DAP-seq sequencing library building method

Abstract

The invention relates to the technical field of high-throughput sequencing and library building, and discloses a DAP-seq sequencing and library building method, which comprises the following steps: firstly, designing specific primers which can be accurately identified and combined to a target gene sequence; then, the desired gene segments are amplified through the PCR technology, purification is conducted, and it is ensured that high-purity target DNA is obtained to serve as a gene template for in-vitro protein translation; in an in-vitro protein expression stage, a specific expression system is utilized, and a template is input to synthesize a target protein. The proteins are subsequently combined with specific DNA in the screening process of DNA fragments, and the DNA fragments are screened out through an affinity purification technology by utilizing the interaction between the proteins and the DNA. The DNA fragments are constructed into a library for computer sequencing. The operations can accurately identify, extract and utilize the target DNA fragment, and a new way is opened up for exploring the combination of the transcription factor and DNA.

Description

Technical Field

[0001] The present invention relates to the technical field of high-throughput sequencing library construction, and in particular to a DAP-seq sequencing library construction method. Background Art

[0002] Transcription factors (TFs) play a central role in the regulation of gene expression, regulating the expression of downstream genes by specifically binding to transcription factor binding sites (TFBSs) on the genome. Exploring TFBSs is of great significance for understanding the function of TFs. Chromatin immunoprecipitation sequencing (ChIP-seq) is an effective means to reveal TFBSs. However, the success of ChIP-seq depends largely on the quality of antibodies. For rare or low-expression proteins, it is difficult to prepare high-quality antibodies. In addition, for non-model organisms, the available commercial antibody resources are extremely limited. These factors limit the widespread application of ChIP-seq technology in non-model organisms or less common transcription factors.

[0003] DNA affinity purification sequencing (DAP-seq) overcomes the limitations of ChIP-seq in terms of antibody acquisition and species, allowing researchers to use specially modified transcription factor proteins to directly interact with genomic DNA fragments in vitro, and perform high-throughput sequencing of enriched DNA fragments to identify TFBS. Since its introduction, DAP-seq technology has been widely used in multiple disciplines due to its advantages of being independent of antibodies and species, and has effectively facilitated the in-depth analysis of transcriptional regulatory mechanisms.

[0004] Although DAP-seq technology provides an effective strategy in the study of TFBS, researchers still face difficulties in the actual plasmid construction stage. In the early stages of plasmid construction, it is sometimes necessary to determine the appropriate restriction endonuclease to cut the vector and exogenous DNA, and the design of appropriate modified transcription factor proteins and corresponding DNA binding sequences may be more complicated. In the process of plasmid construction, the efficiency is not as good as expected, and multiple constructions are required to succeed. In addition, the extraction, purification, and verification of plasmids are often time-consuming, and there is even the possibility of false positive clones. These situations invisibly increase the cost of researchers' experiments and time. Summary of the invention

[0005] The present invention provides a DAP-seq sequencing library construction method, which optimizes the traditional DNA affinity purification sequencing (DAP-seq) experimental process, improves the efficiency of plasmid construction, and reduces the required time and resource consumption.

[0006] The present invention provides a DAP-seq sequencing library construction method, comprising:

[0007] S1. Design gene-specific primers so that the primers can accurately recognize and bind to the target gene sequence, amplify the gene fragment by PCR and purify it to ensure that high-purity target DNA is obtained as a gene template for in vitro protein translation;

[0008] S2, in the in vitro protein expression stage, using a specific expression system, input template to synthesize the target protein;

[0009] S3, the protein binds to specific DNA during the screening process of DNA fragments, and the DNA fragments are screened out by affinity purification technology using the interaction between the protein and DNA;

[0010] S4. The DNA fragments are constructed into libraries and sequenced.

[0011] Furthermore, the step S1 specifically includes:

[0012] S11. Connect the 3xFLAG tag to the C-terminus or N-terminus of the target protein, wherein:

[0013] C-terminal: Upstream primer F includes protection base, SP6 promoter, transcription start site, Kozak sequence, translation start codon, and 17-22bp sequence at the start position of the CDS region of the target protein; downstream primer R includes the reverse complementary sequence of the translation stop codon, the reverse complementary sequence of 3xFLAG, and the reverse complementary sequence of the sequence before the CDS stop codon of the target protein;

[0014] N-terminal: Upstream primer F includes protection base, SP6 promoter, transcription start site, Kozak sequence, translation start codon, 3xFLAG sequence, and the sequence after the start codon ATG in the CDS region of the target protein; Downstream primer R includes the reverse complementary sequence of the translation stop codon and the reverse complementary sequence of the sequence before the stop codon in the CDS region of the target protein;

[0015] S12, Primer testing and comparison: After amplifying the target fragment by PCR, first-generation Sanger sequencing is used to obtain sequence information and compare and confirm;

[0016] S13, amplification and purification: The PCR product is obtained according to the primer amplification, and subjected to agarose gel electrophoresis. The PCR product is recovered and purified using a gel recovery kit.

[0017] Furthermore, the step S2 specifically includes:

[0018] The thawed 30 μl Master Mix in the in vitro protein expression kit was mixed with 5-8 μl PCR product to prepare a reaction mixture, and the system was supplemented to 50 μl with ddH2O. After pipetting and mixing, the mixture was incubated at 25°C for 2 h.

