A geranylgeranyl diphosphate synthase with high β-carotene yield and its application

Abstract

The present invention discloses a geranylgeranyl diphosphate synthase with high β-carotene productivity and its application. Specifically, the present invention discloses a method for producing β-carotene, the method comprising: overexpressing the CrtE gene, the CarRP gene and the CarB gene in a chassis strain; wherein, the CrtE gene is the CrtE gene from Sulfolobaceae and / or Sulfolobus acidocaldarius. The method of the present invention can effectively relieve the lycopene substrate inhibition effect and effectively improve the β-carotene yield in the chassis strain.

Description

Technical Field

[0001] The present invention relates to the field of biosynthesis, and particularly to a geranylgeranyl diphosphate synthase with high yield of β-carotene and its application. Background Art

[0002] β-carotene is a tetraterpenoid compound with biological activities such as antioxidant activity, and is widely used in the fields of food, medicine, cosmetics, etc. The heterologous synthesis chassis is mainly yeast and Escherichia coli, and yeast is a generally recognized safer expression strain compared to Escherichia coli.

[0003] The heterologous expression genes of β-carotene include geranylgeranyl diphosphate synthase (CrtE), phytoene synthase / lycopene cyclase bifunctional enzyme (CarRP / CrtYB), and phytoene dehydrogenase (CarB / CrtI). Among them, geranylgeranyl diphosphate synthase CrtE is one of the key genes for the heterologous synthesis of β-carotene. In addition, during the biosynthesis of β-carotene, lycopene cyclase has a substrate inhibition effect, and when the production of lycopene increases, it will inhibit the synthesis of the downstream product β-carotene.

[0004] Currently, the relevant biosynthesis methods include the following several. The first method is, for example, as shown in patent application CN202410102011.4, using Saccharomyces cerevisiae as the chassis strain, overexpressing the genes of CrtE, CrtI, CrtYB, tHMG1, IDI1, and ispA to obtain an engineering strain with high yield of β-carotene. In the second method, researchers found (for example, Ma Y et al., Nat Commun. 2022 Jan 31;13(1):572.) that by modifying and mutating lycopene cyclase and establishing a geranylgeranyl diphosphate synthase-mediated metabolic flux limiter, the substrate inhibition effect of lycopene can be effectively relieved to achieve the purpose of increasing the yield of β-carotene. The third method is to assemble the synthetic genes on a plasmid vector for expression. This is the mainstream method for the heterologous expression of β-carotene. For example, Wang Siyi et al. (Journal of Microbiology, 2023, 43(4): 10-17.) obtained a genetically engineered Saccharomyces cerevisiae strain producing β-carotene by constructing a constitutive expression vector pY-ES2-Kan-CrtI-CrtYB-BTS1 and transforming it into Saccharomyces cerevisiae MKP-o.

[0005] However, there are still defects in current synthesis methods that urgently need to be solved. First, although assembling β-carotene synthesis genes into plasmid vectors for expression can quickly verify whether the synthesis genes are successfully expressed, this requires the use of defective media or antibiotics to ensure that the plasmids are not lost, which not only affects the growth activity of the strains but also is not conducive to downstream fermentation and purification research. Second, the direct precursor of β-carotene synthesis in yeast is geranylgeranyl diphosphate (GGPP). However, the β-carotene content is extremely low without overexpressing geranylgeranyl diphosphate synthase (CrtE). Therefore, CrtE is one of the key rate-limiting enzymes for heterologous expression of β-carotene. In existing research, the enzyme activities of CrtE from different sources vary greatly, resulting in uneven yields of downstream β-carotene synthesis. Therefore, it is crucial to select a suitable CrtE gene for heterologous expression. Moreover, during the β-carotene biosynthesis process, lycopene cyclase has a substrate inhibition effect, and when the lycopene production increases, it will inhibit the synthesis of downstream product β-carotene. Although Ma Y et al. have proposed two improvement schemes for this, namely enzyme mutation and suitable CrtE homologous enzymes, it is still necessary to further explore CrtE homologous enzymes with better activities to solve the substrate inhibition effect and further increase the β-carotene yield.

[0006] Therefore, there is an urgent need in the art to develop a method for efficiently producing β-carotene. Summary of the Invention

[0007] The object of the present invention is to provide a method for efficiently producing β-carotene. Specifically, the present invention provides a geranylgeranyl diphosphate synthase with high yield of β-carotene and its application. The present invention aims to explore a geranylgeranyl diphosphate synthase (CrtE) that can relieve the substrate inhibition effect of lycopene and has a high yield of β-carotene, and use the CRISPR-Cas9 gene editing technology to insert the CrtE, CarRP and CarB genes required for heterologous synthesis of β-carotene into the genome of Saccharomyces cerevisiae, so as to obtain an engineered strain with stable expression and high yield of β-carotene.

[0008] In one aspect, the present invention provides a method for producing β-carotene, the method comprising: overexpressing the CrtE gene, the CarRP gene and the CarB gene in a chassis strain.

[0009] In one embodiment, the CrtE gene is the CrtE gene from Sulfolobaceae and / or Sulfolobus acidocaldarius; more preferably, the CrtE gene is from Sulfolobaceae.

[0010] In one embodiment, the CrtE gene sequence from Sulfolobus is as shown in SEQ ID NO: 58, and / or the CrtE gene sequence from Sulfolobus acidocaldarius is as shown in SEQ ID NO: 55.

