrane structure of RhBZ1.
[0023] Fig. 9 Prediction of the secondary structure of RhBZ1.
[0024] Fig.10 Prediction of the tertiary structure of RhBZ1.
[0025] Fig.11 Subcellular localization of RhBZ1.
[0026] Fig.12 Analysis of RhBZ1 expression pattern. DETAILED DESCRIPTION
[0027] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0028] Example 1
[0029] 1.1 Materials and methods
[0030] 1.1.1 Test materials
[0031] The European miniature rose 'Neptune King' (H) and its flower color mutant 'Queen' (S) discovered and identified in production were selected from the flowering plants bred in batches at the same time under routine production management in a multi-span greenhouse. Plants with good growth, robustness and no diseases or insect pests were selected, and 10 flowers in full flowering period were randomly collected. The outermost two layers and the innermost two layers of petals of the whole flower were removed, and the middle layer of petals were quickly frozen in liquid nitrogen, and then stored in an ultra-low temperature refrigerator at -80°C for cDNA extraction (reference prior art: Integrated metabolome and transcriptome analysis of the anthocyanin biosynthetic pathway in relation to color mutation in miniature roses BMC Plant Biology, 2021.05).
[0032] 1.1.2 RNA extraction and reverse transcription
[0033] (1) RNA extraction and quality detection methods refer to existing technologies
[0034] (2) This study used a reverse transcription kit (OMEGA, R6827) to perform sample RNA reverse transcription experiments, and the specific operation steps were carried out according to the reference instructions.
[0035] 1.1.3 Target gene cloning
[0036] 1.1.3.1 Primer design and synthesis
[0037] The cDNA of the petals of the mutant at full flowering stage was used as a template for amplification. Specific PCR primers were designed using Primer Premier 5.0 software and synthesized at Sangon Biotech (Shanghai) Co., Ltd.
[0038] Primers used for gene cloning:
[0039] F ATGGCAGTAGTCAACAGCTC
[0040] R TTAAGTCGAAGAAATAATCAAATCTACCAA
[0041] As shown in SEQ ID NO: 3 and 4.
[0042] 1.1.3.2 PCR amplification procedures and systems
[0043] PrimeSTAR Max high-fidelity enzyme (Takara, Dalian, Cat. No. R045) was used to amplify the target fragment. The specific details are shown in the table below.
[0044] Table 1 PCR reaction system
[0045]
[0046] Table 2 PCR reaction program
[0047]
[0048] 1.1.3.3 Electrophoresis detection
[0049] After PCR amplification, take 10 μL of the product and perform electrophoresis at 220V for about 20 minutes to observe whether it is present and single. By comparing it with the DNA Marker, determine whether the target gene is amplified correctly.
[0050] 1.1.3.4 Purification and recovery of PCR products
[0051] After agarose electrophoresis, the target fragment is recovered using a gel recovery kit. Depending on the added nucleic acid dye, the gel can be cut under ultraviolet light or fluorescent light. The cut target band is placed in a 2mL centrifuge tube. The specific steps are as follows:
[0052] 500 μL of the equilibrium solution BL was pipetted into the adsorption column CA2, followed by centrifugation (12200×g, 1 min), and finally the collected solution was discarded.
[0053] Add an equal volume of sol solution PN to the centrifuge tube and place it in a 50°C water bath. During this period, the centrifuge tube needs to be gently turned over continuously and the gel block is taken out after it is completely dissolved.
[0054] The completely dissolved liquid in the previous step was added to the CA2 adsorption column, placed at room temperature for 2 minutes, and then centrifuged (12200×g, 30 seconds), and finally the collected liquid was discarded.
[0055] Add 600 μL of the rinse solution PW to the adsorption column CA2, let it stand at room temperature for 2-5 min, then centrifuge (12200×g, 30 s), and finally discard the collected solution. Repeat this step.
[0056] Place the adsorption column back into the collection tube, centrifuge for 2 min at 12,200 × g, and then leave to dry at room temperature to prevent residual ethanol from affecting subsequent enzyme digestion experiments.
[0057] Place the adsorption column CA2 in a clean centrifuge tube, add 50 μL of elution buffer EB, leave at room temperature for 2 minutes, then centrifuge (12200×g, 2 minutes), repeat the elution once to obtain a higher concentration DNA solution, and finally store in a -20℃ refrigerator for later use.
