Materials and methods for preparing spatial transcriptomic libraries

Abstract

The present disclosure relates generally to materials and methods for improving in situ capture of RNA from a tissue sample and improved methods for synthesizing cDNA from captured RNA.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 477,730, filed on December 29, 2022, which is incorporated herein by reference in its entirety.

[0003] Sequence disclosure incorporated by reference

[0004] The sequence listing as part of this disclosure is submitted simultaneously with the specification as a computer-readable file. The file name containing the sequence listing is "IP-2526_SeqListing.xml", which was created on December 21, 2023 and is 10,966 bytes in size. The subject matter of the sequence listing is incorporated herein by reference in its entirety. Technical Field

[0005] The present disclosure generally relates to improved methods for preparing RNA from tissue samples and preparing spatial transcriptomics libraries from the isolated RNA. Background Art

[0006] Spatial transcriptomics enables highly multiplexed, spatially localized gene expression analysis from fresh frozen and formalin-fixed paraffin-embedded (FFPE) tissue samples. However, due to the freezing process or fixation process of FFPE tissues, fragmentation, degradation, and cross-linking may alter the quality and quantity of RNA and DNA used for transcriptomic library preparation. Current spatial workflows on the market capture and transform <1% of mRNA within tissue sections. Summary of the invention

[0007] Provided herein are methods for generating higher capture and spatial library conversion from preserved tissue samples (e.g., frozen or FFPE tissue samples). In situ polyadenylation can capture fragmented FFPE RNA on oligonucleotide-dT surfaces. Also provided herein are improved methods for synthesizing cDNA from isolated mRNA transcripts to improve the overall synthesis and alignment quality of mRNA sequences and the preparation of spatial transcriptomics libraries.

[0008] The present disclosure provides a method for isolating RNA from a sample, the method comprising (a) contacting total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphate to hydroxyl, thereby producing end-repaired total RNA; (b) contacting the end-repaired total RNA with polyadenylic acid polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; (c) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides comprising a poly T sequence; and (d) eluting the polyadenylated total RNA from the substrate.

[0009] In various embodiments, the method further comprises quantifying the total RNA. In some aspects, RNA is quantified using Qubit or RT-qPCR.

[0010] Also provided is a method for preparing an RNA library from a tissue sample, the method comprising: (a) contacting total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphate to hydroxyl, thereby producing end-repaired total RNA; (b) contacting the end-repaired total RNA with polyadenylic acid polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; (c) releasing the polyadenylated total RNA from the tissue sample; (d) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides comprising a poly T sequence; and (e) producing an RNA library from the polyadenylated total RNA using an RNA library preparation kit.

[0011] In various embodiments, the releasing is performed by lysing and / or permeabilizing the tissue sample.

[0012] In various embodiments, the RNA comprises rRNA and / or mRNA.

[0013] Further contemplated is a method for preparing an mRNA transcriptome library from a tissue sample, the method comprising: (a) contacting total RNA isolated from the sample with polynucleotide kinase (PNK) to modify the 3' phosphate to a hydroxyl group, thereby producing end-repaired total RNA; (b) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; (c) releasing the polyadenylated total RNA from the tissue sample; (d) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides comprising a poly T sequence; (e) depleting ribosomal RNA from the total RNA to leave polyadenylated mRNA; (f) generating an mRNA library from the polyadenylated mRNA using an mRNA library preparation kit.

[0014] In various embodiments, the substrate is a bead, a bead array, a spotted array, a flow cell (eg, a clustered flow cell), clustered particles arrayed on the surface of a chip, a membrane, and a plate (eg, a multiwell plate).

[0015] In various embodiments, the sample is a fresh frozen tissue sample or a formalin fixed paraffin embedded (FFPE) sample.

[0016] In various embodiments, releasing comprises contacting the sample with a lysis buffer, a permeabilization buffer, and / or a reagent to dewax the FFPE sample. For example, when the sample is a FFPE sample on a glass slide, the method comprises permeabilizing and collagenase treating the sample on the glass slide before contacting the RNA with PNK. The method may also comprise decrosslinking the FFPE sample, optionally wherein the decrosslinking is performed using a TE buffer at pH 9.

[0017] In various embodiments, after polyadenylation, the polyA tail is between 3 and 50 nucleotides.

[0018] In various embodiments, generating the RNA library comprises the following steps: eluting the polyadenylated total RNA from the substrate, and generating the RNA library from the eluted polyadenylated RNA library using an RNA library preparation kit. In some embodiments, generating the RNA library comprises: i) contacting the isolated RNA with a reverse transcriptase (RT) or a DNA polymerase to generate a first cDNA strand complementary to the RNA; ii) contacting the first cDNA strand with a reverse transcriptase (RT) or a DNA polymerase to generate a second cDNA strand complementary to the first cDNA strand; iii) amplifying the second strand cDNA to form a PCR template and isolating the PCR template; and iv) generating an RNA library from the PCR template.

[0019] In various embodiments, one or more of the first clustering sequence, index sequence, and / or read 2 sequence are added during or prior to second strand synthesis.

[0020] In various embodiments, the RNA library is an mRNA library.

[0021] In various embodiments, the PCR template is further processed by labeling to produce a spatial transcriptomics library. In some embodiments, the labeling includes labeling on beads, wherein the beads include a plurality of bead-connected transposons (BLTs). In some embodiments, BLT includes i) a plurality of oligonucleotides comprising a first clustering sequence (P7), a first index sequence, and a read 1 sequencing primer (Rd1 SP), and ii) a plurality of oligonucleotides comprising a second clustering sequence (P5), a second index sequence, and a read 2 sequencing primer (Rd2 SP).

[0022] The present disclosure also provides a method for improving the capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation, the method comprising: (a) capturing mRNA transcripts from a sample on a substrate; (b) contacting the substrate with a high processivity reverse transcriptase (RT) to produce a first cDNA chain complementary to the mRNA transcript; (c) contacting the first cDNA chain with a DNA polymerase to produce a second cDNA chain complementary to the first cDNA chain; (d) amplifying the second cDNA chain to form a PCR template and separating the PCR template.

[0023] In other embodiments, a method for improving the capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation includes: (a) capturing mRNA transcripts from a sample on a substrate; (b) contacting the substrate with a high processivity reverse transcriptase (RT) to produce a first cDNA chain complementary to the mRNA transcript; (c) contacting the first cDNA chain with the high processivity reverse transcriptase (RT) or a high processivity DNA polymerase to produce a second cDNA chain complementary to the first cDNA chain; and (d) amplifying the second chain cDNA to form a PCR template and isolating the PCR template.

[0024] In yet other embodiments, a method for improving the nucleotide length of a polynucleotide used to generate an in situ transcriptome library is provided, the method comprising: (a) capturing mRNA transcripts from a sample on a substrate; (b) contacting the substrate with a high processivity reverse transcriptase (RT) to produce a first cDNA chain complementary to the mRNA transcript; (c) contacting the first cDNA chain with a high processivity reverse transcriptase (RT) or a high processivity DNA polymerase to produce a second cDNA chain complementary to the first cDNA chain; and (d) amplifying the second chain cDNA to form a PCR template and isolating the PCR template.

[0025] In various embodiments, the high processivity RT is Superscript IV, thermostable group II intron RT (TGIRT) or marathon RT. In various embodiments, the high processivity DNA polymerase is Klenowexo-, Bst 3.0 or phi29. In various embodiments, the DNA polymerase lacks 5'- > 3' and 3'- > 5' exonuclease activity.

[0026] A method for preparing an mRNA transcriptome library from a tissue sample is also provided, the method comprising: (a) contacting total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphate to hydroxyl, thereby producing end-repaired total RNA; (b) contacting the total RNA with polynucleotide kinase (PNK) to modify 3' phosphate to hydroxyl, thereby producing end-repaired total RNA; (c) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; (d) releasing the polyadenylated total RNA from the tissue sample; (e) (f) depleting ribosomal RNA from the total RNA, leaving polyadenylated mRNA; (g) contacting the polyadenylated mRNA with a high processivity reverse transcriptase (RT) to produce a first cDNA chain complementary to the mRNA transcript; (h) contacting the first cDNA chain with a high processivity reverse transcriptase (RT) or a high processivity DNA polymerase to produce a second cDNA chain complementary to the first cDNA chain, thereby producing a PCR template; (i) eluting the PCR template; and (j) producing an mRNA library from the PCR template.

[0027] In various embodiments, the sample is a fresh frozen tissue sample or a formalin fixed paraffin embedded (FFPE) sample. In various embodiments, when the sample is a FFPE sample on a slide, the method includes permeabilizing and collagenase treating the sample on the slide before contacting the RNA with PNK. Optionally, the method also includes de-crosslinking the FFPE sample, optionally, wherein the de-crosslinking is performed using a TE buffer at pH 9.

[0028] In various embodiments, generating the RNA library comprises: i) contacting the isolated RNA with a reverse transcriptase (RT) to generate a first cDNA chain complementary to the RNA; ii) contacting the first cDNA chain with a reverse transcriptase (RT) or a DNA polymerase to generate a second cDNA chain complementary to the first cDNA chain; iii) amplifying the second cDNA chain to form a PCR template and isolating the PCR template; iv) generating an RNA library from the PCR template.

[0029] In various embodiments, one or more of the first clustering sequence, index sequence, and / or read 1 or read 2 sequence are added during or prior to second strand synthesis.

[0030] In various embodiments, the RNA library is an mRNA library.

[0031] In various embodiments, the PCR template is further processed by labeling to generate a spatial transcriptomics library. In some embodiments, the labeling includes labeling on beads, wherein the beads include a plurality of bead-connected transposons (BLTs). In various embodiments, the BLT includes: i) a plurality of oligonucleotides comprising a first clustering sequence (P7), a first index sequence, and a read 1 sequencing primer (Rd1 SP); and ii) a plurality of oligonucleotides comprising a second clustering sequence (P5), a second index sequence, and a read 2 sequencing primer (Rd2 SP).

[0032] It should be understood that each feature or embodiment or combination described herein is a non-limiting, illustrative example of any aspect of the present invention, and is therefore meant to be combined with any other feature or embodiment or combination described herein. For example, where features are described using language such as "one embodiment," "various embodiments," "some embodiments," "certain embodiments," "additional embodiments," "particular exemplary embodiments," and / or "another embodiment," each of these types of embodiments is a non-limiting example of a feature that is intended to be combined with any other feature or combination of features described herein, without necessarily listing every possible combination.