[0011] In one embodiment, the CrtE gene sequence has a sequence identity higher than 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% compared to SEQ ID NO: 55 or 58.

[0012] In one embodiment, the CarRP gene and the CarB gene are the CarRP gene and the CarB gene from Blakeslea trispora.

[0013] In one embodiment, the CarRP gene sequence is as shown in SEQ ID NO: 62, or has a sequence identity of 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more with SEQ ID NO: 62.

[0014] In one embodiment, the CarB gene sequence is as shown in SEQ ID NO: 63, or has a sequence identity of 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more with SEQ ID NO: 63.

[0015] In one embodiment, the overexpression is achieved by introducing the heterologous CrtE gene, CarRP-Bt and CarB-Bt genes into the chassis strain through a gene editing method.

[0016] In one embodiment, the gene editing method includes gene editing using a system selected from the group consisting of the CRISPR-Cas9 system, ZFN (zinc finger nuclease), and TALEN (transcription activator-like effector nuclease).

[0017] In one embodiment, the chassis strain is a yeast strain or an Escherichia coli strain.

[0018] In one embodiment, the chassis strain is a yeast strain; more preferably, the yeast strain is yeast strain 2369R, BY4741 or BY4742.

[0019] In one embodiment, the gene editing method is gene editing using the CRISPR-Cas9 system.

[0020] In one embodiment, in the gene editing method, the CarRP gene is inserted between the RPO21 and SCM3 genes on chromosome IV of the yeast strain 2369R, the CarB gene is inserted between the IPI3 and PBR1 genes on chromosome XIV of the yeast strain 2369R, and / or the CrtE gene is designed to be inserted between the LSB6 and GSH1 genes on chromosome X of the yeast strain 2369R.

[0021] In one embodiment, in the gene editing method, the CRISPR-Cas9 system is used to identify the genomic sequence SEQ ID NO: 59 of the yeast strain 2369R to insert the CarRP gene, identify the genomic sequence SEQ ID NO: 60 of the yeast strain 2369R to insert the CarB gene, and / or identify the genomic sequence SEQ ID NO: 61 of the yeast strain 2369R to insert the CrtE gene.

[0022] In one aspect, the present invention provides a chassis strain for producing β-carotene, in which the CrtE gene, the CarRP gene, and the CarB gene are overexpressed, and the β-carotene yield in the chassis strain is at least 5 times higher than the lycopene yield.

[0023] In one embodiment, the CrtE gene is the CrtE gene from Sulfolobus and / or Sulfolobus acidocaldarius; more preferably, the CrtE gene is from Sulfolobus.

[0024] In one embodiment, the CrtE gene sequence from Sulfolobus is as shown in SEQ ID NO: 58, and / or the CrtE gene sequence from Sulfolobus acidocaldarius is as shown in SEQ ID NO: 55.

[0025] In one embodiment, the CarRP gene and the CarB gene are the CarRP gene and the CarB gene from Blakeslea trispora.

[0026] In one embodiment, the β-carotene yield in the chassis strain is at least 10 times, at least 15 times, at least 20 times, at least 25 times, or at least 30 times higher than the lycopene yield.

[0027] In one embodiment, the chassis strain is a yeast strain or an Escherichia coli strain.

[0028] In one embodiment, the chassis strain is a yeast strain; more preferably, the yeast strain is the yeast strain 2369R, BY4741, or BY4742.

[0029] In one embodiment, the chassis strain is yeast strain 2369R, and wherein the CarRP gene is introduced between the RPO21 and SCM3 genes on chromosome IV, the CarB gene is introduced between the IPI3 and PBR1 genes on chromosome XIV, and / or the CrtE gene is introduced between the LSB6 and GSH1 genes on chromosome X.

[0030] In one aspect, the present invention provides the use of a CrtE gene in the production of β-carotene, wherein the CrtE gene is a CrtE gene from Sulfolobus and / or Sulfolobus acidocaldarius.

[0031] Based on common general knowledge in the art, the above preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0032] The reagents and raw materials used in the present invention are all commercially available.

[0033] In a specific embodiment, the present invention provides a CrtE gene with high yield of β-carotene and capable of relieving the substrate inhibition effect of lycopene, and then using the CRISPR / Cas9 gene editing technology to co-express the screened CrtE, CarRP-Bt and CarB-Bt genes to obtain a yeast engineering strain with high yield of β-carotene.

[0034] The present invention provides a novel reference solution for improving the synthesis yield of β-carotene. The specific positive and progressive effects of the present invention are as follows:

[0035] a. Effectively relieve the substrate inhibition effect of lycopene and break through the limitations of β-carotene biosynthesis: Existing studies have shown that there is a phenomenon of substrate inhibition of lycopene in β-carotene biosynthesis, which is not conducive to the improvement of β-carotene yield. The CrtE enzyme provided by the present invention can relieve the substrate inhibition effect of lycopene, thereby promoting the efficient synthesis of β-carotene. This provides a new selection scheme of CrtE enzyme for the study of heterologous expression of β-carotene or other carotenoids.

[0036] b. Provide an enzyme combination with high yield of β-carotene: The combination of the screened CrtE gene, CarRP-Bt and CarB-Bt genes adopted by the present invention can obtain a relatively high yield of β-carotene, which not only provides a new gene combination method for yeast to synthesize β-carotene, but also further promotes the industrialization process of β-carotene biosynthesis.