[0019] Furthermore, in step S3, DNA fragmentation and fragment screening specifically include:

[0020] S301, take 100pg~1μg sample DNA, add 5μl FEABuffer, and make up to 40μl with ddH2O, and operate on ice throughout the process; then add 10μl FEA Enzyme Mix, use a pipette to blow or shake to mix, and briefly centrifuge to collect the reaction solution to the bottom of the tube, and place it in a PCR instrument for reaction;

[0021] S302, diluting the Adapter to a suitable concentration according to the amount of DNA, and configuring the ligation reaction system according to the first preset table;

[0022] S303, using a pipette to mix, and after a short centrifugation, placing the PCR tube in a PCR instrument;

[0023] S304, add 80 μl DNAClean Beads equilibrated to room temperature to the above PCR reaction product, pipette and mix well, and let stand at room temperature for 10 minutes;

[0024] S305, open the PCR tube, place it on a magnetic rack, let it stand for 5 minutes, and discard the supernatant;

[0025] S306. Keep the PCR tube on the magnetic rack, add 200 μl of freshly prepared 80% ethanol, incubate at room temperature for 30 seconds, remove the supernatant, repeat once, open the lid and air-dry the magnetic beads for 5 minutes;

[0026] S307, take the PCR tube out of the magnetic stand, add 23 μl H2O, resuspend the magnetic beads, and let stand at room temperature for 2 min;

[0027] S308. Open the PCR tube and place it on the magnetic stand. After standing for 5 minutes, carefully pipette 21 μl of supernatant into a new PCR tube, add 2 μl of DAP F and 2 μl of DAP R to a total volume of 25 μl, place in a PCR instrument, and amplify the library:

[0028] S309, add 40 μl (0.8x) DNAClean Beads to the product, pipette and mix well, and place at room temperature for 10 min;

[0029] S310, repeat steps S305-S307;

[0030] S311. Open the PCR tube and place it on the magnetic rack. After it stands for 5 minutes, carefully pipette 21 μl of supernatant into a new PCR tube.

[0031] Furthermore, the first preset table includes components and the volume of each component, specifically: 50 μl of the product of the previous step, 325 μl of Rapid Ligation Buffer, 5 μl of Rapid DNA Ligase, 5 μl of DAP Adapter, 15 μl of ddH2O, and 100 μl of Total.

[0032] Furthermore, in step S3, protein affinity adsorption of DNA fragments specifically includes:

[0033] S3001, transfer 20 μl of antibody magnetic beads that have been equilibrated to room temperature to the EP tube, place on the magnetic rack, adhere to the wall for 1 min, and discard the supernatant after the solution is clarified;

[0034] S3002. Take the EP tube out of the magnetic rack, add 20 μl DAP buffer, resuspend the magnetic beads, wash them, place them on the magnetic rack, let them adhere to the wall for 1 min, and discard the supernatant after the solution is clarified;

[0035] S3003, add 40 μl DAP buffer, resuspend the magnetic beads, add 40 μl protein in vitro expression mixture, resuspend the magnetic beads, place on a rotating mixer, and incubate at 25°C for 1 h;

[0036] S3004, transfer the remaining 10 μl to a new EP tube and mark it as Input-protein;

[0037] S3005. After the incubation is completed, shake the tube to make the liquid and magnetic beads at the bottom of the tube, place it on a magnetic rack, adhere to the wall for 1 minute, mark the supernatant as Supernatant, and store it at -20°C.

[0038] S3006, add 85 μl DAP buffer to resuspend the magnetic beads. After the magnetic beads settle naturally, place them on a magnetic rack and let them adhere to the wall for 1 min. Discard the supernatant.

[0039] S3007, add 40 μl DAP buffer to resuspend the magnetic beads, add 30-100 ng Input DNA, add ddH2O to 80 μl, place on a rotating mixer, and incubate at 4°C overnight;

[0040] S3008. Take out the EP tube from the rotary mixer, shake it off, place it on the magnetic rack, let it adhere to the wall for 1 minute, and discard the supernatant;

[0041] S3009, take the EP tube out of the magnetic rack, add 85 μl ice-cold DAP buffer, resuspend the magnetic beads, wash them and transfer them to a new EP tube, add 17 μl magnetic beads marked as DAP-protein, and the remaining magnetic beads marked as DAP-DNA;

[0042] S3010, add 20μl 2x SDS loading buffer to the Input-protein tube in S3004, separate 20μl from the Supernatant in S3005 into a new EP tube, add 20μl 2x SDS loading buffer, place the DAP-protein tube in S3009 on a magnetic stand, let stand for 5 min, discard the supernatant, and add 25μl 1x SDS loading buffer;

[0043] S3011. Boil the above three tubes for 10 minutes and place them on a magnetic rack. After standing for 5 minutes, transfer the supernatant to three new EP tubes for Western Blot quality inspection.

[0044] S3012. Place the DAP-DNA tube on a magnetic rack and let it stand for 5 minutes. Discard the supernatant and add 200 μl Elution Buffer to resuspend the magnetic beads. Add Elution Buffer to make up the volume of the Input-DNA sample to 200 μl.

[0045] S3013. Add 5 μg RNase A to each tube and shake at 37°C for 30 min on a Thermo Mixer.

[0046] S3014, flash shake, add 200 μg Proteinase K to each tube, wrap with sealing film, and shake at 65℃ for 2h;

[0047] S3015, place the EP tube on a magnetic rack, let it stand for 5 minutes, and transfer the supernatant to a new EP tube;

[0048] S3016, add 200 μl of phenol chloroform isoamyl alcohol (pH 8.0) to each tube and shake vigorously for 30 seconds, centrifuge at room temperature and 12000 rpm for 15 minutes, and transfer 200 μl of supernatant to a new EP tube;

[0049] S3017, add 20 μl 3M NaAc (pH 5.2) and 1 μl glycogen to each tube, mix well, then add 600 μl anhydrous ethanol, mix well by vigorous inversion, and precipitate at -80°C for 1 h;

[0050] S3018. After precipitation, centrifuge at 4°C and 12,000 rpm for 15 min and discard the ethanol;

[0051] S3019, add 1 mL of ice-cold 75% ethanol, slowly invert several times to wash, centrifuge at 4°C, 12000 rpm for 5 min, discard the ethanol; repeat once;

[0052] S3020, shake off and completely remove the remaining ethanol, dry at 56°C for 3 min, add 50 μl H2O to the Input and 30 μl H2O to the DAP.