[0033] These features or combinations of features are applicable to any aspect of the present invention. When examples of values ​​falling within a range are disclosed, any of these examples are considered possible endpoints of the range, any and all numerical values ​​between such endpoints are considered, and any and all combinations of upper and lower limits are considered possible. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 . Schematic diagram showing polyadenylation in formalin-fixed paraffin-embedded (FFPE) and fresh-frozen (FF) tissues.

[0035] Figure 2 . Schematic diagram of the workflow for testing polyadenylation efficiency on total extracted RNA on FFPE and fresh frozen tissues.

[0036] Figure 3 . Protocol for polyadenylation studies on extracted RNA.

[0037] Figure 4 .Percentage of RNA captured on oligo-dT beads from the polyadenylation in-tube workflow.

[0038] Figure 5 The captured RNA was run on a high-sensitivity RNA screentape.

[0039] Figure 6 . Schematic diagram of the workflow for testing the efficiency of in situ polyadenylation on FFPE and fresh frozen tissues.

[0040] Figure 7 . Detailed protocol for polyadenylation studies on FFPE and fresh frozen tissues.

[0041] Figure 8 .Probe-based RT-PCR of RNA captured from in situ polyadenylation experiments.

[0042] Fig. 9 .The captured RNA yield was quantified using the High Sensitivity RNA Qubit Kit.

[0043] Fig.10 .Schematic diagram of library preparation and sequencing library.

[0044] Fig.11 .PolyA trimming results of the sequenced library.

[0045] Fig.12 A to Fig.12 C. FF and FFPE sequencing data from the basespace RNA-seq alignment application. Fig.12 A.) Polyadenylation alters 3' biased transcript coverage. Fig.12 B.) Polyadenylation increases insert size. Fig.12 C.) Polyadenylation increases the percentage of reads aligning to FFPE coding regions.

[0046] Fig.13 Analysis of cDNA size after using SSIV in second-strand synthesis

[0047] Fig.14 cDNA length was improved when SSIV was used as the polymerase for 2nd strand synthesis.

[0048] Fig.15 . cDNA preparation using SSIV for 1st and 2nd strand synthesis. DETAILED DESCRIPTION

[0049] There are many problems in isolating mRNA from preserved tissue samples and converting mRNA to cDNA on a flat surface, including low-quality mRNA transcripts isolated from tissue samples, shorter synthetic cDNA fragments (<450 bp) in library preparation products, and a high percentage of poly A present in cDNA regions in the final sequencing products. These problems lead to a low mapping rate of exonic mRNA transcript regions in subsequent RNA-seq alignments.

[0050] To address this problem, it is assumed that improved methods for generating higher capture and spatial library conversion from FFPE tissue samples are needed. In situ polyadenylation can capture fragmented FFPE RNA on oligonucleotide-dT surfaces. Improvements in synthesizing cDNA are also needed, using reverse transcriptases (RTases) (e.g., Superscript IV) with faster processivity and thermal stability to 1) replace the recognized DNA polymerase (Klenow exo-) used in the second strand synthesis step typically performed using DNA polymerase, and optionally combined with 2) replacing the slower RTase (e.g., maxima H-) used in the first strand synthesis with high processivity RT to achieve longer cDNA lengths in a shorter workflow time frame.

[0051] definition

[0052] Unless otherwise stated, the following terms used in this Application (including the specification and claims) have the definitions given below.

[0053] As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a capture probe" includes a mixture of two or more capture probes, etc.

[0054] The term "about", particularly with respect to a given amount, is intended to include a deviation of plus or minus 5 percent.

[0055] As used herein, the terms "comprises," "comprising," and any variations thereof are intended to cover a non-exclusive inclusion such that a process, method, product defined by a method, or composition of matter that comprises, contains, or contains an element or list of elements includes not only those elements, but may include other elements not expressly listed or inherent to such process, method, product defined by a method, or composition of matter.

[0056] As used herein, the term "address," "tag," or "index," when used to refer to a nucleotide sequence, is intended to mean a unique nucleotide sequence that is distinguishable from other indexes and from other nucleotide sequences within a polynucleotide contained within a sample. A nucleotide "address," "tag," or "index" may be a random or specifically designed nucleotide sequence. An "address," "tag," or "index" may have any desired sequence length, as long as it has a length sufficient to make it a unique nucleotide sequence within multiple indexes in a population and / or within a plurality of polynucleotides being analyzed or probed. The nucleotide "address," "tag," or "index" of the present disclosure may be used, for example, to attach to a target polynucleotide to tag or mark a particular species to identify all members of the tagged species within a population. Thus, an index may be used as a barcode, wherein different members of the same molecular species may contain the same index, and wherein different species within a population of different polynucleotides may have different indexes.

[0057] The label / index / barcode sequence may be unique to a single nucleic acid species in a population, or may be shared by several different nucleic acid species in a population. For example, each nucleic acid probe in a population may include a label / index / barcode sequence that is different from all other nucleic acid probes in the population. Alternatively, each nucleic acid probe in a population may include a label / index / barcode sequence that is different from some or most other nucleic acid probes in the population. For example, each probe in a population may have a label / index / barcode that exists for several different probes in the population, even if the probes with a common label / index / barcode differ from each other at other sequence regions along their length. In a specific embodiment, one or more label / index / barcode sequences for a biological sample are not present in the genome, transcriptome, or other nucleic acid of the biological sample. For example, the label / index / barcode sequence may have a sequence identity of less than 80%, 70%, 60%, 50%, or 40% with a nucleic acid sequence in a specific biological sample.

[0058] As used herein, "spatial address," "spatial tag," "spatial barcode," "spatial barcode sequence," or "spatial index," when used in reference to a nucleotide sequence, means an address, tag, barcode, or index that encodes spatial information associated with the region or location of origin of an addressed, tagged, barcoded, or indexed nucleic acid in a tissue sample. The sequence may be a naturally occurring sequence or a sequence that does not naturally occur in the organism from which the barcoded nucleic acid was obtained.

[0059] As used herein, the term "substrate" is intended to represent a solid carrier or support structure. The term includes any material that can be used as a solid or semi-solid basis for forming features, such as holes for depositing biopolymers (including nucleic acids, polypeptides and / or other polymers). Non-limiting examples of substrates include bead arrays, spot arrays, clustered particles arranged on the surface of a chip, membranes, porous plates, and flow cells. For example, substrates as provided herein are modified, or can be modified to adapt to the attachment of biopolymers by a variety of methods well known to those skilled in the art. Exemplary types of substrate materials include glass, modified glass, functionalized glass, inorganic glass, microspheres (including inert and / or magnetic particles), plastics, polysaccharides, nylon, nitrocellulose, ceramics, resins, silica, silica-based materials, carbon, metals, optical fibers or fiber bundles, various polymers other than those illustrated above, and porous microtiter plates. Exemplary plastics of specific types include acrylic resins, polystyrene, copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, and Teflon TM Specific types of exemplary silica-based materials include silicon and various forms of modified silicon.

[0060] Those skilled in the art will know or understand that the composition and geometry of substrates as provided herein may vary according to the intended use and the preferred requirements of the user. Thus, although planar substrates such as slides, chips, wafers or beads may be used for microarrays, given the teachings and guidance provided herein, those skilled in the art will understand that various other substrates illustrated herein or well known in the art may also be used in the methods and / or compositions herein.

[0061] In some embodiments, the solid support comprises one or more surfaces capable of contacting a reagent, bead, or analyte. The surface may be substantially flat or planar. Alternatively, the surface may be rounded or contoured. Exemplary contours that may be included on the surface are holes (e.g., micropores or nanopores), depressions, columns, ridges, channels, etc. Exemplary materials that may be used as surfaces include: glass, such as modified or functionalized glass; plastics, such as acrylic acid, polystyrene, or copolymers of styrene and another material, polypropylene, polyethylene, polybutylene, polyurethane, or Teflon; polysaccharides or cross-linked polysaccharides, such as agarose or agarose gel; nylon; nitrocellulose; resin; silica or silica-based materials, including silicon and modified silicon, carbon fiber; metal; inorganic glass; fiber bundles, or a variety of other polymers. A single material or a mixture of several different materials may form a surface that can be used for certain examples. In some examples, the surface includes holes (e.g., micropores or nanopores). In some aspects, the surface comprises an array of pores (e.g., micropores or nanopores) on a glass, silicon, plastic, or other suitable solid support having a patterned covalently attached gel such as poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) (PAZAM, see, e.g., U.S. Patent Application Publication No. 2014 / 0079923A1, which is incorporated herein by reference). In some examples, the support structure may include one or more layers.

[0062] In some embodiments, the solid carrier includes one or more surfaces of a flow cell. As used herein, the term "flow cell" refers to a chamber including a solid surface through which one or more fluid reagents can flow. The flow cell can be an ordered flow cell or a random flow cell. Examples of flow cells and related fluid systems and detection platforms that can be easily used in the methods of the present disclosure are described in, for example, Bentley et al., Nature 456:53-59 (2008), WO04 / 018497; US 7,057,026; WO 91 / 06678; WO 07 / 123744; US 7,329,492; US 7,211,414; US 7,315,019; US 7,405,281 and US2008 / 0108082, each of which is incorporated herein by reference.

[0063] In some embodiments, the solid support includes a patterned surface. "Patterned surface" refers to the arrangement of different regions in or on the exposed layer of the solid support. For example, one or more regions in these regions can be features in which one or more amplification primers are present. Features can be separated by gap regions in which there is no amplification primer. In some embodiments, the pattern can be an xy format of a feature portion in the form of rows and columns. In some embodiments, the pattern can be a repeated arrangement of a feature portion and / or gap regions. In some embodiments, the pattern can be a random arrangement of a feature portion and / or gap regions. The exemplary patterned surfaces that can be used for the methods and compositions set forth herein are described in U.S. Serial No. 13 / 661,524 and U.S. Patent Application Publication No. 2012 / 0316086 or International Patent Publication WO 2017 / 019456, each of which is incorporated herein by reference.