[0037] c. The engineered strain obtained by the method of the present invention has stable genetic properties, which is beneficial to the large-scale fermentation of β-carotene: The present invention uses the CRISPR-Cas9 gene editing technology to insert the β-carotene synthesis gene into the yeast genome, making the genetic properties of the engineered strain stable. Its activation culture does not require the addition of a defective medium or antibiotics, which is conducive to the industrial research on the large-scale fermentation of β-carotene.

[0038] d. The GOMC-CrtE-Su and GOMC-CrtE-Sa genes are used for the heterologous expression of β-carotene for the first time: The present invention uses bioinformatics tools to mine the GOMC-CrtE-Su gene and experimentally verifies its advantages in the heterologous expression of β-carotene for the first time. Brief Description of the Drawings

[0039] Figure 1 It is a pathway diagram for the synthesis of β-carotene by Saccharomyces cerevisiae.

[0040] Figure 2 It is an evolutionary tree of CrtE genes from different sources.

[0041] Figure 3 It shows the carotenoid content of the engineered strain. Detailed Embodiments

[0042] The present invention will be further described below by way of examples, but the present invention is not limited to the scope of the described examples. The experimental methods without specific conditions in the following examples are carried out according to conventional methods and conditions, or selected according to the product instructions.

[0043] Experimental Methods

[0044] The synthesis pathway of β-carotene in the Saccharomyces cerevisiae chassis is as Figure 1 shown. The synthesis pathway uses geranylgeranyl diphosphate (GGPP) in the mevalonate (MVA) pathway of Saccharomyces cerevisiae as the direct precursor substance. Through the bifunctional enzyme phytoene synthase / lycopene cyclase (CarRP / CrtYB), phytoene is generated, and then through phytoene desaturase (CarB / CrtI), lycopene is generated, and finally β-carotene is generated by the bifunctional enzyme CarRP / CrtYB.

[0045] The present invention screens and mines geranylgeranyl diphosphate synthase that can highly produce β-carotene and has no lycopene substrate effect from the database of The Global Ocean Microbiome Catalogue (GOMC, IDMDB0000002), and simultaneously selects the CarRP gene (CarRP-Bt) and CarB gene (CarB-Bt) both from Blakeslea trispora for co-expression, thereby obtaining an engineered strain that highly produces β-carotene and has no lycopene substrate inhibition effect.

[0046] The specific experiment is achieved through the following steps:

[0047] Step 1: Mining potential CrtE homologs with high β-carotene production in the GOMC database

[0048] Based on the amino acid sequences of CrtE-Af, CrtE-Sa, and CrtE-Pa enzymes from known Archaeoglobus fulgidus, Sulfolobus acidocaldarius, and Pantoea ananatis, the present invention screens for homologous sequences and sets thresholds of similarity > 35% and coverage > 80% for structural alignment. Finally, 119 CrtE homolog sequences are screened out from the GOMC database.

[0049] Step 2: Constructing an initial chassis strain for expressing β-carotene

[0050] Download the amino acid sequences of the CarRP gene (CarRP-Bt, ID: AAO46893.1) and CarB gene (CarB-Bt, ID: AAX20903.1) of Blakeslea trispora from the NCBI website (https: / / www.ncbi.nlm.nih.gov), and then use the GenScript development tool website (https: / / www.genscript.com.cn / tools / gensmart-codon-optimization) for codon optimization to obtain gene expression sequences.

[0051] CarRP gene (SEQ ID NO: 62)

[0052]

[0053] CarB gene (SEQ ID NO: 63)

[0054]

[0055] Using the CRISPR / Cas9 gene editing technology, the CarRP-Bt and CarB-Bt genes were inserted into the genome of the synthetic chromosome yeast strain 2369R to construct an initial chassis cell for heterologous expression of β-carotene. Among them, the present invention uses the lithium acetate (LiAc)-mediated chemical transformation method for yeast gene editing, and the relevant experimental procedures are as follows:

[0056] 1. Take the cryopreserved bacterial liquid, streak it on a YPD plate, and incubate it upside down for 3 days;

[0057] 2. Transfer a single colony to 3 mL of YPD liquid medium, and shake the bacteria overnight at 30 °C and 220 rpm;

[0058] 3. Inoculate with an initial OD600 = 0.2 into 50 mL of YPD medium;

[0059] 4. Incubate at 30 °C and 220 rpm for about 4.5 h until OD = 0.8 - 1.

[0060] 5. Centrifuge the bacterial liquid at 4500 rpm for 5 min, and discard the supernatant;

[0061] 6. Add 20 mL of 1xTE solution to resuspend, and centrifuge at 4500 rpm for 5 min;

[0062] 7. Add 2 mL of Solution 1 (1.7 mL ddH2O, 200 μL of 10× lithium acetate, 100 μL of 1×TE), and incubate in a 30 °C incubator for 10 min to obtain competent cells;

[0063] 8. Take 100 μL of competent cells and mix them with 20 μL of ssDNA, add about 3 μg of donor DNA fragment, about 500 ng of gRNA, and Solution 2 (600 μL of 50% PEG4000, 75 μL of 1M lithium acetate, 75 μL of 10×TE), and vortex to mix evenly;

[0064] 9. Place it in a 30 °C incubator for 30 min, add 88 μL of DMSO, and mix evenly;

[0065] 10. Heat shock in a 42 °C water bath for 20 min, centrifuge at 13000 rpm for 1 min, and discard the supernatant;

[0066] 11. Add 1 mL of YPD liquid medium, pipette to resuspend, centrifuge at 13000 rpm for 1 min, and discard the supernatant;

[0067] 12. Add 1 mL of YPD liquid medium, pipette to resuspend, and resuscitate in a shaker at 30 °C and 220 rpm for 60 min;

[0068] 13. Centrifuge at 13,000 rpm for 1 min and discard the supernatant.