[0053] Furthermore, the step S4 specifically includes:

[0054] S41, prepare an amplification reaction mixture according to the second preset table, and add it to a 0.2 mL PCR tube;

[0055] S42, placing the sample in a PCR instrument to amplify the library;

[0056] S43, add water to 100 μl of PCR product, mix well, add 70 μl (0.7x) DNAClean Beads, mix well by pipetting, and leave at room temperature for 10 min;

[0057] S44, open the PCR tube, place it on the magnetic stand, let it stand for 5 minutes, transfer the supernatant to a new PCR tube, add 20 μl (0.2x) DNAClean Beads, mix well by pipetting, let it stand at room temperature for 10 minutes, open the cover and let it stand for another 5 minutes;

[0058] S45. Keep the PCR tube on the magnetic rack, add 200 μl of freshly prepared 80% ethanol, incubate at room temperature for 30 seconds, and remove the supernatant; repeat this step once; open the lid and air-dry the magnetic beads for 5 minutes;

[0059] S46. Take the PCR tube out of the magnetic stand, add 27 μl H2O, resuspend the magnetic beads, and let stand at room temperature for 2 min.

[0060] S47, open the PCR tube and place it on the magnetic rack. After standing for 5 minutes, pipette 25 μl of supernatant into a new PCR tube;

[0061] S48 used Qubit reagent to quantify the library and performed fragment analysis using Bioanalyzer.

[0062] Furthermore, the second preset table includes components and the volume of each component, specifically: Input or DAPDNAxμl, 2X KAPAHiFi HotStart ReadyMix 25μl, BGI F primer (10μM) 2.5μl, BGI Rx primer (10μM) 2.5μl, ddH2O to a total volume of 50μl.

[0063] The beneficial effects of the present invention are:

[0064] 1. Reduce errors in the cloning process: Traditional plasmid construction methods involve multiple steps, such as restriction enzyme digestion, ligation, transformation, etc., each of which may introduce errors or mutations. The new method reduces these steps by directly expressing PCR products, thereby reducing experimental errors caused by errors in the cloning process.

[0065] 2. Improve experimental efficiency: Since the time for plasmid construction and verification is saved, the present invention can obtain experimental data more quickly, which is particularly important for research that requires rapid results.

[0066] 3. Reduce false positive results: In traditional methods, the instability of plasmid construction may lead to the appearance of false positive clones. The present invention reduces this possibility and improves the reliability of the results through direct expression.

[0067] 4. Simplify the operating procedures: Simplified experimental procedures reduce the possibility of human operating errors, thereby improving the repeatability and consistency of the experiment.

[0068] 5. Cost-effectiveness: Since the cost of plasmid construction and verification is eliminated, the present invention is more economically efficient, enabling more researchers to perform DAP-seq experiments.

[0069] 6. Flexibility: The present invention allows for the rapid replacement of different DNA fragments for testing, which provides researchers with greater flexibility to more extensively explore different TFs and DNA binding sites. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 This is a schematic diagram of the PCR primer design principle according to an embodiment of the present invention.

[0071] Figure 2 Schematic diagram of the DNA template structure for in vitro protein expression according to one embodiment of the present invention.

[0072] Figure 3 This is a diagram of the in vitro expression protein blotting results of one embodiment of the present invention.

[0073] Figure 4 FIG. 4 is a schematic diagram of the TFBS motif analysis results according to an embodiment of the present invention.

[0074] The realization of the purpose, functional features and advantages of the present invention will be further explained in conjunction with embodiments and with reference to the accompanying drawings. DETAILED DESCRIPTION

[0075] It should be understood that the specific embodiments described herein are only used to explain the present invention, and are not used to limit the present invention.

[0076] In order to significantly improve the efficiency of DAP-seq experiments, the present invention proposes a DAP-seq experimental method that does not require cloning the target DNA fragment into a plasmid vector. This method cleverly circumvents the complexity, time-consuming and high cost of plasmid construction in the traditional DAP-seq process by directly expressing the target fragment obtained by PCR amplification in vitro.

[0077] At present, it takes 2-3 weeks to construct a plasmid, and the process involves steps such as gene connection, transformation, identification, and sequencing, which is relatively cumbersome and lengthy. In addition, the reagents and drugs used in this process cost from several hundred to several thousand yuan. There are companies specializing in plasmid construction, and the market quotation depends on the difficulty of construction. Generally, it costs several thousand to several million yuan to construct one plasmid. It only takes less than 1 week and costs only a few hundred yuan to obtain a protein translation template through PCR. Therefore, the present invention not only simplifies the experimental steps, but also greatly reduces the research cost, and provides a more efficient and economical experimental strategy for the study of transcription factor binding sites.

[0078] The present invention proposes an innovative DAP-seq method, which directly expresses the target protein in vitro in a wheat germ extract protein expression system by injecting the target fragment amplified by PCR, eliminating the plasmid construction step. Combined with bioinformatics analysis, this method can efficiently and accurately identify key gene regulatory elements.