[0064] As used herein, when used to refer to nucleic acids, the term "fixed" is intended to mean directly or indirectly attached to a solid support via covalent or non-covalent bonds. In certain embodiments, covalent attachment may be used, but all that is required is that the nucleic acid remains fixed or attached to a support under conditions intended to use the support (e.g., in applications requiring nucleic acid amplification and / or sequencing). The oligonucleotide to be used as a capture primer or amplification primer may be fixed so that the 3'-end can be used for enzymatic extension, and at least a portion of the sequence can hybridize with a complementary sequence.

[0065] Immobilization may occur by hybridization to a surface-attached oligonucleotide, in which case the immobilized oligonucleotide or polynucleotide may be in a 3'-5' orientation. Alternatively, immobilization may occur by means other than base pairing hybridization, such as covalent attachment as described above.

[0066] Exemplary covalent linkages include, for example, those produced using click chemistry techniques. Exemplary non-covalent linkages include, but are not limited to, non-specific interactions (e.g., hydrogen bonding, ionic bonding, van der Waals interactions, etc.) or specific interactions (e.g., affinity interactions, receptor-ligand interactions, antibody epitope interactions, avidin-biotin interactions, streptavidin-biotin interactions, lectin carbohydrate interactions, etc.). Exemplary linkages are described in U.S. Patents 6,737,236, 7,259,258, 7,375,234, and 7,427,678; and U.S. Patent Publication 2011 / 0059865A1, each of which is incorporated herein by reference.

[0067] As used herein, the term "array" refers to a group of sites that can be distinguished from each other according to relative positions. Different molecules located at different sites of the array can be distinguished from each other according to the position of the site in the array. A single site of an array may contain one or more specific types of molecules. For example, a site may contain a single target nucleic acid molecule with a specific sequence, or a site may contain several nucleic acid molecules with the same sequence (and / or its complementary sequence). The sites of an array may be different features located on the same substrate. Exemplary features include, but are not limited to, holes in a substrate, beads (or other particles) in or on a substrate, projections of a substrate, ridges on a substrate, or channels in a substrate. The sites of an array may be separate substrates each with different molecules. Different molecules attached to a separate substrate may be identified according to the position of the substrate on a surface associated with the substrate, or according to the position of the substrate in a liquid or gel. Exemplary arrays in which separate substrates are located on the surface include, but are not limited to, those arrays with beads in holes.

[0068] As used herein, the term "plurality" is intended to represent a population of two or more different members. Multiple numbers can range from small, medium, large to extremely large sizes. The size of a small multiple number can range from, for example, a few members to tens of members. A medium-sized multiple number can range from, for example, tens of members to about 100 members or hundreds of members. A large multiple number can range from, for example, about hundreds of members to about 1000 members, to thousands of members, and up to tens of thousands of members. An extremely large multiple number can range from, for example, tens of thousands of members to about hundreds of thousands, one million, several million, tens of millions, and up to or exceeding hundreds of millions of members. Therefore, a plurality of sizes measured in terms of the number of members can range from two to far more than 100 million members, as well as all sizes between and exceeding the above exemplary ranges. The features of the exemplary numbers within the microarray include 1.28 cm 2 A plurality of about 500,000 or more discrete features within a nucleic acid. Exemplary nucleic acid plurality numbers include, for example, about 1×10 5 pcs, 5×10 5 and 1×10 6 The term "polynucleotide" refers to a population of one or more different nucleic acid species. Thus, the definition of the term is intended to include all integer values ​​greater than two. The upper limit of the plurality of numbers can be set, for example, by the theoretical diversity of the oligonucleotide sequences in the nucleic acid sample.

[0069] As used herein, the term "nucleic acid" is intended to be consistent with its use in the art, and includes naturally occurring nucleic acids or functional analogs thereof. Particularly useful functional analogs can hybridize with nucleic acids in a sequence-specific manner or can be used as a template for replicating a specific nucleotide sequence. Naturally occurring nucleic acids generally have a backbone comprising a phosphodiester bond. Similar structures may have alternative backbone bonds, including any of a variety of backbone bonds known in the art. Naturally occurring nucleic acids generally have deoxyribose (e.g., present in deoxyribonucleic acid (DNA)) or ribose (e.g., present in ribonucleic acid (RNA)). Nucleic acids may include any of a variety of analogs of these sugar moieties known in the art. Nucleic acids may include natural or non-natural bases. In this regard, natural deoxyribonucleic acids may have one or more bases selected from the group consisting of adenine, thymine, cytosine or guanine, and ribonucleic acids may have one or more bases selected from the group consisting of uracil, adenine, cytosine or guanine. Useful non-natural bases that may be included in nucleic acids are known in the art. Unless otherwise expressly stated, the term "target" when used in reference to a nucleic acid is intended as a semantic identifier of the nucleic acid in the context of the methods or compositions described herein and does not necessarily limit the structure or function of the nucleic acid. Specific forms of nucleic acids can include all types of nucleic acids found in organisms, as well as synthetic nucleic acids, such as polynucleotides produced by chemical synthesis.

[0070] Specific examples of nucleic acids suitable for analysis by incorporation into a microarray produced by the methods provided herein include genomic DNA (gDNA), expressed sequence tags (ESTs), messenger RNA (cDNA) of DNA copies, messenger RNA (cRNA) of RNA copies, mitochondrial DNA or genome, RNA, messenger RNA (mRNA), ribosomal RNA (rRNA) and / or other RNA populations. Fragments and / or portions of these exemplary nucleic acids are also included within the meaning of the term as used herein.

[0071] As used herein, the term "double-stranded" when used to refer to a nucleic acid molecule means that substantially all of the nucleotides in the nucleic acid molecule are hydrogen-bonded to complementary nucleotides. A partially double-stranded nucleic acid may account for at least 10%, 25%, 50%, 60%, 70%, 80%, 90%, or 95% of the nucleotides that are hydrogen-bonded to complementary nucleotides.

[0072] As used herein, the term "single-stranded" when used in reference to a nucleic acid molecule means that substantially no nucleotides in the nucleic acid molecule are hydrogen bonded to complementary nucleotides.

[0073] As used herein, the term "capture primer" or "capture probe" is intended to mean an oligonucleotide having a nucleotide sequence that is capable of specifically annealing to a single-stranded polynucleotide sequence to be analyzed or subjected to nucleic acid interrogation under conditions encountered, for example, in a primer annealing step of an amplification or sequencing reaction. The terms "nucleic acid," "polynucleotide," and "oligonucleotide" are used interchangeably herein. Unless specifically indicated otherwise, the different terms are not intended to represent any specific differences in size, sequence, or other properties. For clarity of description, when describing a particular method or composition comprising several nucleic acid species, the terms may be used to distinguish one nucleic acid species from another nucleic acid species.

[0074] As used herein, when used to refer to capture probes or other nucleic acids, the terms "gene-specific" or "target-specific" are intended to mean a capture probe or other nucleic acid that contains a nucleotide sequence that is specific to a targeted nucleic acid (e.g., a nucleic acid from a tissue sample), i.e., a sequence of nucleotides that can selectively anneal to an identification region of the targeted nucleic acid. A gene-specific capture probe may have an oligonucleotide of a single species, or may contain two or more substances with different sequences. Therefore, a gene-specific capture probe may be two or more sequences, including 3, 4, 5, 6, 7, 8, 9 or 10 or more different sequences. A gene-specific capture probe may contain a gene-specific capture primer sequence and a universal capture probe sequence. Other sequences such as sequencing primer sequences may also be contained in a gene-specific capture primer.

[0075] As used herein, "unique molecular index," "unique molecular identifier," or "UMI," when used in reference to a capture probe or other nucleic acid, is intended to refer to a portion of a probe that can be used as a molecular barcode to uniquely label each molecule in a sample library. A UMI can be represented in a nucleic acid string as "NNNN..." to designate that portion of an oligonucleotide as a UMI. A UMI can be 6 to 20 nucleotides in length or longer. In some aspects, a UMI comprises a spatial barcode.

[0076] In contrast, when used to refer to capture probes or other nucleic acids, the term "universal" means a capture probe or nucleic acid that has a common nucleotide sequence in a variety of capture probes. The common sequence can be, for example, a sequence complementary to the same adapter sequence. Universal capture probes are suitable for probing a variety of different polynucleotides without having to distinguish between different species, while gene-specific capture primers are suitable for distinguishing between different species.

[0077] As used herein, the term "amplicon" when used to refer to nucleic acid, means a product of replicating the nucleic acid, wherein the product has a nucleotide sequence identical or complementary to at least a portion of the nucleotide sequence of the nucleic acid. Amplicon can be produced by any of a variety of amplification methods using nucleic acid or its amplicon as a template, including, for example, polymerase extension, polymerase chain reaction (PCR), rolling circle amplification (RCA), connection extension or ligase chain reaction. Amplicon can be a nucleic acid molecule with a single copy (e.g., PCR product) of a specific nucleotide sequence or multiple copies (e.g., tandem products of RCA) of the nucleotide sequence. The first amplicon of a target nucleic acid can be a complementary copy. Subsequent amplicon is a copy formed by the target nucleic acid or by the first amplicon after generating the first amplicon. Subsequent amplicon can have a sequence that is substantially complementary to the target nucleic acid or substantially identical to the target nucleic acid.

[0078] The number of template copies or amplicons that can be generated can be adjusted by appropriately modifying the amplification reaction, including, for example, changing the number of amplification cycles run, using polymerases with different processivities in the amplification reaction, and / or changing the length of time the amplification reaction is run, as well as modifying other conditions known in the art that affect amplification yield. The number of copies of the nucleic acid template can be at least 1, 10, 100, 200, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, and 10,000 copies, and can vary depending on the specific application.

[0079] "Processivity" refers to the ability of a reverse transcriptase or DNA polymerase to perform DNA synthesis on a template DNA without frequently dissociating or releasing the template strand, and can be measured by the average number of nucleotides added by the enzyme. See, e.g., Zhuang et al., Biochim Biophys Acta. 2010 May; 1804(5): 1081–1093. In some embodiments, a high processivity enzyme can process tens to hundreds of bases per second.