[0069] 14. Resuspend with 1 mL of 1x TE, centrifuge at 13,000 rpm for 1 min, and discard the supernatant.

[0070] 15. After adding 100 μL of 1x TE, spread the bacterial solution on an SD-URA solid plate and incubate for 3 - 4 days.

[0071] Step 3: Overexpress CrtE homologs from different sources

[0072] Six CrtE homologs were expressed, three of which were from known literature and three were from the GOMC database. The CrtE genes from known literature sources include CrtE-Af (from Archaeoglobus fulgidus), CrtE-Pa (from Pantoea ananatis), and CrtE-Sa (from Sulfolobus acidocaldarius). CrtE genes potentially highly productive for β-carotene mined from the GOMC database using bioinformatics tools include GOMC-CrtE-Ar (Archaeoglobus), GOMC-CrtE-Ps (Pseudomonas), and GOMC-CrtE-Su (Sulfolobaceae).

[0073] Step 4: Shake-flask fermentation culture of engineered strains

[0074] a. Streak the engineered strain on a YPD plate and incubate for 3 days.

[0075] b. Pick a single colony and culture it overnight at 30 °C and 220 rpm in 3 mL of YPD liquid medium.

[0076] c. Inoculate at an initial OD600 = 0.1 into 50 mL of YPD liquid medium.

[0077] d. Perform shake-flask fermentation at 30 °C and 220 rpm for 3 days to obtain the fermented bacterial solution.

[0078] Step 5: Detection of carotenoid content

[0079] 1. Bacterial cell collection: a. Take 1 mL of the bacterial solution and centrifuge at 1000 g for 10 min at 4 °C, and discard the supernatant. b. Quickly immerse the bacterial cells in liquid nitrogen for quenching for 30 s and thaw on ice. c. Wash the bacterial cells with 1 mL of 1x PBS buffer pre-cooled to 4 °C. d. Centrifuge at 1000 g for 10 min and discard the supernatant. e. Centrifuge at 12,000 rpm for 1 min, aspirate the excess liquid to obtain the bacterial cells for mass spectrometry analysis.

[0080] 2. Pretreatment of the cell sample before loading: a. Add 200 μg of 0.5 mm glass beads and 1 mL of acetone to the cells to resuspend the cells; b. Vortex for 20 min in the dark until the cells become colorless; c. Centrifuge at 13,000 rpm for 10 min and take 10 μL of the supernatant; d. After drying with nitrogen, add 100 μL of methanol for reconstitution and wait for loading and detection.

[0081] 3. Detection method and parameters of carotenoids: In this invention, LC-MS / MS is used for detection. The mass spectrometry conditions are in the positive FullScan mode, and the scanning range is 500 - 650 m / z; the chromatographic conditions are that the mobile phase is MEOH:ACN 95:5 (0.1% FA), the chromatographic column model is ACQUITY UPLC BEH C18 Column 130 Å, 1.7 µm, 2.1 mm X 100 mm, the column temperature is 35 °C, the injection volume is 5 μL, and an isocratic elution condition of 0 - 6 min and 0.5 mL / min is adopted.

[0082] The strain, plasmid, primer and gene sequence information used in the technical solution of this invention

[0083] (1)Strain, plasmid and primer information

[0084] Table 1 Information of strains used in this study

[0085]

[0086] Table 2 Information of plasmids used in this study

[0087]

[0088]

[0089] Table 3 Information of primer or gRNA sequences used in this study

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099] The CrtE-Af gene sequence is as follows (SEQ ID NO: 53):

[0100] ATGTTGAAAGAAGAAATTGCTAAAAGAGCTGAAATTATTAATAAAGCTATTGAAGAATTGTTGCCAGAGAGGGAGCCAATTGGTTTGTACAAGGCTGCTAGGCACTTGATTAAGGCTGGTGGTAAGAGGCTGAGGCCGGTTATTTCTTTGTTGGCTGTCGAAGCTTTGGGTAAGGATTATAGAAAAATTATTCCGGCGGCGGTTTCTATTGAAACTATACATAATTTCACTTTGGTTCATGATGATATAATGGATAGAGATGAAATGAGGAGGGGTGTCCCTACTGTTCACAGGGTCTACGGTGAGGCAACTGCTATTTTGGCTGGTGACACTTTGTTTGCTGAAGCTTTTAAGTTGTTGACAAAATGTGATGTTGAATCTGAAGGTATTAGAAAGGCTACAGAAATGTTATCTGATGTTTGCATTAAAATTTGTGAAGGTCAATACTATGATATGTCATTTGAGAAAAAAGAATCAGTTTCAGAAGAAGAGTATTTGAGAATGGTTGAATTGAAAACAGGTGTCTTGATTGCTGCTTCAGCTGCTTTGCCAGCTGTCTTGTTCGGTGAATCTGAAGAAATTGTCAAAGCTTTATGGGACTACGGTGTCTTGTCTGGAATTGGTTTTCAAATTCAAGATGATTTGTTAGATTTGACAGAAGAAACTGGTAAAGATTGGGGTTCTGATTTGTTGAAGGGTAAGAAAACTTTGATTGTTATAAAAGCTTTTGAAAAAGGTGTTAAATTGAAAACTTTTGGTAAAGAAAAGGCTGATGTTTCTGAAATTAGAGACGATATTGAAAAGTTGAGAGAATGCGGTGCTATTGACTACGCTGCATCTATGGCTAGGAAGATGGCTGAGGAGGCTAAGAGAAAGTTGGAAGTTTTGCCTGAATCTAAAGCTAAAGAAACATTGTTAGAATTGACAGATTTTTTAGTTACTAGAAAGAAATAA