[0058] 1.1.3.5 Ligation of target fragment and vector
[0059] The target product is connected to the T vector. The recovered product is connected to the T vector. The gel recovery product (about 4 μL) is placed in a microcentrifuge tube, and 1 μL of pMD19-T vector (Takara, 3271) is added, and the volume is filled to 5 μL with ddH2O. Then 5 μL of Solution I is added to mix, and then centrifuged. Finally, the reaction is carried out using a PCR instrument at 16°C, usually for 30 minutes. When the fragment is long, the connection time can be extended accordingly.
[0060] 1.1.3.6 Transformation of E. coli with ligation products
[0061] The specific operation of transforming the ligation product into E. coli is as follows: the competent E. coli is divided into 50 μL per tube. 5 μL of the ligation product is mixed with 50 μL of the competent E. coli, and then placed on ice for 30 minutes, followed by heat shock in a water bath (42°C, 60s), and then quenched on ice for 3 minutes. Add 700 μL of LB liquid culture medium under sterile conditions and mix, and then shake on a shaker at 37°C (180rpm, 1h). The bacterial solution is evenly applied to the LB solid culture medium containing AMP with a sterilized coating rod, and inverted in a 37°C conditioned incubator. The growth of the colony is observed for about 12 hours. Pick a single colony and add it to liquid LB (containing AMP), and then shake the bacteria for about 12 hours under the above conditions.
[0062] 1.1.3.7 PCR identification of bacterial fluid
[0063] Add 400 μL of liquid LB to a 2 ml sterilized centrifuge tube, use a sterilized pipette tip to select monoclonal plaques with clear edges and good appearance, gently pick them up and put them into the centrifuge tube. Place the centrifuge tube on a 37°C constant temperature shaker for 1 to 2 hours. Perform PCR reaction according to Table 3 below, select positive clones after gel electrophoresis identification, and submit them to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequences of the sequence consensus sites in the three samples can be used as the effective reference sequence of the material.
[0064] Table 3 PCR reaction system
[0065]
[0066] Table 4 PCR reaction program
[0067]
[0068] 1.1.3.8 Plasmid extraction
[0069] Use a plasmid extraction kit to extract the plasmid. The specific steps are as follows.
[0070] Inoculate the bacteria containing the target vector into a 10-20 mL culture tube containing 1-5 mL LB / antibiotic culture medium and culture at 37°C in a shaking incubator for 12-16 hours. Centrifuge at 10,000×g for 1 minute and collect 1-5 mL of bacteria.
[0071] Pour off the culture medium and tap gently on absorbent paper to remove any residual liquid. Add 250 μL of Buffer P1 / RNase A mixture and vortex at high speed to resuspend the bacteria. Make sure RNase A has been added to Buffer P1 before use. Thorough resuspension of bacteria is critical to yield, and no bacterial clumps should be visible after resuspension.
[0072] Add 250 μL of Buffer P2 to the resuspension and mix by inverting 8-10 times. Invert gently to mix. Vortexing can cause genomic DNA contamination. The solution becomes viscous and transparent, indicating that the bacteria have been fully lysed. If necessary, let it stand at room temperature for 2 minutes, inverting several times during the process. When processing multiple samples, this step should not exceed 4 minutes.
[0073] Add 350μL BufferNP3 and immediately invert 8-10 times to completely neutralize the solution. After adding BufferNP3, invert and mix immediately to prevent precipitation from agglomerating and affecting the neutralization effect. Centrifuge for 1min. Centrifuge at 20-25℃. Low-temperature centrifugation will cause SDS to precipitate and it will be impossible to obtain a clear supernatant. Place HiPureDNAMiniColumnII in the collection tube and pour the supernatant into the column. Centrifuge at 13000×g for 60s.
[0074] Discard the filtrate and put the column back into the collection tube. Add 500 μL Buffer PW1 to the column. Centrifuge at 13000×g for 30-60 seconds.
[0075] Discard the filtrate and put the column back into the collection tube. Add 600 μL Buffer PW2 (diluted with anhydrous ethanol) to the column. Centrifuge at 13000×g for 30-60 seconds.