[0080] As used herein, when used in conjunction with polynucleotides, the term "complementary" is intended to mean a polynucleotide comprising a nucleotide sequence that can selectively anneal to an identification region of a target polynucleotide under certain conditions. As used herein, the term "substantially complementary" and grammatical equivalents are intended to mean a polynucleotide comprising a nucleotide sequence that includes an identification region that can specifically anneal to a target polynucleotide under certain conditions. Annealing refers to the nucleotide base pairing interaction of one nucleic acid with another nucleic acid, which results in the formation of a duplex, triplex or other higher ordered structures. The primary interaction is typically with nucleotide base specificity through Watson-Crick and Hoogsteen type hydrogen bonds, for example, A:T, A:U and G:C. In certain embodiments, base stacking and hydrophobic interactions may also contribute to duplex stability. Conditions for annealing polynucleotides to complementary or substantially complementary regions of target nucleic acids are well known in the art, for example, as described in Nucleic Acid Hybridization, A Practical Approach, edited by Hames and Higgins, IRL Press, Washington, DC (1985), and Wetmur and Davidson, Mol. Biol. 31:349 (1968). Annealing conditions will depend on the specific application and can be routinely determined by those skilled in the art without undue experimentation.

[0081] As used herein, the term "hybridization" refers to a process in which two single-stranded polynucleotides are non-covalently bound to form a stable double-stranded polynucleotide. The resulting double-stranded polynucleotide is a "hybrid" or "duplex". Hybridization conditions will typically include a salt concentration of less than about 1M, more typically less than about 500mM and may be less than about 200mM. Hybridization buffers include buffered saline solutions, such as 5% SSPE, or other such buffers known in the art. The hybridization temperature may be as low as 5°C, but is typically greater than 22°C, and more typically greater than about 30°C, and typically exceeds 37°C. Hybridization is typically performed under stringent conditions, i.e., conditions under which the probe will hybridize to its target subsequence but will not hybridize to other non-complementary sequences. Stringent conditions are sequence-dependent and are different in different situations, and can be routinely determined by those skilled in the art.

[0082] As used herein, the term "dNTP" refers to deoxynucleoside triphosphates. NTP refers to ribonucleotide triphosphates. Purine bases (Pu) include adenine (A), guanine (G) and their derivatives and analogs. Pyrimidine bases (Py) include cytosine (C), thymine (T), uracil (U) and their derivatives and analogs. By way of illustration and not limitation, examples of such derivatives or analogs are those modified with reporter groups, biotinylation, amine modification, radiolabeling, alkylation, etc., and also include thiophosphates, phosphites, ring atom-modified derivatives, etc. The reporter group can be a fluorescent group (such as fluorescein), a chemiluminescent group (such as luminol), a terbium chelator (such as N-(hydroxyethyl)ethylenediaminetriacetic acid that can be detected by delayed fluorescence), etc.

[0083] As used herein, the terms "link", "linked" and their grammatical equivalents are intended to mean the formation of a covalent bond or connection between the ends of two or more nucleic acids (e.g., oligonucleotides and / or polynucleotides), typically in a template-driven reaction. The nature of the bond or connection can vary widely, and the connection can be performed enzymatically or chemically. As used herein, the connection is typically performed enzymatically to form a phosphodiester bond between the 5' carbon-terminal nucleotide of one oligonucleotide and the 3' carbon of another nucleotide. Template-driven ligation reactions are described in the following references: U.S. Patents 4,883,750; 5,476,930; 5,593,826 and 5,871,921, which are incorporated herein by reference in their entirety. The term "link" also encompasses the non-enzymatic formation of phosphodiester bonds, as well as the formation of non-phosphodiester covalent bonds (such as phosphorothioate bonds, disulfide bonds, etc.) between the ends of oligonucleotides.

[0084] As used herein, the term "each," when used in reference to a collection of items, is intended to identify a single item in the collection, but does not necessarily refer to every item in the collection unless the context clearly indicates otherwise.

[0085] As used herein, when used to refer to nucleic acids, the term "extension" is intended to mean the addition of at least one nucleotide or oligonucleotide to a nucleic acid. In a specific embodiment, one or more nucleotides can be added to the 3' end of a nucleic acid, for example, by polymerase catalysis (e.g., DNA polymerase, RNA polymerase, or reverse transcriptase). Chemical or enzymatic methods can be used to add one or more nucleotides to the 3' or 5' end of a nucleic acid. One or more oligonucleotides can be added to the 3' or 5' end of a nucleic acid, for example, by chemical or enzymatic (e.g., ligase catalysis) methods. Nucleic acids can be extended in a template-guided manner, whereby the extension product is complementary to the template nucleic acid, and the template nucleic acid hybridizes with the extended nucleic acid.

[0086] Provided herein are arrays and methods for spatial detection and analysis of nucleic acids in tissue samples (e.g., mutation analysis or single nucleotide variation (SNV) detection and insertion and deletion detection). The arrays described herein may include a substrate on which a plurality of capture probes are fixed so that each capture probe occupies a different position on the array. Some or all of the capture probes in the plurality of capture probes may contain a unique position label (i.e., a spatial address or index sequence). The spatial address may describe the position of the capture probe on the array. The position of the capture probe on the array may be associated with the position in the tissue sample.

[0087] As used herein, the term "poly T" or "poly A" when used in reference to a nucleic acid sequence is intended to mean a series of two or more thiamine (T) or adenine (A) bases, respectively. Poly T or poly A may contain at least about 2, 5, 8, 10, 12, 15, 18, 20 or more T or A bases, respectively. Alternatively or in addition, poly T or poly A may contain up to about 30, 20, 18, 15, 12, 10, 8, 5 or 2 T or A bases, respectively.

[0088] As used herein, the terms "tag", "label", or "labeled" refer to the conversion of nucleic acids (e.g., DNA) into adaptor-modified templates in solution ready for cluster formation and sequencing by using transposase-mediated fragmentation and labeling. The method generally involves the modification of nucleic acids by a transposome complex comprising a transposase complexed with an adaptor comprising a transposon end sequence. Tagging results in simultaneous fragmentation of the nucleic acid and ligation of the adaptor to the 5' ends of both strands of the duplex fragments. Following a purification step to remove the transposase, additional sequences are added to the ends of the adapted fragments by PCR.

[0089] "Transposase" means an enzyme that can form a functional complex with a composition (e.g., a transposon, a transposon end, a transposon end composition) comprising a transposon end, and, for example, in an in vitro transposition reaction, catalyzes the insertion or transposition of a composition containing a transposon end into a double-stranded target nucleic acid incubated therewith. Transposases as shown herein may also include integrases from retrotransposons and retroviruses. Transposases, transpososomes, and transposome complexes are generally known to those skilled in the art, as shown in the disclosure of U.S. Patent Publication No. 2010 / 0120098, the contents of which are incorporated herein by reference in their entirety. Although many of the embodiments described herein relate to Tn5 transposases and / or highly active Tn5 transposases, it should be understood that any transposition system capable of inserting a transposon end into a 5'-tag and fragmenting a target nucleic acid for its intended purpose with sufficient efficiency can be used in the present invention. In a specific embodiment, a preferred transposition system is capable of inserting a transposon end into a 5'-tag and fragmenting a target nucleic acid in a random or nearly random manner.

[0090] As used herein, the term "transposition reaction" refers to a reaction in which one or more transposons are inserted into a target nucleic acid, for example, at random sites or nearly random sites. The essential components in a transposition reaction are a transposase and a DNA oligonucleotide that exhibits the nucleotide sequence of the transposon, including the transposon sequence transferred and its complementary sequence (non-transferred transposon end sequence) and other components required to form a functional transposition or transposome complex. The DNA oligonucleotide may also contain additional sequences (e.g., adapter or primer sequences) as needed or desired. In some embodiments, the methods provided herein are exemplified by the following: using a transposition complex formed by a hyperactive Tn5 transposase and a Tn5-type transposon end (Goryshin and Reznikoff, 1998, J. Biol. Chem., 273: 7367) or by a MuA transposase and a Mu transposon end comprising R1 and R2 terminal sequences (Mizuuchi, 1983, Cell, 35: 785; Savilahti et al., 1995, EMBO J., 14: 4893). However, any transposition system capable of inserting transposon ends into 5'-tags in a random or nearly random manner with sufficient efficiency and fragmenting target DNA for its intended purpose can be used in the present invention.Examples of transposition systems known in the art that can be used in the methods of the present invention include, but are not limited to, Staphylococcus aureus Tn552 (Colegio et al., 2001, J Bacterid., 183:2384-8; Kirby et al., 2002, Mol Microbiol, 43:173-86), TyI (Devine and Boeke, 1994, Nucleic Acids Res., 22:3765-72 and International Patent Application No. WO 95 / 23875), transposon Tn7 (Craig, 1996, Science. 271:1512; Craig, 1996, Review in: Curr Top Microbiol Immunol, 204:27-48), Tn10 and IS10 (Kleckner et al., 1996, Curr Top Microbiol Immunol, 204:49-82), Mariner transposase (Lampe et al., 1996, EMBO J., 15:5470-9), Tci (Plasterk, 1996, Curr Top Microbiol Immunol, 204:125-43), P factor (Gloor, 2004, Methods Mol Biol, 260:97-114), TnJ (Ichikawa and Ohtsubo, 1990, J Biol Chem. 265:18829-32), bacterial insertion sequences (Ohtsubo and Sekine, 1996, Curr. Top. Microbiol. Immunol. 204:1-26), retroviruses (Brown et al., 1989, Proc Natl Acad Sci USA, 86:2525-9), and yeast retrotransposons (Boeke and Corces, 1989, Annu Rev Microbiol. 43:403-34). The method for inserting the transposon end into the target sequence can be performed in vitro using any suitable transposon system, for which a suitable in vitro transposition system is available or can be developed based on knowledge in the art. Generally speaking, the in vitro transposition system suitable for the method provided herein requires at least a transposase and a transposon end of sufficient purity, sufficient concentration and sufficient in vitro transposition activity, and the transposase forms a functional complex with the transposon end, and the functional complex has a corresponding transposase capable of catalyzing the transposition reaction. Suitable transposase transposon end sequences that can be used in the present invention include, but are not limited to, wild-type, derivative or mutant transposon end sequences, which form a complex with a transposase selected from a wild-type, derivative or mutant transposase. As used herein, the term "transpososome complex" refers to a transposase that is non-covalently bound to a double-stranded nucleic acid.For example, the complex can be a transposase pre-incubated with a double-stranded transposon DNA under conditions that support the formation of non-covalent complexes. The double-stranded transposon DNA can include, but is not limited to, Tn5 DNA, a portion of Tn5 DNA, a transposon end composition, a mixture of transposon end compositions, or other double-stranded DNAs capable of interacting with a transposase (such as a hyperactive Tn5 transposase).