[0101] The CrtE-Pa gene sequence is as follows (SEQ ID NO: 54):

[0102] ATGACTGTCTGTGCTAAGAAGCACGTCCATTTAACCAGAGATGCTGCTGAACAATTGTTGGCTGACATTGACAGACGTCTAGACCAATTATTACCTGTCGAAGGTGAAAGAGATGTTGTTGGTGCTGCTATGAGAGAAGGTGCTTTGGCTCCAGGTAAGAGAATCAGACCAATGTTGTTGTTACTCACTGCTCGTGATTTAGGTTGTGCCGTTTCCCACGACGGTTTATTGGACTTGGCCTGCGCTGTTGAAATGGTTCACGCCGCATCCTTGATCTTGGATGACATGCCATGTATGGACGACGCTAAGTTGAGAAGAGGCAGACCAACCATTCACTCTCACTACGGTGAACACGTTGCTATCTTGGCTGCCGTTGCTCTTTTGTCCAAGGCTTTCGGTGTCATTGCTGATGCCGATGGTCTAACTCCACTGGCCAAGAACAGAGCTGTCTCCGAATTGAGTAATGCCATCGGTATGCAAGGTTTGGTCCAAGGTCAATTCAAGGATTTGTCTGAAGGTGACAAGCCAAGATCTGCTGAAGCCATTTTGATGACCAACCACTTTAAGACCTCTACCTTGTTCTGTGCTTCCATGCAAATGGCTAGCATTGTTGCTAACGCTTCTTCCGAAGCTAGAGACTGTTTGCACAGATTCTCTTTGGATTTGGGTCAAGCTTTCCAATTGCTAGATGATTTGACTGATGGTATGACTGACACTGGTAAGGACTCTAACCAAGATGCTGGTAAGTCTACTTTGGTTAACTTGTTGGGTCCAAGAGCTGTTGAAGAAAGATTGAGACAACATTTGCAATTGGCTTCTGAACATTTGTCTGCCGCTTGTCAACACGGTCACGCTACCCAACACTTCATCCAAGCTTGGTTCGACAAAAAATTGGCCGCTGTCTCATAA

[0103] The CrtE-Sa gene sequence is as follows (SEQ ID NO: 55):

[0104] ATGTCATATTTCGATAATTACTTCAACGAAATCGTTAACTCCGTCAACGATATCATCAAGTCTTACATCTCCGGCGATGTTCCAAAGTTGTACGAAGCTTCCTACCACTTGTTTACCTCTGGTGGTAAGAGATTACGTCCATTGATCTTAACTATCTCTTCCGATTTGTTCGGTGGTCAAAGAGAAAGAGCTTATTACGCCGGTGCTGCTATTGAAGTTTTACACACTTTCACCTTGGTCCATGATGACATCATGGACCAAGATAACATCAGAAGAGGTTTGCCAACTGTTCACGTCAAGTACGGTTTGCCTTTGGCGATCTTGGCTGGTGACTTGTTGCACGCTAAGGCCTTCCAATTGTTGACTCAAGCTTTGCGTGGTTTGCCATCTGAAACCATTATAAAGGCTTTCGACATCTTCACCAGATCTATCATTATCATTTCTGAAGGTCAAGCTGTTGACATGGAGTTCGAAGACAGAATTGACATCAAAGAACAAGAATACTTGGACATGATTTCCAGAAAGACCGCTGCCTTATTTTCTGCTTCTTCTTCTATTGGTGCCTTGATTGCTGGTGCTAACGACAATGATGTCAGATTGATGTCTGATTTCGGTACCAACTTGGGTATCGCTTTCCAAATCGTCGATGACATTTTAGGTCTAACTGCTGACGAAAAGGAATTAGGTAAGCCAGTTTTCAGCGACATTCGTGAAGGTAAGAAAACTATTTTGGTTATCAAGACTTTGGAATTGTGTAAGGAAGACGAAAAGAAGATTGTCTTGAAGGCTCTCGGTAACAAGTCTGCCTCCAAGGAAGAATTGATGTCCTCTGCTGATATTATTAAGAAGTACTCCTTGGACTACGCATACAACTTGGCCGAAAAATACTACAAGAACGCTATCGATTCTTTGAACCAAGTTTCCTCTAAAAGTGACATTCCAGGTAAGGCTTTGAAGTACCTAGCCGAATTTACCATCAGAAGAAGAAAGTAA

[0105] The GOMC-CrtE-Ar gene sequence is as follows (SEQ ID NO: 56):

[0106]

[0107] The GOMC-CrtE-Ps gene sequence is as follows (SEQ ID NO: 57):