[0076] Discard the filtrate and put the column back into the collection tube. Add 600 μL Buffer PW2 (diluted with anhydrous ethanol) to the column. Centrifuge at 13000×g for 30-60 seconds.
[0077] Discard the filtrate, put the column back into the collection tube, and dry the column by centrifugation at 13000×g for 1 min.
[0078] Place the column in a sterilized 1.5 mL centrifuge tube. Add 30-100 μL Elution Buffer to the center of the column membrane. Let stand for 1 minute, and centrifuge at 13,000 × g for 1 minute to elute the DNA.
[0079] 1.1.4 Bioinformatics analysis
[0080] Bioinformatics analysis of RhBZ1 was performed using online websites, and ProtParam (https: / / web.expasy.org / protparam / ) was used to perform physicochemical analysis of proteins. http: / / smart.embl.de / ) and SignalP5 (http: / / www.cbs.dtu.dk / services / SignalP / ) for signal peptide analysis, ProtScale (https: / / web.expasy.org / prot scale / ) for protein hydrophilicity prediction, and WoLFPSORT ( https: / / wolfpsort.hgc.jp / ) and SUBA4 (http: / / suba.live / ) were used for subcellular localization analysis, NetPhos2.0 Server (http: / / www.cbs.dtu.dk / services / NetPhos / ) was used for phosphorylation analysis, TMHMM Serverv.2.0 (http: / / www.cbs.dtu.dk / services / TMHMM / ) was used for transmembrane structure analysis, SOPMA (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.pl?page=npsa_sopma.html) was used to predict the secondary structure of the protein sequence, and Swiss-Model Workspace (https: / / swissmodel.expasy.org / ) was used to establish the tertiary structure of the protein.
[0081] 1.1.5 Subcellular localization analysis
[0082] Subcellular localization of RhBZ1 protein was performed by transient expression of exogenous genes in tobacco leaves mediated by Agrobacterium. The CDS sequence of the RhBZ1 gene cloned from miniature rose was connected between BamHI and EcoR I of pYBA-1332 using homologous recombination enzyme (Sino-US Taihe, C5891). The homologous recombination reaction system was 1.5 μL of target fragment DNA, 1-2.5 μL of linearized vector, 5 μL of 2×SeamLess Assembly MasterMix, and 10 μL of dd H2O. The reaction conditions were carried out according to the instructions. The amplification, recovery and connection operations of the target fragment involved were referred to the prior art. The specific sequences of the subcellular localization primers are as follows: F cggccgctctagaactagtggatccATGGCAGTAGTCAACAGCTC; R ggtatcgataagcttgatatcgaattcAGTCGAAGAAATAATCAAATCTACCAA; as shown in SEQ ID NO: 5 and 6.
[0083] The constructed expression vector was introduced into Agrobacterium GV3101 by electroporation and injected into tobacco leaves for transient expression. The specific method is as follows.
[0084] Add the Agrobacterium monoclonal containing P19, pSuper1300 and the target gene expression vector into 5 mL LB liquid medium (containing 50 mg / L Rif and 50 mg / L Kan) and culture in a 28°C shaker at 190 rpm until the OD 600 =0.6-1.2.
[0085] The activated bacterial solution was added to LB liquid culture medium (containing 50 mg / L Rif and 50 mg / L Kan, 10 Mm MES, 20 μm as, and the pH value of MES was adjusted to 5.7) at a ratio of 1:10 (volume ratio), and cultured in a shaker at 28°C at 220 rpm until OD600 = 1.0.
[0086] Pour the bacterial solution into a centrifuge tube, centrifuge at 7000 rpm for 10 min, remove the supernatant, and resuspend the bacteria in a resuspension solution (containing 10 mM MgCl2, 100 μM AMS, 10 mM MES, MES requires pH = 5.7) to a value of about OD600 of 0.8.
[0087] The resuspended solution was placed in a dark place for more than 3 hours. Before injection, the Agrobacterium containing P19 and the target gene expression vector were mixed in equal amounts and injected into the back of leaves of Nicotiana benthamiana seedlings of 5-6 weeks old using a syringe.