[0091] As used herein, the term "random" can be used to refer to the spatial arrangement or composition of positions on a surface. For example, there are at least two types of order for the arrays described herein, the first involving the spacing and relative positions of features (also referred to as "sites"), and the second involving the identity or predetermined knowledge of molecules of a specific species present in a specific feature. Therefore, the features of the array can be randomly spaced so that the nearest adjacent features have a variable spacing between each other. Alternatively, the spacing between features can be ordered, for example, forming a regular pattern, such as a rectilinear grid or a hexagonal grid. In another aspect, the features of the array can be random in terms of the identity or predetermined knowledge of the target gene (e.g., a nucleic acid of a specific sequence) occupying each feature, regardless of whether the spacing produces a random pattern or an ordered pattern. The arrays described herein can be ordered in one aspect and random in another aspect. For example, in some embodiments described herein, a surface is contacted with a nucleic acid population under such conditions: wherein the nucleic acids are attached at sites that are "randomly positioned" with respect to their relative positions but with respect to the knowledge of the sequence of the nucleic acid species present in any specific site. By "randomly distributing" nucleic acids at locations on a surface it is intended that it is not known or predetermined as to which nucleic acid will be captured at which location (whether or not the locations are arranged in an ordered pattern).

[0092] As used herein, the term "tissue sample" refers to a piece of tissue that has been obtained from a subject, optionally fixed, sliced, and mounted on a planar surface (e.g., a microscope slide). The tissue sample can be a formalin-fixed paraffin-embedded (FFPE) tissue sample or a fresh tissue sample or a frozen tissue sample, etc. The method disclosed herein can be performed before or after staining the tissue sample. For example, after hematoxylin and eosin staining, the tissue sample can be spatially analyzed according to the method provided herein. The method can include (e.g., using hematoxylin and eosin staining) analyzing the histological characteristics of the sample, and then spatially analyzing the tissue.

[0093] As used herein, the term "formalin-fixed paraffin-embedded (FFPE) tissue section" refers to a piece of tissue, e.g., a biopsy tissue, that has been obtained from a subject, fixed in formaldehyde (e.g., 3% to 5% formaldehyde in phosphate-buffered saline) or Bouin's solution, embedded in wax, cut into thin sections, and then mounted on a planar surface (e.g., a microscope slide).

[0094] As used herein, the term "subject" encompasses mammals and non-mammals. Examples of mammals include, but are not limited to, any member of the class of mammals: humans, non-human primates such as chimpanzees and other apes and monkey species, cows, horses, sheep, goats, pigs, rabbits, dogs, cats, rodents, rats, mice, guinea pigs, etc. Examples of non-mammals include, but are not limited to, birds, fish, etc. The term does not denote a particular age or sex.

[0095] In some embodiments, nucleic acids in tissue samples are transferred and captured onto an array. For example, tissue sections are placed in contact with the array, and nucleic acids are captured onto the array and tagged with spatial addresses. For example, spatially tagged DNA molecules are released from the array and analyzed by high-throughput next-generation sequencing (NGS), such as synthetic sequencing (SBS). In some embodiments, nucleic acids in tissue sections (e.g., formalin-fixed paraffin-embedded (FFPE) tissue sections) are transferred to the array and captured onto the array by hybridization with capture probes. In some embodiments, the capture probe can be a universal capture probe that hybridizes with, for example, an adapter region in a nucleic acid sequencing library or a poly-A tail of an mRNA. In some embodiments, the capture probe can be a gene-specific capture probe that hybridizes with, for example, a specifically targeted mRNA or cDNA in a sample, such as TruSeq TM Custom Amplicon (TSCA) Oligonucleotide Probes (Illumina, Inc.) The capture probe can be a plurality of capture probes, for example, a plurality of the same or different capture probes.

[0096] In some embodiments, a combined indexing (addressing) system is used to provide spatial information for analyzing nucleic acids in a tissue sample. The combined indexing system may involve the use of two or more spatial address sequences (e.g., two, three, four, five or more spatial address sequences).

[0097] In some embodiments, two spatial address sequences are incorporated into the nucleic acid during the preparation of the sequencing library. The first spatial address can be used to define a certain position in the X dimension on the capture array (i.e., capture site), and the second spatial address sequence can be used to define a position in the Y dimension on the capture array (i.e., capture site). During library sequencing, the X and Y spatial address sequences can be determined, and the sequence information can be analyzed to define a specific position on the capture array.

[0098] In some embodiments, three spatial address sequences are incorporated into the nucleic acid during the preparation of the sequencing library. The first spatial address can be used to define a certain position in the X dimension on the capture array (i.e., a capture site), the second spatial address sequence can be used to define a position in the Y dimension on the capture array (i.e., a capture site), and the third spatial address sequence can be used to define the position of a two-dimensional sample slice in a sample (e.g., a tissue biopsy) (e.g., the position of a slice of a tissue sample) to provide positional spatial information in three dimensions (Z dimension) of the sample. During library sequencing, the X, Y, and Z spatial address sequences can be determined, and the sequence information can be analyzed to define a specific position on the capture array.

[0099] In some embodiments, the time address sequence (T) is optionally incorporated into the nucleic acid during the preparation of the sequencing library. In some embodiments, the time address sequence can be combined with two or three spatial address sequences. The time address sequence can be used to determine the time-dependent changes in gene expression in a tissue sample, for example, in the context of a time course experiment. The time-dependent changes in gene expression can occur in a tissue sample, for example, in response to chemical, biological or physical stimulation (e.g., toxins, drugs or heat). The nucleic acid samples obtained from comparable tissue samples (e.g., the proximal section of a tissue sample) at different time points can be merged and sequenced in large quantities. The optional first spatial address can be used to define a certain position (i.e., capture site) in the X dimension on the capture array, the second optional spatial address sequence can be used to define the position (i.e., capture site) in the Y dimension on the capture array, and the third optional spatial address sequence can be used to define the position of the two-dimensional sample slice in the sample (e.g., tissue biopsy) (e.g., the position of the slice of the tissue sample), to provide the positional spatial information in the three-dimensional (Z dimension) of the sample. During library sequencing, the T, X, Y, and Z address sequences are determined and the sequence information is analyzed to determine the specific X, Y (and optionally Z) position on the capture array for each time point (T).

[0100] The address sequences X, Y, and optionally Z and / or T can be contiguous nucleic acid sequences, or the address sequences can be separated by one or more nucleic acids (e.g., 2 or more, 3 or more, 10 or more, 30 or more, 100 or more, 300 or more, or 1,000 or more). In some embodiments, the X, Y, and optionally Z and / or T address sequences can each individually and independently be a combined nucleic acid sequence.

[0101] In some embodiments, the length of the address sequence (e.g., X, Y, Z, or T) can each individually and independently be 100 nucleic acids or less, 90 nucleic acids or less, 80 nucleic acids or less, 70 nucleic acids or less, 60 nucleic acids or less, 50 nucleic acids or less, 40 nucleic acids or less, 30 nucleic acids or less, 20 nucleic acids or less, 15 nucleic acids or less, 10 nucleic acids or less, 8 nucleic acids or less, 6 nucleic acids or less, or 4 nucleic acids or less. The lengths of two or more address sequences in a nucleic acid can be the same or different. For example, if the length of address sequence X is 10 nucleic acids, the length of address sequence Y can be, for example, 8 nucleic acids, 10 nucleic acids, or 12 nucleic acids.

[0102] The address sequence (eg, a spatial address sequence such as X or Y) may be a partially or fully degenerate sequence.

[0103] In some embodiments, the spatially addressed capture probes on the array can be released from the array onto a tissue section for generating a spatially addressed sequencing library. In some embodiments, the capture probes comprise random primer sequences for in situ synthesis of spatially tagged cDNA from RNA in the tissue section. In some embodiments, the capture probes are TruSeq for capturing and spatially tagging genomic DNA in tissue sections. TM Custom Amplicon (TSCA) Oligonucleotide Probes (Illumina, Inc.) Spatially tagged nucleic acid molecules (eg, cDNA or genomic DNA) are recovered from tissue sections and processed in a single tube reaction to generate a spatially tagged amplicon library.

[0104] In some embodiments, magnetic nanoparticles can be used to capture nucleic acids (eg, cDNA synthesized in situ) in tissue samples to generate spatially addressed libraries.

[0105] In some embodiments, spatial detection and analysis of nucleic acids in tissue samples can be performed on a droplet actuator.

[0106] Improved methods and compositions for spatial omics applications are described herein, which retain spatial information related to the source of RNA or DNA in tissues. Examples of spatial omics applications include, but are not limited to: spatial genomics applications, spatial proteomics applications; spatial transcriptomics applications; spatial agricultural genomics applications; spatial epigenomics applications; spatial phenotypic omics applications; spatial ligandomics applications; and spatial multi-omics applications (e.g., transcriptomics and genomics applications).

[0107] Preparation of polynucleotides

[0108] The present disclosure is based in part on the recognition that it is necessary to improve the amount of RNA or DNA information that can be isolated from fresh or frozen tissue samples and FFPE tissue samples to provide information related to the genetic map of the tissue sample. The present disclosure provides a method for improving the capture of genetic information by increasing the amount and quality of RNA isolated from a tissue sample, which can be used for spatial transcriptomics analysis. As described herein, RNA is polyadenylated in situ, wherein the RNA is contacted with a polynucleotide kinase (PNK) to modify the 3' phosphate to a hydroxyl group, thereby producing an end-repaired total RNA. The end-repaired RNA is mixed with a polyadenylic acid polymerase (PAP) and adenosine nucleotides to produce a polyadenylated total RNA. The polyA RNA is captured on a substrate comprising an oligonucleotide comprising a poly T sequence. The oligonucleotide comprising a poly T sequence may also comprise a capture probe or a spatial index sequence, including but not limited to one or more of a P7 sequence, an index sequence and / or a read 2 (Rd2) sequence.