[0108] ATGCAAACTCAAAACTCTCCAGTTCCATTGCCACAATGTGATTCTCTATTAAGATTGAGAAGACAAGTTGACGAAAGATTAGCCTTGCGTTTGCCATTCCCAGAATCTGAATTGGACAAGGTTTCTTTAGCTTTGAGAGAAGGTACTTTGGCCCCAGGTAAGAGATTAAGACCATTGTTGTTATTGCTTGCCTTGTCTGACTTGGGTATTGACCCAGACATTGGTTTGGACTTGGCTTGTGCCCTAGAAATGATTCATGCTGCATCATTGTTCTTGGATGACATGCCATGTATGGACAATGCTTCCTTGAGAAGAGGTCAACCAACCATCCATTTGAGATTCGGTGAAGATGTTGCTGTTTTGGCTTCTGTCGCTTTGTTGTCCCACGCTTACGGTATCACTGCTACTGCTCCAAGACTAACTCCTCGTCAAAGAAACGATGCCGTCGCCATCTTGGCTAGATCCGTCGGTGCTCAAGGCTTGGTCAGAGGTCAATTCCGTGATTTGCACGGTGCTCAAGAAGCCCAACAATTGGACGCTGTCATTGCTACCAACCAATTGAAAACCGCTTCTTTGTTCACCGCTGCTTTGGAAGTTGCCGCTTTATTAGCTGGTGCCGAACGTACCAGAACTAGACACTTGCAAGGTTTCGCTAACCAATTGGGTTTAGCTTTCCAATTGCTGGATGATATCGCTGATGGTTTAACTCCAGAACAAACCGGTAAGAACTGCCAACAAGACAGAACCAAGGCTACAGTTGTCTCCCTCTTGGGTCAACAAGCTGCTGAACAACAATTGGCCACCCACAGAGAAGCTGCTTTGACTCACTTGGATGCTGCCGGTTTGGGTGACGGTGAATTGGCTGCTATGATGAGACAGTTGTTTGGTTAA

[0109] The GOMC-CrtE-Su gene sequence is as follows (SEQ ID NO: 58):

[0110] ATGATTGACGCTTACTTCAACGAAATTTTGAAGGATATCAACGCTACCATCGCTAACTACATCAAGGGTAACGTTAAGGAATTATACGAAGCTTCTTACTACTTATTCCAAGCTGGTGGTAAGAGATTAAGACCATTGATGTTGGTTGCTTCTTCTGATTTGGTTGGTGGTGAAAGAATCAGAGCTATTCTAGCCGGTTCTGCTGTCGAAGTTTTGCACACTTTCACATTGATTCACGATGACATCATGGACCAAGATACTTTGAGAAGAGGTATGCCAACCGTCCATGTCAAGTATGGTGTTCCAATGGCTATCTTGGCTGGTGACTTGTTGCACGCTAAGGCTTTTCAAATCTTGAACGATGCTTTGTCTGGTATGGAATCTAATTTGATCACCAAGGCTTTCAGAATTTTCACCGATGCCATTTTGGTTATCTCAGAAGGTCAAGCCTTGGACATGCAATTCGAAGACAGAAAGAGTATTTCTGAAGGTGAATACCTTGACATGATCAACAGAAAGACCGCCAAGTTGTTTTCCGCATCCACCGCTTTGGGTGCTTTGATTGGTAAGGCTTCCGATGATGTCGTTAAAAAGTTGGAAGATTTCGGTTTATTACTCGGTATCTCTTTCCAAATTGTTGACGACATTCTGGGTTTGACTGCCAACGAAGAAGAGTTAGGTAAGCCATTGTACTCCGACATTAGAGAAGGTAAAAAGACTATCTTGGTCATCAAGGCCTTAGACATGGCCAATGAAGAAGAAAAGCGTATTATCCTACAAAACTTGGGTAACAGAAACGCCTCCAAGGAAGAATTGAAGCAAACTGCTGACATCATCAAGAAGTACTCTTTGAACTACGCTTACGAATTGGCTGATAAATATTACAAGCAAGCTTTGGACAAGTTGGACTCCATTGAATGGAAGAACGAATTGGCTGGCAAAGCTTTGAAGTACATTGCTGAATTCACTGTCAAGAGACGTAAATGA

[0111] Example 1: Mining CrtE homologous enzymes with potential for high - yield β - carotene based on the GOMC database

[0112] In the present invention, the TurNuP model is used to predict the Kcat value of the enzyme for the reaction, the ESP model is used to predict the Km value of the substrate for the enzyme, and the catalytic efficiency of the CrtE enzyme is reflected by the Kcat / Km value. The higher the Kcat / Km value, the better the catalytic activity of the CrtE enzyme. Based on the amino acid sequences of the CrtE - Af, CrtE - Sa, and CrtE - Pa genes, 119 CrtE homologous enzymes were screened from the GOMC database, and 3 CrtE homologous enzymes with similar structures and the highest Kcat / Km values (GOMC - CrtE - Ar, GOMC - CrtE - Su, GOMC - CrtE - Ps) were selected for experimental verification.

[0113] The Kcat / Km values of the 6 genes in the present invention are shown in Table 4. The Kcat / Km values of the genes mined from the GOMC database are all higher than those of the CrtE - Af, CrtE - Sa, and CrtE - Pa genes reported in the literature, indicating that the genes selected in the present invention may have better catalytic activities.

[0114] Table 4 Kcat / Km values of predicted genes

[0115]

[0116] In the present invention, the Foldtree tool (https: / / github.com / DessimozLab / fold_tree) was used for protein structure clustering and visualized with the iTOL tool, as Figure 2 shown. Among them, CrtE - Pa and COMC - CrtE - Ps, CrtE - Af and GOMC - CrtE - Ar, CrtE - Sa and GOMC - CrtE - Su have similar structures.