[0088] After the injection, the tobacco plants were placed at 25°C, 16h light / 8h dark conditions for 2-4 days before the fluorescence signal could be observed. 2 Tobacco leaf samples were mounted on glass slides, and the 488 nm fluorescence signal was detected using a confocal fluorescence microscope (Olympus, BX 51).
[0089] 1.1.6 Expression pattern analysis
[0090] The stems, leaves, petals in the bud stage, petals in the blooming stage and petals in the decay stage of the miniature rose mutant queen were used as materials, and the RNA extraction and quality detection methods were based on the existing technology. The expression pattern of the RhBZ1 gene in different tissues and different developmental stages of flower buds was analyzed by qRT-PCR (the method is the same as the existing technology).
[0091] 2.1 Results and Analysis
[0092] 2.1.1 Total RNA extraction from miniature rose petals
[0093] Using the sequence fragments obtained by the previously established miniature rose transcriptome sequencing, the total RNA in the miniature rose petals was obtained using OMEGA Total RNA Kit. The total RNA was subjected to 1% agarose gel electrophoresis. The brightness and width of the 28S band were twice that of the 18S band, and the 5S band was visible, indicating that the RNA degradation was low. The purity of the total RNA obtained was detected by a micro-ultraviolet spectrophotometer, and the OD260 / 280 value was 1.89, between 1.8-2.1, indicating that the RNA purity was high and there was no other contamination, and the RNA concentration was 395ng / μL. This indicates that the RNA extraction effect is good and subsequent experiments can be carried out.
[0094] 2.1.2 Cloning of the target gene RhBZ1
[0095] After reverse transcription of the obtained RNA, PCR amplification was performed using the designed specific primers, and the amplified product was observed by agarose gel electrophoresis. The obtained band position was consistent and it was inferred to be the target gene ( Figure 1 ). The target fragment was recovered, connected to the pMD19-T vector, and then transformed into E. coli. The positive clones were selected for sequencing and the sequence was finally obtained. The full-length sequence of the target gene RhBZ1 was 1736 bp, and the obtained sequence had a similarity of 80.28% with the transcriptome sequence.
[0096]
[0097]
[0098] As shown in SEQ ID NO: 1 and 2.
[0099] 2.1.3 RhBZ1 amino acid sequence alignment and phylogenetic tree construction
[0100] The gene coding region is 1407 bp long and encodes 468 amino acids ( Figure 2), the amino acid sequence of RhBZ1 was analyzed by BLAST program in NCBI, and the amino acid sequence was highly similar to Rh3GT (anthocyanidin3-O-glucosyltransferase 7-like) of ancient rose (Rosa chinensis) at 98.08%. The results of analysis using NCBI online analysis tools Conserved Domain SeaRhh Service (CD SeaRhh) and InterPro showed that RhBZ1 protein belongs to the glycosyltransferase gene family, has a GTB structure, belongs to the GT-B class protein, and has a PSPG domain. SMARTSequence analysis of the amino acid sequence found that there are two low complexity regions at 255-267 and 296-312.
[0101] In order to further study the relationship between RhBZ1 protein and other plant amino acids, DNAMAN V6 was used to align the amino acid sequences, and MEGA7 software was used to construct a phylogenetic tree of the amino acid sequences of RhBZ1 and UFGT of other plants. Figure 3 ). It can be seen that RhBZ1 and the ancient rose Rh3GT are clustered together, indicating that RhBZ1 belongs to the 3GTs family. It has a high homology with the ancient rose RhRh3GT, with a protein sequence alignment of 98.08%; it has a close genetic evolutionary relationship with the Gt3GT of Gentiana triflora, but the protein sequence alignment is only 44.28% ( Figure 4 ).
[0102] Other plants include: potato (AAZ76827.1), tobacco (BAM37964.1), morning glory (ABW79916.1), perilla (BAA19659.1, BAA36421.1), gentiana triflora (Q96493.1, BAG32251.1), rabbit eye blueberry (BAO58430.1), sweet cherry (AEO79979.1), rose (AAU12367.1, AAU09442, AAU12366), butterfly pea (3WC4), barley (CAA337 29.1), corn (AAL59228.1, ANN77508), iris (BAD83701.1, BAD06874, AB113664), freesia (ADK75021.1), Arabidopsis thaliana (QoWW21.2, NP181217, NP200217, NP197207.1), peony (AFI71902.1), petunia (BAA89008, BAA89009, CAA81057, AB027455), and scutellaria baicalensis (BAA83484).