[0109] Total RNA may include ribosomal RNA (rRNA), messenger RNA (mRNA), transfer RNA (tRNA), microRNA, small nucleolar RNA (snoRNA), small nuclear RNA (snRNA). In various embodiments, the RNA is rRNA and / or mRNA.

[0110] The polyA tail can be between 3 and 50 nucleotides in length, e.g., 5 to 50 nucleotides in length, 10 to 40 nucleotides in length, 15 to 30 nucleotides in length, or 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.

[0111] In some embodiments, total RNA is released from a tissue sample after polyadenylation. Release includes lysis of the tissue or permeabilization of the tissue. In various embodiments, one or more samples that have been contacted with a solid support may be lysed to release the target nucleic acid. Lysis may be performed using known techniques, such as those employing one or more of chemical treatment, enzyme treatment, electroporation, heating, hypotonic treatment, ultrasonic treatment, etc.

[0112] In some embodiments, the tissue sample will be processed to remove the embedding material (e.g., paraffin or formalin) from the sample before releasing, capturing or modifying the nucleic acid. This can be achieved by contacting the sample with a suitable solvent (e.g., xylene and ethanol washing solution). The treatment can be carried out before the tissue sample contacts the solid carrier as described herein, or the treatment can be carried out when the tissue sample is on the solid carrier. The exemplary method for operating the tissue used together with the solid carrier attached to the nucleic acid is described in U.S. Patent Application Publication No. 2014 / 0066318, which is incorporated herein by reference.

[0113] Formalin-fixed tissue samples can also be decrosslinked using known techniques. In various embodiments, decrosslinking is performed using, for example, Tris-EDTA (TE) buffer at pH 8, pH 9, or another suitable buffer at a suitable pH. Decrosslinking can also be performed at high heat (e.g., 70° C.).

[0114] The present disclosure is also based in part on the recognition that the capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation can be improved by using a high processivity enzyme in either or both of the first strand synthesis reaction and the second strand synthesis reaction. The mRNA transcripts isolated from the tissue sample are captured on a substrate and contacted with a high processivity reverse transcriptase (RT) or a high processivity DNA polymerase to produce a first cDNA chain complementary to the mRNA transcript. High processivity RT includes Superscript IV, thermostable group II intron RT (TGIRT) or marathon RT. In various embodiments, the first cDNA chain is contacted with a DNA polymerase to produce a second cDNA chain complementary to the first cDNA chain, and optionally, the DNA polymerase is a high processivity DNA polymerase. In various embodiments, the high processivity DNA polymerase is Klenow exo-, Bst 3.0 or phi29. In various embodiments, the DNA polymerase lacks 5'->3' and 3'->5' exonuclease activity.

[0115] In some embodiments, mRNA transcripts isolated from a tissue sample are captured on a substrate and contacted with RT to produce a first cDNA strand complementary to the mRNA transcript. In various embodiments, the first cDNA strand is contacted with a high processivity RT or a high processivity DNA polymerase to produce a second cDNA strand complementary to the first cDNA strand.

[0116] In some embodiments, mRNA transcripts isolated from a tissue sample are captured on a substrate and contacted with a high processivity RT or a high processivity DNA polymerase having RT activity to produce a first cDNA strand complementary to the mRNA transcript. In various embodiments, the first cDNA strand is contacted with a high processivity RT or a high processivity DNA polymerase to produce a second cDNA strand complementary to the first cDNA strand.

[0117] In some embodiments, mRNA transcripts isolated from a tissue sample are captured on a substrate and contacted with a high processivity RT to produce a first cDNA strand complementary to the mRNA transcript. In various embodiments, the first cDNA strand is contacted with a high processivity RT or a high processivity DNA polymerase to produce a second cDNA strand complementary to the first cDNA strand.

[0118] Following second strand synthesis, the second strand cDNA is amplified to form a PCR template, and the PCR template is isolated using standard techniques.

[0119] The above methods can also be used to improve the capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation, and / or to improve the nucleotide length of polynucleotides used to generate in situ transcriptome libraries (e.g., improving the polynucleotide size of cDNA transcribed from mRNA isolated from a sample and used to generate an in situ transcriptome library).

[0120] The present disclosure is also based in part on the recognition that the in situ polyadenylation method described herein can be used in combination with a high processivity enzyme for first-strand and / or second-strand synthesis to improve spatial transcriptomics RNA library preparation. For example, the present disclosure provides a method for preparing an mRNA transcriptome library from a tissue sample, the method comprising: contacting total RNA isolated from the sample with a polynucleotide kinase (PNK) to modify the 3' phosphate to a hydroxyl group, thereby producing an end-repaired total RNA; contacting the end-repaired total RNA with a polyadenylate polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; releasing the polyadenylated total RNA from the tissue sample; T sequence on a substrate; deplete ribosomal RNA from the total RNA, leaving polyadenylated mRNA; elute the polyadenylated mRNA from the substrate; contact the polyadenylated mRNA with a high processivity reverse transcriptase (RT) to produce a first cDNA chain complementary to the mRNA transcript; contact the first cDNA chain with a high processivity reverse transcriptase (RT) or a high processivity DNA polymerase to produce a second cDNA chain complementary to the first cDNA chain, thereby producing a PCR template; elute the PCR template; and generate an mRNA library from the PCR template using the methods described herein.

[0121] Spatial detection and analysis of nucleic acids in tissue samples

[0122] According to the methods described herein, spatial detection and analysis of nucleic acids in tissue samples can be performed using a group of two or more capture probes (e.g., 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more capture probes). Typically, at least the first capture probe in a group of capture probes is fixed to a capture array. In some embodiments, the second capture probe may be fixed to the same capture array as the first capture probe, for example, near the first capture probe, for example, in the same capture site. In some embodiments, the second capture probe may be fixed to particles (such as magnetic particles or magnetic nanoparticles). In some embodiments, the second capture probe can be in a solution, for example, for in situ reaction with nucleic acids in a tissue sample. The capture probes in the capture probe group can individually and independently have a variety of different regions, for example, a capture region (e.g., a first universal or gene-specific capture region or a first cluster region), a primer binding region (e.g., an SBS primer region, such as an SBS3 or SBS12 region) or a second universal region / cluster sequence, such as a P5 or P7 region, a spatial address region (e.g., a partial or combined spatial address region) or a cleavable region.

[0123] Exemplary sequences include the following Rd1 and Rd2 adaptor sequences. Second universal adaptor - Rd1SBS3 (long): ACACTCTTTCCCTACACGAC GCTCTTCCGATCT (SEQ ID NO: 7); second universal adapter - Rd1 SBS3 (short): ACACTCTTTCCCTACACGAC (SEQ ID NO: 8); first universal adapter - Rd2SBS12 (long): GTGACTGGAGTTCAGACGTGT GCTCTTCCGATCT (SEQ ID NO:9); First universal adaptor - Rd2 SBS12 (short): GTGACTGGAGTTCAGACGTGT (SEQ ID NO:10).

[0124] In some embodiments, only one capture probe in a set of capture probes comprises a capture region. In some embodiments, two or more capture probes in a set of capture probes comprise a capture region.

[0125] In some embodiments, only one probe in a set of capture probes comprises a spatial address region, for example, a complete spatial address region such as describing the location of a capture site on a capture array. In some embodiments, two or more probes in a set of capture probes may comprise a spatial address region, for example, two or more probes may each comprise a partial spatial address region (i.e., a combined address region), wherein each partial address region describes the location of a capture site on a capture array, for example, along the x-axis or y-axis.

[0126] In some embodiments, a set of capture probes (e.g., a first capture probe and a second capture probe) may include at least one capture probe comprising a capture region and a spatial address region (e.g., a complete or partial spatial address region). In some embodiments, no capture probe in a set of capture probes comprises both a capture region and a spatial address region.

[0127] In some embodiments, the first capture probe is a 5' gene-specific probe comprising a sequence complementary to the first universal adaptor sequence and a 5' gene-specific primer.

[0128] In some embodiments, the second capture probe is a 3' gene-specific probe comprising a 3' gene-specific primer, a unique molecular index (UMI), and a second universal adapter sequence (Rd1 adapter). In some embodiments, the second capture probe does not comprise a spatial address region.

[0129] In some embodiments, the capture site on the substrate is a plurality of capture sites. In some embodiments, the plurality of capture sites is 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 30,000 or more, 100,000 or more, 300,000 or more, 1,000,000 or more, 3,000,000 or more, or 10,000,000, or 1,000,000,000 or more capture sites.

[0130] In various embodiments, the capture array or substrate comprises 2 )A capture site density of 1 or more, 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 100,000 or more, 1,000,000 or more capture sites.

[0131] In various embodiments, the capture probe pairs in the capture site are multiple pairs of capture probes. In some embodiments, the multiple capture probes are 2 or more, 10 or more, 30 or more, 100 or more, 300 or more, 1,000 or more, 3,000 or more, 10,000 or more, 30,000 or more, 100,000 or more, 300,000 or more, 1,000,000 or more, 3,000,000 or more, or 10,000,000 or more, 100,000,000 or more, or 1,000,000,000 or more capture probes.

[0132] In some embodiments, the capture probe pairs in the capture sites of the substrate are multiple pairs of capture probes. In some embodiments, each first capture probe in multiple pairs of capture probes in the same capture site comprises the same spatial address sequence. In some embodiments, each first capture probe in multiple pairs of capture probes in different capture sites comprises different spatial address sequences.

[0133] In some embodiments, the surface of the capture array is a flat surface, e.g., a glass surface. In some embodiments, the surface of the capture array includes one or more holes. In some embodiments, the one or more holes correspond to one or more capture sites. In some embodiments, the surface of the capture array is a bead surface.

[0134] In some embodiments, the capture region in the second capture probe is a gene-specific capture region. In some embodiments, the gene-specific capture region in the second capture probe comprises a TruSeq TM Sequences of Custom Amplicon (TSCA) Oligonucleotide Probes (Illumina, Inc.) For example, the gene-specific capture regions in the plurality of second capture probes in a capture site can comprise a plurality of TSCA oligonucleotide probe sequences.