[0117] Example 2: Construction of an initial chassis strain for expressing β - carotene

[0118] 2.1 Construction of gene expression cassettes

[0119] Construction of the CarRP - Bt gene expression vector: Using the genome of the BY4741 yeast strain as a template, the Int3L, P PGK1 , T PGK1 , Int3R target fragments were amplified by PCR, and assembled into a large fragment Int3L - P PGK1 -T PGK1 -Int3R using the Overlap PCR technique, where P PGK1 promoter and T PGK1Restriction enzyme cleavage sites KpnI and SacI were inserted between the terminators, and then the large fragment Int3L-P PGK1 -T PGK1 -Int3R was assembled onto the linear PRS426 vector digested with KpnI and SacI to construct plasmid TG-2. The codon-optimized synthetic CarRP-Bt target fragment was then assembled onto the linear TG-2 vector digested with KpnI and SacI to construct the CarRP-Bt gene expression cassette TG-2-CarRP-Bt.

[0120] Construction of the CarB-Bt gene expression vector: Using the genomic DNA of the BY4741 yeast strain as a template, the target fragments Int10L, P CYC1 、T CYC1 、Int10R were amplified by PCR. The large fragment Int10L-P CYC1 -T CYC1 -Int10R was assembled using Overlap PCR technology. Restriction enzyme cleavage sites BamHI and EcoRI were inserted between the P CYC1 promoter and the T CYC1 terminator. Then, the large fragment Int10L-P CYC1 -T CYC1 -Int10R was assembled onto the linear PRS426 vector digested with KpnI and SacI to construct plasmid TG-3. The codon-optimized synthetic CarB-Bt target fragment was then assembled onto the linear TG-3 vector digested with BamHI and EcoRI to construct the CarB-Bt gene expression cassette TG-3-CarB-Bt.

[0121] 2.2 Construction of the CRISPR-Cas9 expression cassette

[0122] The CRISPR-Cas9 gene expression cassette designed in this study was mainly constructed by inserting a 20-bp recognition site, the gRNA scaffold, and the screening resistance URA protein into pCas. The recognition site gRNA for gene insertion was designed using the CHOPCHOP online tool (https: / / chopchop.cbu.uib.no / ).

[0123] Construction of the CRISPR-Cas9 expression cassette for the CarRP-Bt gene: The CarRP-Bt gene was designed to be inserted between the RPO21 and SCM3 genes on chromosome IV of strain 2369R, namely locus Int3, and the recognition sequence was AACATTAATTGCTCTCACAG (SEQ ID NO: 59). The sequence Int3gRNA-Ura was synthesized by PCR, and then the pCas9 vector and the Int3gRNA-Ura fragment were assembled by Golden-gate cloning using BsaI restriction endonuclease to construct the pCAS-Int3 expression cassette.

[0124] Construction of the CRISPR-Cas9 expression cassette for the CarB-Bt gene: The CarB-Bt gene was designed to be inserted between the IPI3 and PBR1 genes on chromosome XIV of strain 2369R, namely locus Int10, and the recognition sequence was CATGAGCAGCCACTGTATCG (SEQ ID NO: 60). The sequence Int10gRNA-Ura was synthesized by PCR, and then the pCas9 vector and the Int10gRNA-Ura fragment were assembled by Golden-gate cloning using BsaI restriction endonuclease to construct the pCAS-Int10 expression cassette.

[0125] 2.3 Genomic insertion of CarRP-Bt and CarB-Bt

[0126] Using plasmids TG-2-CarRP-Bt and TG-3-CarB-Bt as templates, the donor DNA fragments Int3L-P PGK1 -CarRP-Bt-T PGK1 -Int3R and Int10L-P CYC1 -CarB-Bt-T CYC1 -Int10R were obtained by PCR respectively.

[0127] Using 2369R as the chassis cell, the donor DNA fragments Int3L-P PGK1 -CarRP-Bt-T PGK1 -Int3R and the pCAS-Int3 plasmid were transferred in by the LiAc-mediated chemical transformation method to obtain strain 2-RP into which the CarRP-Bt gene was introduced.

[0128] Using 2-RP as the chassis cell, the donor DNA fragments Int10L-P CYC1 -CarB-Bt-T CYC1-The Int10R and pCAS-Int10 plasmids were transferred in, and the strain 2-RPB into which the CarRP-Bt and CarB-Bt genes were introduced was obtained. This strain is the initial chassis cell for heterologous synthesis of β-carotene.

[0129] Example 3: Overexpression of CrtE homologous enzymes from different sources

[0130] 3.1 Construction of CrtE gene expression cassette

[0131] Using the genome of the BY4741 yeast strain as a template, the target fragments X-4L, P TDH3 , T PGK1 , X-4R were amplified by PCR, and they were assembled into a large fragment X-4L-P TDH -T PGK1 -X-4R by Overlap PCR technology. Among them, restriction enzyme sites KpnI and SacI were inserted between the P TDH3 promoter and the T PGK1 terminator. Then, the large fragment X-4L-P TDH -T PGK1 -X-4R was assembled onto the PRS426 linear vector digested with KpnI and SacI to construct the plasmid TG-1. The target fragments of CrtE-Af, CrtE-Pa, CrtE-Sa, GOMC-CrtE-Ar, GOMC-CrtE-Ps, GOMC-CrtE-Su synthesized after codon optimization were then assembled onto the TG-1 linear vector digested with KpnI and SacI to construct the CrtE gene expression cassettes TG-1-CrtE-Af, TG-1-CrtE-Pa, TG-1-CrtE-Sa, TG-1-GOMC-CrtE-Ar, TG-1-GOMC-CrtE-Ps, TG-1-GOMC-CrtE-Su.