[0079] The DAP-seq optimization scheme of the present invention includes the following steps: designing gene-specific primers, in vitro protein expression, DNA fragmentation and fragment screening, protein affinity adsorption of DNA fragments, and construction of a DNA library. Specifically:

[0080] S1. Design gene-specific primers so that the primers can accurately recognize and bind to the target gene sequence, amplify the gene fragment by PCR and purify it to ensure that high-purity target DNA is obtained as a gene template for in vitro protein translation;

[0081] Design of gene-specific primers:

[0082] S11. Connect the 3xFLAG tag to the C-terminus or N-terminus of the target protein:

[0083] C-terminal: The upstream primer F mainly consists of the protective base, SP6 promoter, transcription start site, Kozak sequence, translation start codon, and the 17-22bp sequence at the start position of the CDS region of the target protein; the downstream primer R mainly consists of the reverse complementary sequence of the translation stop codon, the reverse complementary sequence of 3xFLAG, and the reverse complementary sequence (21-26bp) of the sequence before (excluding) the CDS stop codon of the target protein, such as Figure 1 shown.

[0084] N-terminus: The upstream primer F is mainly composed of the protective base, SP6 promoter, transcription start site, Kozak sequence, translation start codon, 3xFLAG sequence, and the sequence after (not including) the start codon ATG in the CDS region of the target protein (21-26bp); the downstream primer R is mainly composed of the reverse complementary sequence of the translation stop codon and the reverse complementary sequence of the sequence before (not including) the stop codon in the CDS region of the target protein (18-23bp).

[0085] S12. Primer testing and comparison:

[0086] After amplifying the target fragment by PCR, the sequence information was obtained by first-generation Sanger sequencing and confirmed by software comparison.

[0087] S13, amplification and purification:

[0088] The PCR product was obtained by primer amplification, subjected to agarose gel electrophoresis, and purified using a gel recovery kit.

[0089] S2, in the in vitro protein expression stage, using a specific expression system, input template to synthesize the target protein;

[0090] In vitro protein expression:

[0091] After thawing, 30 μl SP6 High-Yield Wheat Germ Master Mix or the Master Mix in the in vitro protein expression kit was added to 5-8 μl of PCR product to prepare the reaction mixture, and the system was supplemented to 50 μl with ddH2O. After pipetting and mixing, the mixture was incubated at 25°C for 2 h.

[0092] S3, the protein binds to specific DNA during the screening process of DNA fragments, and the DNA fragments are screened out by affinity purification technology using the interaction between the protein and DNA;

[0093] DNA fragmentation and fragment screening:

[0094] S301, take 100pg~1μg sample DNA, add 5μl FEA (Fragmentation / Endrepair / dA-tailing) Buffer, and add ddH2O to 40μl, and operate on ice throughout the process. Then add 10μl FEA Enzyme Mix, use a pipette to blow or shake to mix, and briefly centrifuge to collect the reaction solution to the bottom of the tube, and place it in a PCR instrument for reaction.

[0095] S302. Dilute the Adapter to a suitable concentration according to the amount of DNA. Configure the ligation reaction system according to the following table:

[0096] Components volume Previous step product 50μl RapidLigationBuffer3 25μl RapidDNALigase 5μl DAPAdapter 5μl <![CDATA[ddH2O]]> 15μl Total 100μl

[0097] S303, using a pipette to mix, and after a short centrifugation, placing the PCR tube in a PCR instrument;

[0098] S304, add 80 μl DNAClean Beads equilibrated to room temperature to the above PCR reaction product, pipette and mix well, and let stand at room temperature for 10 minutes;

[0099] S305, open the PCR tube, place it on a magnetic rack, let it stand for 5 minutes, and discard the supernatant;

[0100] S306. Keep the PCR tube on the magnetic rack, add 200 μl of freshly prepared 80% ethanol, incubate at room temperature for 30 seconds, remove the supernatant, repeat once, open the lid and air-dry the magnetic beads for 5 minutes;

[0101] S307, take the PCR tube out of the magnetic stand, add 23 μl H2O, resuspend the magnetic beads, and let stand at room temperature for 2 min;

[0102] S308. Open the PCR tube and place it on the magnetic stand. After standing for 5 minutes, carefully pipette 21 μl of supernatant into a new PCR tube, add 2 μl of DAP F and 2 μl of DAP R to a total volume of 25 μl, place in a PCR instrument, and amplify the library:

[0103] S309, add 40 μl (0.8x) DNAClean Beads to the product, pipette and mix well, and place at room temperature for 10 min;

[0104] S310, repeat steps S305-S307;

[0105] S311. Open the PCR tube and place it on the magnetic rack. After it stands for 5 minutes, carefully pipette 21 μl of supernatant into a new PCR tube.

[0106] Protein affinity adsorption of DNA fragments:

[0107] S3001, transfer 20 μl of antibody magnetic beads that have been equilibrated to room temperature to the EP tube, place on the magnetic rack, adhere to the wall for 1 min, and discard the supernatant after the solution is clarified;

[0108] S3002. Take the EP tube out of the magnetic rack, add 20 μl DAP buffer, resuspend the magnetic beads, wash them, place them on the magnetic rack, let them adhere to the wall for 1 min, and discard the supernatant after the solution is clarified;

[0109] S3003, add 40 μl DAP buffer, resuspend the magnetic beads, add 40 μl protein in vitro expression mixture, resuspend the magnetic beads, place on a rotating mixer, and incubate at 25°C for 1 h;

[0110] S3004, transfer the remaining 10 μl to a new EP tube and mark it as Input-protein;

[0111] S3005. After the incubation is completed, shake the tube to make the liquid and magnetic beads at the bottom of the tube, place it on a magnetic rack, adhere to the wall for 1 minute, mark the supernatant as Supernatant, and store it at -20°C.

[0112] S3006, add 85 μl DAP buffer to resuspend the magnetic beads. After the magnetic beads settle naturally, place them on a magnetic rack and let them adhere to the wall for 1 min. Discard the supernatant.