[0103] 2.1.4 Bioinformatics analysis of the RhBZ1 gene
[0104] 2.1.4.1 Physicochemical properties of the target gene RhBZ1
[0105] According to the ExPASY Protparam (https: / / www.expasy.org / tools / protparam.html) online website, the physicochemical properties of the protein encoded by the gene were predicted and analyzed. The molecular weight of the protein was estimated to be 50649.30, the theoretical isoelectric point was 2.16, the total number of negatively charged residues was 51, and the total number of positively charged residues was 38. The atomic formula is C 2290 H 3597 N 595 O 667 S 16 It has 7165 atoms, an extinction coefficient of 49305 at 280nm, an instability coefficient of 39.70 (<40), which is speculated to be a stable protein, a fat coefficient of 99.64, and an overall average hydrophilicity of 0.144.
[0106] The amino acids encoded by RhBZ1 were analyzed, and the results are shown in Table 5. There are 20 basic amino acids in total, of which leucine has the highest number of 54, followed by alanine with 46, and serine with 43. From the perspective of classification, there are 242 non-polar amino acids in total, accounting for 51.6%.
[0107] Table 5 Amino acids encoded by RhBZ1
[0108]
[0109]
[0110] The functional domain of RhBZ1 protein was predicted by cloning the gene using NCBI website ( Figure 5 ), the results showed that the protein contained a GT1_Gtf-Like functional domain and a GlycosylTransferse_GTB_type supergene family.
[0111] 2.1.4.2 Prediction of the hydrophobicity and hydrophilicity of RhBZ1 protein
[0112] ProtScale software was used to predict the hydrophilicity / hydrophobicity of RhBZ1 protein ( Figure 6), the maximum hydrophobicity is 4.500, the minimum is -4.500, and the average is -0.600. The hydrophilicity analysis of RhBZ1 protein shows that the hydrophobic and hydrophilic regions of its gene-encoded product are arranged alternately around a straight line. The values less than zero are hydrophilic regions, and the values greater than zero are hydrophobic regions. For RhBZ1 amino acids, the hydrophilic region accounts for a large proportion. Combined with the number of amino acids appearing and the hydrophilic-hydrophobic spectrum analysis, it can be inferred that RhBZ1 protein is a hydrophilic protein.
[0113] 2.1.4.3 Analysis of RhBZ1 phosphorylation
[0114] The NetPhos2.0 Server program was used to perform phosphorylation analysis on the target gene RhBZ1 ( Figure 7 ), RhBZ1 protein has a total of 63 phosphorylation sites, of which 43 serines, 14 threonines, and 6 tyrosines may become protein kinase phosphorylation sites. It also shows that serine phosphorylation is the main phosphorylation site of this protein.
[0115] 2.1.4.4 Analysis of RhBZ1 transmembrane structure and prediction of subcellular localization
[0116] The transmembrane structure of RhBZ1 protein was predicted using TMHMM Server v.2.0. The results are as follows: Figure 8 , it can be seen that this protein has 2 transmembrane proteins and 2 transmembrane regions.
[0117] Subcellular localization of the protein using SUBA4 revealed that it was localized in membranes, vacuoles, nuclei, cytoplasm, mitochondria, and peroxisomes.
[0118] 2.1.4.5 Prediction of RhBZ1 protein structure
[0119] The secondary structure mainly refers to the periodic structure of the polypeptide chain that depends on the arrangement of hydrogen bonds. The secondary structure prediction of the RhBZ1 protein sequence using SOPMA was found ( Fig. 9 ): The secondary structure is mainly composed of α-helix (28.34%), extended chain (16.88%), β-turn (4.70%) and random coil (39.10%). The above analysis shows that random coil and α-helix are the main structural elements of the secondary structure of miniature rose RhBZ1 protein.
[0120] Swiss-Model Workspace was used to automatically build the target gene RhBZ1 protein and construct the tertiary structure of the protein. The construction results are as follows: Fig.10The tertiary structure prediction shows that the protein contains multiple α-helices, extended chains, and random coils, and has a helix-loop-helix structure.