[0132] 3.2 Construction of CRISPR-Cas9 expression cassette

[0133] The CrtE genes of the present invention share one CRISPR-Cas9 expression cassette construction. Among them, the CrtE gene is designed to be inserted between the LSB6 and GSH1 genes on the Xth chromosome of the 2369R strain, that is, locus X-4, and the recognition sequence is CGCCATTCAAGAGCAGCAAC (SEQ ID NO: 61). The sequence X-4gRNA-Ura was synthesized by PCR, and then the pCas9 vector and the X-4gRNA-Ura fragment were assembled by Golden-gate cloning with the BsaI restriction endonuclease to construct the pCAS-X-4 expression cassette.

[0134] 3.3 Insertion of CrtE series genes into the genome

[0135] Using plasmids TG-1-CrtE-Af, TG-1-CrtE-Pa, TG-1-CrtE-Sa, TG-1-GOMC-CrtE-Ar, TG-1-GOMC-CrtE-Ps, TG-1-GOMC-CrtE-Su as templates, PCR was respectively performed to obtain the X-4L-P TDH3 -CrtE-Af-T PGK1 -X-4R, X-4L-P TDH3 -CrtE-Pa-T PGK1 -X-4R, X-4L-P TDH3 -CrtE-Sa-T PGK1 -X-4R, X-4L-P TDH3 -GOMC-CrtE-Ar-T PGK1 -X-4R, X-4L-P TDH3 -GOMC-CrtE-Ps-T PGK1 -X-4R, X-4L-P TDH3 -GOMC-CrtE-Su-T PGK1 donor DNA fragments of -X-4R.

[0136] Using 2-RPB as the chassis cell, the donor DNA fragments of the CrtE series genes and the pCAS-X-4 plasmid were respectively transferred into it by the LiAc-mediated chemical transformation method, and the chassis cells 2-E of the strains into which the CrtE-Af, CrtE-Pa, CrtE-Sa, GOMC-CrtE-Ar, GOMC-CrtE-Ps, GOMC-CrtE-Su genes were transferred were obtained Af RPB, 2-E Pa RPB, 2-E Sa RPB, 2-E Ar RPB, 2-E Ps RPB, 2-E Su RPB.

[0137] Example 4: Detection of Carotenoid Content in Engineered Strains

[0138] In the present invention, LC-MS / MS was used to detect the lycopene and β-carotene contents of the initial chassis strain 2RPB expressing β-carotene and the strains 2-E Af RPB, 2-E Pa RPB, 2-E Sa RPB, 2-E Ar RPB, 2-E Ps RPB, 2-E Su RPB into which different CrtE genes were inserted into the genome, as Figure 3as shown

[0139] It can be seen from Figure 3 that the strain 2RPB with the CarRP-Bt and CarB-Bt genes inserted into its genome can express and produce β-carotene, but the yield is low, only 21.6 ug / L / OD, and no lycopene is detected; secondly, inserting the CrtE-Pa, CrtE-Af and their structurally similar GOMC-CrtE-Ps, GOMC-CrtE-Ar genes on the 2RPB chassis all showed that the lycopene yield was significantly higher than that of β-carotene, indicating that these 4 CrtE genes would cause lycopene substrate inhibition, and the higher the lycopene content, the lower the β-carotene content; however, inserting the CrtE-Sa and GOMC-CrtE-Su genes into the genome can relieve the lycopene substrate inhibition, resulting in a sharp increase in the β-carotene content, while the β-carotene content of the strain 2-E Su RPB is significantly higher than that of 2-E Sa RPB strain, reaching 574.01 ug / L / OD, and its content is 26.57 times that of the initial strain 2RPB, which indicates that the GOMC-CrtE-Su gene discovered from the GOMC database in the present invention has great advantages in heterologous expression of β-carotene.

Claims

1. A method for producing β-carotene, characterized in that: The method comprises: overexpressing CrtE gene, CarRP gene and CarB gene in a chassis strain; Wherein, the CrtE gene sequence is shown in SEQ ID NO: 55 or 58; Furthermore, the CarRP gene sequence is shown in SEQ ID NO: 62; the CarB gene sequence is shown in SEQ ID NO: 63; And the chassis strain is a yeast strain.

2. The method according to claim 1, characterized in that The overexpression is achieved by introducing heterologous CrtE gene, CarRP and CarB gene into the chassis strain through gene editing method.

3. The method according to claim 2, characterized in that The gene editing method is to use the CRISPR-Cas9 system to perform gene editing.

4. A chassis strain for producing β-carotene, characterized in that: The CrtE gene, the CarRP gene and the CarB gene are overexpressed in the chassis strain, and the β-carotene yield in the chassis strain is at least 5 times higher than the lycopene yield; Wherein, the CrtE gene sequence is shown in SEQ ID NO: 55 or 58; Furthermore, the CarRP gene sequence is shown in SEQ ID NO: 62; the CarB gene sequence is shown in SEQ ID NO: 63; And the chassis strain is a yeast strain.

5. The chassis strain according to claim 4, characterized in that The chassis strain is yeast strain 2369R, and wherein the CarRP gene is introduced between the RPO21 and SCM3 genes of chromosome IV, the CarB gene is introduced between the IPI3 and PBR1 genes of chromosome XIV, and / or the CrtE gene is introduced between the LSB6 and GSH1 genes of chromosome X.

Images