[0135] In another embodiment, the disclosure provides nanoparticles or beads comprising spatially addressable probes disclosed herein. In a specific embodiment, beads comprise spatially addressable probes disclosed herein. In yet another embodiment, beads comprise streptavidin on the surface of beads. In yet another embodiment, beads comprise multiple oligonucleotides bound to beads via a bond or a reversible bond. Examples of reversible bonds include biotin molecules, such as ddBio molecules. The oligonucleotides bound to beads typically comprise an adapter sequence, such as a P5 sequence or a P7 sequence. As used herein, the P5 sequence comprises a sequence defined by AAT GAT ACG GCG ACC ACC GA (SEQ ID NO: 1) or AAT GAT ACG GCG ACC ACC GAG ATC TACAC (SEQ ID NO: 2), and the P7 sequence comprises a sequence defined by CAA GCA GAA GAC GGC ATA CG (SEQ ID NO: 3) or CAA GCA GAA GAC GGC ATA CGA GAT (SEQ ID NO: 4). In some embodiments, P5 or P7 sequence may also include spacer polynucleotides, and its length may be 1 to 20 nucleotides, such as 1 to 15 or 1 to 10 nucleotides, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides. In some embodiments, the spacer includes 10 nucleotides. In some embodiments, the spacer includes 10 nucleotides. In some embodiments, the spacer is a polyT spacer, such as a 10T spacer. Spacer nucleotides may be included in the 5' end of the polynucleotide, which may be attached to a suitable carrier by a key with the 5' end of the oligonucleotide. Attachment may be achieved by sulfur-containing nucleophiles (such as thiophosphates) present at the 5' end of the polynucleotide. In some embodiments, the oligonucleotide will include a polyT spacer and a 5' thiophosphate group. Thus, in some embodiments, the P5 sequence comprises 5' phosphorothioate-TTTTTTTTTTAATGATACGGCGACCACCGA-3' (SEQ ID NO:5), and in some embodiments, the P7 sequence comprises 5' phosphorothioate-TTTTTTTTTTCAAGCAGAAGACGGCATACGA-3' (SEQ ID NO:6). In certain embodiments, the oligonucleotide attached to the bead comprises an address sequence that allows the x, y position of the oligonucleotide / bead to be determined when decoded.In other embodiments, the address sequence is 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides in length, or a range including or between any two of the above nucleotides. In another embodiment, the oligonucleotide attached to the beads comprises a transposome hybridization region (Tsm hyb). In yet other embodiments, the oligonucleotide comprises a sequencing primer site sequence. Examples of sequencing primer site sequences include and from Illumina. TM The oligonucleotide may further comprise one or more linker sequences. In yet another embodiment, the oligonucleotide may further comprise one or more index sequences. In certain embodiments, the oligonucleotide may comprise one or more unique molecular identifier (UMI) sequences. A unique molecular identifier (UMI) is a class of molecular barcodes that provide error correction and increased accuracy during sequencing. These molecular barcodes are short sequences used to uniquely mark each molecule in a sample library. UMI is used in a wide range of sequencing applications, many of which are PCR replications around DNA and cDNA. UMI deduplication can also be used for RNA-seq gene expression analysis and other quantitative sequencing methods. As previously noted, the oligonucleotide comprises a portion or sequence that can specifically bind to a polynucleotide from a biological sample (e.g., a tissue sample). Therefore, the oligonucleotide attached to the bead is a spatially addressable probe for a polynucleotide from a biological sample. A portion or sequence that can specifically bind to a polynucleotide from a biological sample can be selected for use in a specific omics application. For example, the oligonucleotide may comprise a oligo d (T) sequence for transcriptomics or for determination (e.g., RNA-seq determination). Alternatively, the oligonucleotide may comprise a sequence that binds to genomic DNA from a biological sample for genomic applications or for determination (e.g., ATAC-seq determination). As provided in the embodiments presented herein, beads may comprise various types of oligonucleotides having different parts or sequences, so that spatially addressable probes can specifically bind to two or more different types of polynucleotides from a biological sample. The use of various types of oligonucleotides is ideally suitable for multi-omics or multi-determination applications.

[0136] Reagent test kit

[0137] Kits and articles are also encompassed herein. Such kits may include carriers, packages or containers, such as vials, tubes, etc., separated to receive one or more containers, each container including one of the independent elements to be used in the methods described herein. Suitable containers include, for example, bottles, vials, syringes and test tubes. The container may be formed of a variety of materials, such as glass or plastic. For example, a container may include one or more spatially addressable probes disclosed herein, optionally in a composition or in combination with another reagent disclosed herein (e.g., arrays, bead chips). Optionally, the container has a sterile inlet (e.g., the container may be an intravenous bag or a vial with a stopper that can be pierced by a hypodermic needle). Optionally, such kits include an identification description or label or instructions for use thereof in the methods described herein.

[0138] The kit will typically include one or more additional containers, each with one or more of the various materials (such as reagents and / or devices, optionally in concentrated form) that are desirable from a commercial and user standpoint for use with the spatially addressable probes described herein. Non-limiting examples of such materials include, but are not limited to: buffers, diluents, filters, needles, syringes; carriers, packaging, containers, vials, and / or tube labels listing the contents and / or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.

[0139] The mark may be on or associated with the container. In the case where the letters, numbers or other characters forming the mark are attached, molded or etched to the container itself, the mark may be on the container, and when it is present in a receptacle or carrier that also supports the container, such as in a package insert, the mark may be associated with the container. The mark may be used to indicate that the contents will be used for a specific spatial omics application. Such as in the method described herein, the mark may also indicate the direction in which the contents are used.

[0140] The following examples are intended to illustrate but not to limit the present disclosure. Although they are typical of methods that can be used, other methods known to those skilled in the art may alternatively be used.

[0141] Example

[0142] Example 1 - In situ capture of FFPE RNA for spatial transcriptomics applications

[0143] The genetic profile of a tissue sample can be used to diagnose and determine treatment for a subject having or at risk for a disease determined by the genetic profile. In situ polyadenylation has been investigated as a method to increase RNA capture from FFPE tissue samples. In situ polyadenylation adds polyA tails to fragmented transcripts, creating regions that can then be used for capture on a polyT surface.

[0144] Total RNA was extracted and used for this initial experiment. Three conditions were tested: 1.) no treatment, 2.) polyadenylation, and 3.) end repair with polynucleotide kinase (PNK), which converts the 3' phosphate to a hydroxyl group for polyA addition, followed by polyadenylation. Figure 2 )

[0145] In the initial experiment ( Figure 3 ), total RNA was extracted from FFPE tissue using the RNeasy FFPE kit (Qiagen). Total RNA was extracted from fresh frozen tissue using the RNeasy mini kit (Qiagen). 500ng total RNA was used for each condition. Samples were treated with + / - end repair polynucleotide kinase (PNK) mixture (1X T4 PNK buffer (NEB), 10U T4 PNK (NEB), water) at 37°C for 30 minutes. The reaction was then terminated with 20mM final EDTA. Samples were purified with RNAClean XP beads (1.8X reaction volume). Samples were then treated with + / - PAP mixture (1X yPAP reaction buffer (ThermoFisher), 500μM ATP, 600U yPAP, water) and incubated at 37°C for 20 minutes. The reaction was terminated with 5mM final EDTA. Samples were purified with RNAClean XP beads (1.8X reaction volume). The samples were then hybridized to Illumina RPBX oligo-dT beads using the following parameters: 65°C for 5 minutes, 4°C for 30 seconds, and 23°C for 5 minutes. The samples were washed once with Illumina Bead Wash Buffer (BWB). The samples were then eluted in Illumina Elution Buffer (ELB). The kit quantifies the eluate.

[0146] Plotting the QUBIT concentration between conditions ( Figure 4 ). Oligo-dT beads saturated after PAP, indicating increased capture of polyA RNA. PAP significantly improved capture of polyA RNA from both FFPE and fresh frozen samples. End repair improved capture by approximately 10%. The expected capture of approximately 2% of mRNA in untreated samples (which comprised 1% to 5% of total RNA) was observed. TapeStation analysis showed capture of 18S and 28S (non-polyA RNA) from the total RNA population, indicating that polyadenylation is acting to improve RNA capture ( Figure 5 ).

[0147] To test the in situ PAP, a Figure 2 Similar solutions ( Figure 6 In this experiment, end-repair was added to all PAP samples ( Figure 7). Three 10 micron fresh frozen tissue sections were mounted on two charged slides (one slide for untreated tissue and one slide for polyadenylation). The slides were fixed in methanol for 30 minutes at -20°C, treated with isopropanol for 1 minute at room temperature, and then air-dried for 10 minutes. A barrier was then drawn around each fresh frozen tissue section using a hydrophobic pen. Commercial FFPE tissue with fixed tissue sections was purchased from Zyagen. The slides were oven-baked at 60°C for 1 hour, followed by the following rehydration series: two incubations in xylene at room temperature for 10 minutes, followed by three incubations in 100% ethanol for 3 minutes, followed by two incubations in 96% ethanol for 3 minutes, followed by incubation in 70% ethanol for 3 minutes. The surface was then treated with nuclease-free water for 1 minute at room temperature. The slides were then dried at 37°C for 5 minutes. The pre-permeabilization mixture was then added to the tissue (986 μl HBS buffer (Life tech), 10 μl BSA (20 mg / ml), 4 μl collagenase I (50 U / μl, Life tech)) and incubated at 37°C for 20 minutes. The pre-permeabilization mixture was then removed and TE (pH 9) was added to the slide to de-crosslink. A barrier was then drawn around each FFPE tissue using a hydrophobic pen. The samples were treated with + / - end repair PNK mixture (1X T4 PNK buffer (NEB), 10U T4 PNK (NEB), 40UProtector RNase inhibitor (Millipore Sigma), water) at 37°C for 30 minutes. The samples were then washed with 100 μl 0.1XSSC buffer. Each well was then equilibrated at room temperature for 30 seconds with 100ul 1X yPAP buffer (1XyPAP reaction buffer, 40UProtector RNase inhibitor, water). The solution was discarded and the tissue was incubated at 37°C for 25 minutes in 75μl yPAP reaction mixture (1X yPAP reaction buffer, 1nM ATP, 600U PAP, 120U Protector RNase inhibitor, water). The PAP mixture was discarded and the tissue was washed once with 100μl 0.1X SSC. 60μl tissue digestion mixture (100mM Tris buffer, pH 8, 100mM NaCl, 5mM EDTA, 2% SDS, 16U / ml proteinase K (NEB)) was then added to the tissue and incubated at 37°C for 40 minutes. The tissue digestion mixture was then removed and added to the strip tube. An additional wash was performed in the barrier with 50μl 0.1X SSC and added to the tissue digestion mixture of the sample. All samples were then purified with a DNA enzyme step using an RNeasy mini kit (Qiagen) according to the manufacturer's instructions.Samples were quantified using the High Sensitivity RNA QUBIT kit and 50 ng was set aside as a "non-capture" control. The remaining RNA was subjected to Invitrogen's mRNA purification kit (oligo-dT beads) according to the manufacturer's instructions. RT-qPCR and High Sensitivity RNA. The kit quantifies the captured RNA.