[0113] S3007, add 40 μl DAP buffer to resuspend the magnetic beads, add 30-100 ng Input DNA, add ddH2O to 80 μl, place on a rotating mixer, and incubate at 4°C overnight;

[0114] S3008. Take out the EP tube from the rotary mixer, shake it off, place it on the magnetic rack, let it adhere to the wall for 1 minute, and discard the supernatant;

[0115] S3009. Take the EP tube out of the magnetic rack, add 85 μl of ice-cold DAP buffer, resuspend the magnetic beads, wash them and transfer them to a new EP tube, add 17 μl of magnetic beads marked as DAP-protein, and the remaining magnetic beads marked as DAP-DNA.

[0116] S3010, add 20μl 2x SDS loading buffer to the Input-protein tube in S3004, separate 20μl from the Supernatant in S3005 into a new EP tube, add 20μl 2x SDS loading buffer, place the DAP-protein tube in S3009 on a magnetic stand, let stand for 5 min, discard the supernatant, and add 25μl 1x SDS loading buffer;

[0117] S3011. Boil the above three tubes for 10 minutes and place them on a magnetic rack. After standing for 5 minutes, transfer the supernatant to three new EP tubes for Western Blot quality inspection.

[0118] S3012. Place the DAP-DNA tube on a magnetic rack and let it stand for 5 minutes. Discard the supernatant and add 200 μl Elution Buffer to resuspend the magnetic beads. Add Elution Buffer to make up the volume of the Input-DNA sample to 200 μl.

[0119] S3013. Add 5 μg RNase A to each tube and shake at 37°C for 30 min on a Thermo Mixer.

[0120] S3014, flash shake, add 200 μg Proteinase K to each tube, wrap with sealing film, and shake at 65℃ for 2h;

[0121] S3015, place the EP tube on a magnetic rack, let it stand for 5 minutes, and transfer the supernatant to a new EP tube;

[0122] S3016, add 200 μl of phenol chloroform isoamyl alcohol (pH 8.0) to each tube and shake vigorously for 30 seconds, centrifuge at room temperature and 12000 rpm for 15 minutes, and transfer 200 μl of supernatant to a new EP tube;

[0123] S3017, add 20 μl 3M NaAc (pH 5.2) and 1 μl glycogen to each tube, mix well, then add 600 μl anhydrous ethanol, mix well by vigorous inversion, and precipitate at -80°C for 1 h;

[0124] S3018. After precipitation, centrifuge at 4°C and 12,000 rpm for 15 min and discard the ethanol;

[0125] S3019, add 1 mL of ice-cold 75% ethanol, slowly invert several times to wash, centrifuge at 4°C, 12000 rpm for 5 min, discard the ethanol; repeat once;

[0126] S3020, shake off and completely remove the remaining ethanol, dry at 56°C for 3 min, add 50 μl H2O to the Input and 30 μl H2O to the DAP.

[0127] S4. The DNA fragments are constructed into libraries and sequenced.

[0128] Construction of DNA library:

[0129] S41. Prepare the amplification reaction mixture according to the table below and add it to a 0.2 mL PCR tube;

[0130] Components Volume (μl) InputorDAPDNA x 2XKAPAHiFiHotStartReadyMix 25 BGIF primer (10 μM) 2.5 BGIRx primer (10 μM) 2.5 <![CDATA[ddH2O]]> Make up to a total volume of 50

[0131] S42, placing the sample in a PCR instrument to amplify the library;

[0132] S43, add water to 100 μl of PCR product, mix well, add 70 μl (0.7x) DNAClean Beads, mix well by pipetting, and leave at room temperature for 10 min;

[0133] S44, open the PCR tube, place it on the magnetic stand, let it stand for 5 minutes, transfer the supernatant to a new PCR tube, add 20 μl (0.2x) DNAClean Beads, mix well by pipetting, let it stand at room temperature for 10 minutes, open the cover and let it stand for another 5 minutes;

[0134] S45. Keep the PCR tube on the magnetic rack, add 200 μl of freshly prepared 80% ethanol, incubate at room temperature for 30 seconds, and remove the supernatant; repeat this step once; open the lid and air-dry the magnetic beads for 5 minutes;

[0135] S46. Take the PCR tube out of the magnetic stand, add 27 μl H2O, resuspend the magnetic beads, and let stand at room temperature for 2 min.

[0136] S47. Place the PCR tube with the lid open on a magnetic rack. After it has stood for 5 minutes, pipette 25 μl of the supernatant into a new PCR tube.

[0137] S48. Quantify the library using Qubit reagent and perform fragment analysis using Bioanalyzer.

[0138] In general, first, specific primers are designed that can accurately identify and bind to the target gene sequence. Next, the desired gene fragment is amplified by PCR technology and purified to ensure that high-purity target DNA is obtained as a gene template for in vitro protein translation. In the in vitro protein expression stage, a specific expression system is used to input the template to synthesize the target protein. These proteins then bind to specific DNA during the screening process of DNA fragments, and the interaction between protein and DNA is used to screen out these DNA fragments through affinity purification technology. The DNA fragments are constructed into libraries and sequenced on the machine. These operations can accurately identify, extract and utilize target DNA fragments, opening up new avenues for exploring the binding of transcription factors to DNA.