[0121] 2.1.4.6 Bioinformatics analysis of RhBZ1 promoter
[0122] PlantCARE was used to predict the possible cis-acting regulatory elements of RhBZ1 protein online. PlantCARE analysis revealed that there were many cis-acting regulatory elements, more light-responsive elements, and various types of plant hormone and abiotic stress response cis-acting elements, including methyl jasmonate, abscisic acid, gibberellin response elements, low temperature stress response, anaerobic induction essential action elements, and MYB and MYC recognition site elements.
[0123] 2.1.5 Analysis of subcellular localization of RhBZ1
[0124] The subcellular localization of RhBZ1 was performed by transient expression in tobacco leaves mediated by Agrobacterium using an expression vector fused with RhBZ1 and GFP. The results showed that RhBZ1-GFP was localized in the cell membrane, cytoplasm and nucleus of Nicotiana benthamiana leaf cells ( Fig.11 ).
[0125] 2.1.6 Analysis of RhBZ1 expression pattern
[0126] The stems, leaves, petals at the bud stage, petals at the blooming stage, and petals at the decaying stage of miniature roses were selected for RNA extraction, and real-time fluorescence quantitative analysis was performed using action as the internal reference gene to detect the expression levels in different organs and at different stages of flower development ( Fig.12 ). Analysis of expression patterns in different organs showed that RhBZ1 was highly expressed in flowers, but was slightly expressed in stems and leaves. In different stages of flower development, it was expressed at low levels in the bud stage, reached the highest level in the blooming stage, and began to decrease in the decay stage.
[0127] Table 6 Cis-acting elements in gene promoter sequences
[0128]
[0129]
[0130] In summary, the present invention cloned the miniature rose gene RhBZ1 involved in anthocyanin glycosylation modification. Bioinformatics analysis was performed on it. The gene coding region is 1407bp long, encoding 468 amino acids, belonging to the glycosyltransferase gene family, with a GTB structure, and two low-complexity regions at 255-267 and 296-312. The protein molecular weight is 50649.30, the theoretical isoelectric point is 2.16, the total number of negatively charged residues is 51, and the total number of positively charged residues is 38. The atomic formula is C 2290 H 3597 N 595 O 667 S 16 , with 7165 atoms, an extinction coefficient of 49305 at 280nm, a fat coefficient of 99.64, and an instability coefficient of 39.70 (<40), which is a stable protein. The maximum hydrophobicity of the protein is 4.500, the minimum is -4.500, and the average is -0.600. It is a hydrophilic protein with an overall average hydrophilicity of 0.144. The protein has a total of 63 phosphorylation sites, of which 43 serines, 14 threonines, and 6 tyrosines may become protein kinase phosphorylation sites. When phosphorylation of this protein occurs, serine phosphorylation is the main one. This protein has two transmembrane proteins and two transmembrane regions. The secondary structure is mainly composed of α-helix (28.34%), extended chain (16.88%), β-turn (4.70%) and random coil (39.10%). The tertiary structure is predicted to have a helix-loop-helix structure. Subcellular localization analysis found that it is localized in the cell membrane, cytoplasm and nucleus. Expression pattern analysis shows that the expression level in flowers is significantly higher than that in stems and leaves, and only trace amounts are expressed in stems and leaves. In different stages of flower development, the expression levels are from high to low in the bud stage, flowering stage, and decay stage.
[0131] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A rose petal color regulation gene RhBZ1, characterized in that: The nucleotide sequence of the gene RhBZ1 is shown in SEQ ID NO:
1.
2. The rose petal color regulation gene RhBZ1 according to claim 1, characterized in that: The amino acid sequence encoded by the gene RhBZ1 is shown in SEQ ID NO:
2.
3. An expression vector, characterized in that: It comprises an initial vector and the RhBZ1 gene as claimed in claim 1.
4. The expression vector according to claim 3, characterized in that The initial vector is pMD19-T or pYBA-1332.
5. A host, characterized in that The host is transformed or transfected with the expression vector according to claim 3 or 4; the host is a microorganism.
6. Use of the rose petal color regulating gene RhBZ1 according to claim 1 or 2, the expression vector according to claim 3 or 4, or the host according to claim 5 in regulating the color of rose petals or in rose breeding.