[0139] Specific examples are as follows:

[0140] 1) Taking the Zm00001eb143080 transcription factor as an example, its CDS is 501 bp long, as shown below:

[0141] ATGGCACCGCGCGGGCGCGTGGAGCTGCGGCGGATCGAGGACAAGGCGAGCCGGCAGGTGCGCTTCTCCAAGCGCCGCGGGGCTGTTCAAGAAGGCCTTCGAGCTGGCCCTGCTCTGCGACG CCGAGGTCGCGCTCCTCGTCTTTTCCCCCGGCGGCAAGCTCTATGAGTACTCCTCCTCCAGCATAGAAGATACATATGACCGCTATCATCAATTTGCGGGAGCAGGAAGAAAAGTGAACGGACAT AACAACGATAACCGGGATGTAGCTGCTTCAGATTTACAGTCGAGACTTAAGGAGATCGCAACATGGTCTAAACAAAACAACGCTGAGGAGTCGGATGCCAATGAACTTGAGAAACTTGAGGAACTCCTGACAAATGCTTTGAGGAATACGAAAGCCAAAAAGATGTTGGCAAAAGAAAACAATGGTGGTGCCGGTGCAAGTACAAGCAGCCAGATGTTGCTTTACTCGGCAGAGCGTGCAACCGACAAA

[0142] Prepare the CDS region to be constructed on the 3×Flag tag, such as Figure 2 .

[0143] Design 3×Flag tag primers for this sequence: the upstream primer is (F):

[0144] TATTTAGGTGACACTATAGAACAGACCACCATGGCACCGCGCGGGCGCGT; downstream primer is (R):

[0145] TCACTTGTCATCGTCATCCTTGTAGTCGATGTCATGATCTTTAATCACCGTCATGGTCTTTGTAGTCTTTGTCGGTTGCACGCTCTG;

[0146] 2) Use the above primers to amplify the bands by PCR, and configure the PCR reaction system as follows:

[0147]

[0148] The PCR reaction program is:

[0149]

[0150]

[0151] 3) Amplification and purification:

[0152] 15 μl of the PCR stock solution obtained in 2) and all sequencing primers including the F primer and the R primer (10 μl each) were sent to the first generation Sanger sequencing to confirm the synthetic sequence:

[0153] TATTTAGGTGACACTATAGAACAGACCACCATGGCACCGCGCGGGCGCGTGGAGCTGCGGCGGATCGAGGACAAGGCGAGCCGGCAGGTGCGCTTCTCCAAGCGCCGCGGGGCTGTTCAAGAAGGCCTTCGAGCTGGCCCTGCTCTG CGACGCCGAGGTCGCGCTCCTCGTCTTTTCCCCCGGCGGCAAGCTCTATGAGTACTCCTCCTCAGCATAGAAGATACATATGACCGCTATCATCAATTTGCGGGAGCAGGAAGAAAAGTGAACGGACATAACAACGATAACCGGGATG TAGCTGCTTCAGATTTACAGTCGAGACTTAAGGAGATCGCAACATGGTCTAAACAAAACAACGCTGAGGAGTCGGATGCCAATGAACTTGAGAAACTTGAGGAACTCCTGACAAATGCTTTGAGGAATACGAAAGCCAAAAAGATGTTG GCAAAAGAAAACAATGGTGGTGCCGGTGCAAGTACAAGCAGCCAGATGTTGCTTTACTCGGCAGAGCGTGCAACCGACAAAGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAGTGA

[0154] 3) Purify the PCR product according to the kit instructions: prepare 50μl PCR amplification system and place it in the PCR instrument for agarose gel electrophoresis. Use the Tiangen TIANgel Purification Kit DNA Recovery Kit (Enhanced) to excise the gel to recover and purify the PCR product, and add anhydrous ethanol to the rinse solution PW in advance. Please refer to the label on the bottle for the volume to be added; cut the single target DNA band from the agarose gel (try to cut off the excess part) and put it into a clean centrifuge tube and weigh it; add 3 times the volume of sol solution PE to the gel block, and sol at room temperature 15-25℃ for 5-10 minutes. During this period, gently turn the centrifuge tube up and down to ensure that the gel block is fully dissolved; add the resulting solution to an adsorption column CA5 (absorption column CA5). Place the adsorption column in a collection tube), place at room temperature for 2 minutes, centrifuge at 12,000rpm for 30-60sec, discard the waste liquid in the collection tube, and place the adsorption column CA5 in the collection tube; add 600μl of rinsing solution PW to the adsorption column CA5, centrifuge at 12,000rpm for 30-60sec, discard the waste liquid in the collection tube, place the adsorption column CA5 in the collection tube, and repeat the washing steps once; place the adsorption column CA5 back into the collection tube, centrifuge at 12,000rpm for 2min, and try to remove the rinsing solution. Place the adsorption column CA5 at room temperature for several minutes and dry it to prevent the residual rinsing solution from affecting the next experiment; place the adsorption column CA5 in a clean centrifuge tube, add an appropriate amount of elution buffer TB to the middle of the adsorption membrane in mid-air, and place at room temperature for 2min. Centrifuge at 12,000rpm for 2min to collect the DNA solution.

[0155] The PCR product concentration was detected using NanoDrop and quantified by Qubit. The results are as follows:

[0156]

[0157] In vitro protein expression:

[0158] Take 1.5ug of Sample1-A1 PCR amplification product, express 100uL in vitro to obtain Sample1-A1-pro protein for WB quality inspection, see Figure 3 , the target band was detected at 12-25 kD, consistent with the theoretical size of 25 kD.

[0159] Construction of DAP-seq DNA library:

[0160] Take corn leaf Sample 1-A2, extract gDNA using a kit, and sonicate for 6 min at 20% power for 1S on 1S off. After sonication, take 20 ng gDNA and use the VAHTS Universal DNA Library Prep Kit for Illumina V3 kit to build a library. According to the instructions, construct three replicate libraries so that the total amount of Sample 1-A2-gDNA-Lib library is greater than 1.5 ug.

[0161] Incubate Sample1-A1-pro (30uL) and Flag magnetic beads (25uL) at room temperature for 4h, wash the beads, elute the sample, add Sample1-A2-gDNA-Lib (1.5ug), and incubate overnight; after washing, digest the protein and extract

[0162] DNA (Sample1-IP-DNA: 0.752ng / uL); Sample1-Input-DNA (Sample1-A2-gDNA-Lib): 10ng and Sample1-IP-DNA: 0.752*10(uL) were taken respectively, amplified for 5 cycles, and finally purified with 0.8× magnetic beads, and the obtained library was sequenced. The data was analyzed by bioinformatics, and the results are clearly presented in Figure 4 middle.

[0163] In this experiment, optimized experimental techniques were used, the entire experimental operation process was smooth, and the analysis system was normal.

[0164] It should be noted that, in this article, the terms "include", "comprises" or any other variations thereof are intended to cover non-exclusive inclusion, so that a process, device, article or method including a series of elements includes not only those elements, but also includes other elements not explicitly listed, or also includes elements inherent to such process, device, article or method. In the absence of further restrictions, an element defined by the sentence "includes a ..." does not exclude the presence of other identical elements in the process, device, article or method including the element.

[0165] The above description is only a preferred embodiment of the present invention, and does not limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made by using the contents of the present invention specification and drawings, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A DAP-seq sequencing library construction method, characterized in that: include: S1. Design gene-specific primers so that the primers can accurately recognize and bind to the target gene sequence, amplify the gene fragment by PCR and purify it to ensure that high-purity target DNA is obtained as a gene template for in vitro protein translation; S2, in the in vitro protein expression stage, using a specific expression system, input template to synthesize the target protein; S3, the protein binds to specific DNA during the screening process of DNA fragments, and the DNA fragments are screened out by affinity purification technology using the interaction between the protein and DNA; S4. The DNA fragments are constructed into libraries and sequenced.

2. The DAP-seq sequencing library construction method according to claim 1, characterized in that: The step S1 specifically includes: S11. Connect the 3xFLAG tag to the C-terminus or N-terminus of the target protein, wherein: C-terminal: Upstream primer F includes protection base, SP6 promoter, transcription start site, Kozak sequence, translation start codon, and 17-22bp sequence at the start position of the CDS region of the target protein; downstream primer R includes the reverse complementary sequence of the translation stop codon, the reverse complementary sequence of 3xFLAG, and the reverse complementary sequence of the sequence before the CDS stop codon of the target protein; N-terminal: Upstream primer F includes protection base, SP6 promoter, transcription start site, Kozak sequence, translation start codon, 3xFLAG sequence, and the sequence after the start codon ATG in the CDS region of the target protein; Downstream primer R includes the reverse complementary sequence of the translation stop codon and the reverse complementary sequence of the sequence before the stop codon in the CDS region of the target protein; S12, Primer testing and comparison: After amplifying the target fragment by PCR, first-generation Sanger sequencing is used to obtain sequence information and compare and confirm; S13, amplification and purification: The PCR product is obtained according to the primer amplification, and subjected to agarose gel electrophoresis. The PCR product is recovered and purified using a gel recovery kit.

3. The DAP-seq sequencing library construction method according to claim 1, characterized in that: The step S2 specifically includes: The thawed 30 μl Master Mix in the in vitro protein expression kit was mixed with 5-8 μl PCR product to prepare a reaction mixture, and the system was supplemented to 50 μl with ddH2O. After pipetting and mixing, the mixture was incubated at 25°C for 2 h.

4. The DAP-seq sequencing library construction method according to claim 3, characterized in that: In step S3, DNA fragmentation and fragment screening specifically include: S301, take 100pg~1μg sample DNA, add 5μl FEABuffer, and make up to 40μl with ddH2O, and operate on ice throughout the process; then add 10μl FEA Enzyme Mix, use a pipette to blow or shake to mix, and briefly centrifuge to collect the reaction solution to the bottom of the tube, and place it in a PCR instrument for reaction; S302, diluting the Adapter to a suitable concentration according to the amount of DNA, and configuring the ligation reaction system according to the first preset table; S303, using a pipette to mix, and after a short centrifugation, placing the PCR tube in a PCR instrument; S304, add 80 μl DNAClean Beads equilibrated to room temperature to the above PCR reaction product, pipette and mix well, and let stand at room temperature for 10 minutes; S305, open the PCR tube, place it on a magnetic rack, let it stand for 5 minutes, and discard the supernatant; S306. Keep the PCR tube on the magnetic rack, add 200 μl of freshly prepared 80% ethanol, incubate at room temperature for 30 seconds, remove the supernatant, repeat once, open the lid and air-dry the magnetic beads for 5 minutes; S307, take the PCR tube out of the magnetic stand, add 23 μl H2O, resuspend the magnetic beads, and let stand at room temperature for 2 min; S308. Open the PCR tube and place it on the magnetic stand. After standing for 5 minutes, carefully pipette 21 μl of supernatant into a new PCR tube, add 2 μl of DAP F and 2 μl of DAP R to a total volume of 25 μl, place in a PCR instrument, and amplify the library: S309, add 40 μl (0.8x) DNAClean Beads to the product, pipette and mix well, and place at room temperature for 10 min; S310, repeat steps S305-S307; S311. Open the PCR tube and place it on the magnetic rack. After it stands for 5 minutes, carefully pipette 21 μl of supernatant into a new PCR tube.

5. The DAP-seq sequencing library construction method according to claim 4, characterized in that: The first preset table includes components and the volume of each component, specifically: 50 μl of the product from the previous step, 325 μl of Rapid Ligation Buffer, 5 μl of RapidDNA Ligase, 5 μl of DAPAdapter, 15 μl of ddH2O, and 100 μl of Total.

6. The DAP-seq sequencing library construction method according to claim 4, characterized in that: In step S3, protein affinity adsorption of DNA fragments specifically includes: S3001, transfer 20 μl of antibody magnetic beads that have been equilibrated to room temperature to the EP tube, place on the magnetic rack, adhere to the wall for 1 min, and discard the supernatant after the solution is clarified; S3002. Take the EP tube out of the magnetic rack, add 20 μl DAP buffer, resuspend the magnetic beads, wash them, place them on the magnetic rack, let them adhere to the wall for 1 min, and discard the supernatant after the solution is clarified; S3003, add 40 μl DAP buffer, resuspend the magnetic beads, add 40 μl protein in vitro expression mixture, resuspend the magnetic beads, place on a rotating mixer, and incubate at 25°C for 1 h; S3004, transfer the remaining 10 μl to a new EP tube and mark it as Input-protein; S3005. After the incubation is completed, shake the tube to make the liquid and magnetic beads at the bottom of the tube, place it on a magnetic rack, adhere to the wall for 1 minute, mark the supernatant as Supernatant, and store it at -20°C. S3006, add 85 μl DAP buffer to resuspend the magnetic beads. After the magnetic beads settle naturally, place them on a magnetic rack and let them adhere to the wall for 1 min. Discard the supernatant. S3007, add 40 μl DAP buffer to resuspend the magnetic beads, add 30-100 ng Input DNA, add ddH2O to 80 μl, place on a rotating mixer, and incubate at 4°C overnight; S3008. Take out the EP tube from the rotary mixer, shake it off, place it on the magnetic rack, let it adhere to the wall for 1 minute, and discard the supernatant; S3009, take the EP tube out of the magnetic rack, add 85 μl ice-cold DAP buffer, resuspend the magnetic beads, wash them and transfer them to a new EP tube, add 17 μl magnetic beads marked as DAP-protein, and the remaining magnetic beads marked as DAP-DNA; S3010, add 20μl 2x SDS loading buffer to the Input-protein tube in S3004, separate 20μl from the Supernatant in S3005 into a new EP tube, add 20μl 2x SDS loading buffer, place the DAP-protein tube in S3009 on a magnetic stand, let stand for 5 min, discard the supernatant, and add 25μl 1x SDS loading buffer; S3011. Boil the above three tubes for 10 minutes and place them on a magnetic rack. After standing for 5 minutes, transfer the supernatant to three new EP tubes for Western Blot quality inspection. S3012. Place the DAP-DNA tube on a magnetic rack and let it stand for 5 minutes. Discard the supernatant and add 200 μl Elution Buffer to resuspend the magnetic beads. Add Elution buffer to make up the volume of the Input-DNA sample to 200 μl. S3013. Add 5 μg RNase A to each tube and shake at 37°C for 30 min on a Thermo Mixer. S3014, flash shake, add 200 μg Proteinase K to each tube, wrap with sealing film, and shake at 65℃ for 2h; S3015, place the EP tube on a magnetic rack, let it stand for 5 minutes, and transfer the supernatant to a new EP tube; S3016, add 200 μl of phenol chloroform isoamyl alcohol (pH 8.0) to each tube and shake vigorously for 30 seconds, centrifuge at room temperature and 12000 rpm for 15 minutes, and transfer 200 μl of supernatant to a new EP tube; S3017, add 20 μl 3M NaAc (pH 5.2) and 1 μl glycogen to each tube, mix well, then add 600 μl anhydrous ethanol, mix well by vigorous inversion, and precipitate at -80°C for 1 h; S3018. After precipitation, centrifuge at 4°C and 12,000 rpm for 15 min and discard the ethanol; S3019, add 1 mL of ice-cold 75% ethanol, slowly invert several times to wash, centrifuge at 4°C, 12000 rpm for 5 min, discard the ethanol; repeat once; S3020, shake off flash, completely absorb the remaining ethanol, dry at 56℃ for 3min, add 50μl H2O to dissolve the Input, and add 30μl H2O to dissolve the DAP.

7. The DAP-seq sequencing library construction method according to claim 6, characterized in that: The step S4 specifically includes: S41, prepare an amplification reaction mixture according to the second preset table, and add it to a 0.2 mL PCR tube; S42, placing the sample in a PCR instrument to amplify the library; S43, add water to 100 μl of PCR product, mix well, add 70 μl (0.7x) DNAClean Beads, mix well by pipetting, and leave at room temperature for 10 min; S44, open the PCR tube, place it on the magnetic stand, let it stand for 5 minutes, transfer the supernatant to a new PCR tube, add 20 μl (0.2x) DNAClean Beads, mix well by pipetting, let it stand at room temperature for 10 minutes, open the cover and let it stand for another 5 minutes; S45. Keep the PCR tube on the magnetic rack, add 200 μl of freshly prepared 80% ethanol, incubate at room temperature for 30 seconds, and remove the supernatant; repeat this step once; open the lid and air-dry the magnetic beads for 5 minutes; S46. Take the PCR tube out of the magnetic stand, add 27 μl H2O, resuspend the magnetic beads, and let stand at room temperature for 2 min. S47, open the PCR tube and place it on the magnetic rack. After standing for 5 minutes, pipette 25 μl of supernatant into a new PCR tube; S48 used Qubit reagent to quantify the library and performed fragment analysis using Bioanalyzer.

8. The DAP-seq sequencing library construction method according to claim 7, characterized in that: The second preset table includes components and the volume of each component, specifically: Input or DAP DNA xμl, 2X KAPA HiFi HotStart Ready Mix 25μl, BGI F primer (10μM) 2.5μl, BGI Rx primer (10μM) 2.5μl, ddH2O to make up the total volume to 50μl.

Images