[0148] Primer and probe pairs were designed for Kap (mRNA) and 18S (rRNA) to investigate fold differences in polyadenylation. Primer / probe pairs were used with the QuantiNova RT-qPCR kit (Qiagen) according to the manufacturer's instructions. End repair using PNK as well as polyadenylation to generate more polyA transcripts were included in the workflow, which resulted in more mRNA capture (4.7-fold increase in Kap in FFPE tissue) and rRNA capture (9-fold increase in 18S in FFPE tissue) ( Figure 8 ). The captured RNA was also quantified using QUBIT. Including end-repair and polyadenylation in sample preparation increased RNA capture from both fresh-frozen and FFPE tissues, indicating that in situ polyadenylation works efficiently ( Fig. 9 ).

[0149] Preparation of RNA-Seq libraries after Illumina's RNA Prep with Enrichment (L) tagmentation (without enrichment step) Fig.10 A). The library preparation used low density eBLTL to transpose to the fragment library and add PCR adapters. 17 cycles of index PCR using UD indexing were used. TapeStation showed that polyadenylation increased library fragment size. Libraries were normalized, pooled, and 0.8 pM was sequenced on a Nextseq with 1% PhiX ( Fig.10 B).

[0150] PolyA trimming of fastq libraries showed that approximately 50% of the FFPE PAP-treated library yield was transposed polyA. This suggests that polyadenylation is working. Additionally, the length of the polyA tail added can be controlled by the ligation method. RNA ligase 2 deletion mutants (such as those used in Illumina small RNA preparation kits; Epicentre) can ligate polyA adapters to the 3' end of transcripts for enrichment on polyT surfaces ( Fig.11 ).

[0151] Sequences separated were aligned using the base space RNA-seq alignment application. Alignment analysis revealed altered 3' biased transcript coverage by polyadenylation ( Fig.12 A) and increase the insert size ( Fig.12 B). Polyadenylation also increases the percentage of reads aligned to the coding regions of FFPE isolated mRNA ( Fig.12 C) These sequencing metrics demonstrate that in situ polyadenylation is efficient and can be used as a method to increase the capture of FFPE RNA on a spatial, barcoded basis.

[0152] Example 2 - Use of high processivity polymerase for mRNA library preparation

[0153] Traditionally, reverse transcriptase (RT) is implemented in a 1-step or 2-step workflow, using different types of polymerases for each step, depending on the template type (ssDNA or ssRNA) and the priming strategy (oligo-dT, random primers, or a combination of both). In a 2-step workflow using oligo-dT as a primer in the first-strand RT synthesis and random primers as primers in the second-strand synthesis, a 3'-bias is expected in the alignment transcript coverage in RNA-seq applications. The general practice of optimization that has been established previously is to use maxima H-, a well-known RTase that has been evaluated as having the highest efficiency (e.g., in terms of cDNA yield, not quality) for first-strand RT synthesis, and then perform second-strand synthesis with a common DNA polymerase with some strand displacement activity (e.g., Klenow fragment exo-).

[0154] This approach encountered low efficiency in synthesizing high-quality cDNA from permeabilized tissue samples on the grafted flow cell (FC) surface, which may be attributed to mRNA degradation before and / or during RT and low RT efficiency on the FC surface. Subsequent sequencing of cDNA regions showed symptoms of high poly A% fractions, with base% as high as >60%, indicating that short and / or fragmented cDNAs were synthesized.

[0155] We tested multiple approaches to improve cDNA data quality and after switching the polymerase from Klenow fragment exo- to SSIV in secondary strand synthesis, we observed a higher fraction of cDNA in the 400-1000 bp region under SSIV conditions compared to the Klenow exo- control ( Fig.13 ).

[0156] In summary, the use of faster processivity enzymes such as SSIV in a 2-step workflow has several benefits when applied to spatial genomics library preparation. When using SSIV as the RTase for 1st strand RT synthesis, it shortens the workflow time from 16 to 20 hours overnight incubation to 1 hour with comparable hands-on time. This not only saves time and improves workflow efficiency, but also reduces concerns about mRNA diffusion during capture, which is the main limiting factor for spatial resolution.

[0157] The use of SSIV as the polymerase for second-strand synthesis, although contrary to prevailing general practice, actually improves the ease of SPRI selection in subsequent library preparation, as it preferentially increases the cDNA length to 400-1000 bp, leaving the mRNA fraction <400 bp relatively low compared to the main peak and thus easier to remove ( Fig.14 In addition, the use of SSIV as either RTase for 1st strand RT synthesis in addition to being a polymerase for 2nd strand synthesis further improves the length and therefore integrity (and possibly complexity) of the cDNA in the final product ( Fig.15 ).

[0158] Subsequent data analysis from RNA-seq alignments showed that the use of SSIV as the RTase for 1st strand RT synthesis or the polymerase for 2nd strand synthesis resulted in the highest mapped fraction of exonic regions, especially in coding regions (captured coding regions increased from -52% to -62%), with reduced 3' bias (due to the polydT priming strategy) and a decrease in the median CV of transcript coverage from -1.41 to 1.34 (Tables 1 and 2).

[0159] Table 1. RNAs in which maxima H acts as RTase in the first strand synthesis and SSIV acts as polymerase in the second strand synthesis Seq comparison

[0160] Comparison information

[0161] area Multiple coverage % Bases coding 17.50x 51.92％ UTR 11.15x 35.27％ Intron 0.08x 6.51％ intergenic region 0.04x 6.30％

[0162] Table 2. RNA-seq alignment of SSIVx2 (SSIV as both 1st strand RTase and 2nd strand synthesis)

[0163] Comparison information

[0164] area Multiple coverage % Bases coding 23.31x 62.01％ UTR 9.09x 25.79％ Intron 0.07x 5.39％ intergenic region 0.05x 6.82％

[0165] In general practice, although SSIV is a RTase and can bind to both ssDNA and ssRNA, it is not generally recommended for second-strand synthesis because it requires ssDNA as a template, and RTases generally bind to RNA more preferentially than ssDNA. Researchers also tend to use one RTase rather than two RTases for workflows. Another previous concern about the use of SSIV is the relatively low fidelity of RTases compared to normal DNA polymerases, which is partly due to their loss of proofreading function and partly due to the dual template use of both DNA and RNA. However, the use of SSIV in this paper did not reveal any mutation problems in downstream RNA-seq alignment analysis.

[0166] Unexpectedly, when SSIV was used as both the RTase for 1st strand RT synthesis and the polymerase for 2nd strand synthesis, the reduction in the 3' bias of the median CV of transcript coverage in the RNA-seq alignment analysis results (from -1.41 to 1.34 for the test in closed FC) was beneficial and can be further explored.

[0167] The results show that the methods herein provide significant improvements in separating longer cDNA fragments in the range of 500-3000 bp, as indicated by peak shifts on the Bioanalyzer, but also provide much lower polyA percentages (-30%), with improved transcript alignments reaching >89% in RNA-seq alignments (STAR ​​aligner), with more than 90% being exonic transcripts. In particular, the use of SSIV in both 1st and 2nd strand synthesis increased the percentage of coding regions in mapped transcripts from -52% to 62%, while reducing the 3' bias in the CV of transcript coverage. The use of SSIV as the 2nd strand synthesis polymerase plays a key role in improved mRNA transcript delivery and library preparation.

[0168] It should be understood, therefore, that the invention is not limited to the particular embodiments disclosed, but is intended to cover all modifications within the spirit and scope of the invention as defined in the appended claims; the above description and / or shown in the accompanying drawings. Therefore, only such limitations as appear in the appended claims should be placed on the present disclosure.

Claims

1. A method for isolating RNA from a sample, the method comprising: (a) contacting total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphate to hydroxyl, thereby generating end-repaired total RNA; (b) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; (c) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides comprising a poly T sequence; and (d) eluting the polyadenylated total RNA from the substrate.

2. The method according to claim 1, further comprising quantifying the total RNA.

3. A method for preparing an RNA library from a tissue sample, the method comprising: (a) contacting total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphate to hydroxyl, thereby generating end-repaired total RNA; (b) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; (c) releasing the polyadenylated total RNA from the tissue sample; (d) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides comprising a poly T sequence; and (e) generating an RNA library from the polyadenylated total RNA using an RNA library preparation kit.

4. The method according to any one of claims 1 to 3, wherein the RNA comprises rRNA and / or mRNA.

5. A method for preparing an mRNA transcriptome library from a tissue sample, the method comprising: (a) contacting total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphate to hydroxyl, thereby generating end-repaired total RNA; (b) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; (c) releasing the polyadenylated total RNA from the tissue sample; (d) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides comprising a poly T sequence; (e) depleting ribosomal RNA from the total RNA to leave polyadenylated mRNA; and (f) generating an mRNA library from the polyadenylated mRNA using an mRNA library preparation kit.

6. The method according to any one of the preceding claims, wherein the substrate is a bead, a bead array, a spotted array, a flow cell, clustered particles arranged on the surface of a chip, a membrane and a plate.

7. The method according to any of the preceding claims, wherein the sample is a fresh frozen tissue sample or a formalin fixed paraffin embedded (FFPE) sample.

8. The method of any one of claims 3 to 7, wherein releasing comprises contacting the sample with a lysis buffer, a permeabilization buffer and / or a reagent to deparaffinize the FFPE sample.

9. The method according to any one of claims 3 to 8, wherein when the sample is a FFPE sample on a slide, the method comprises permeabilizing and collagenase treating the sample on the slide before contacting the RNA with PNK. 10 . The method according to claim 7 , further comprising decrosslinking the FFPE sample, optionally wherein the decrosslinking is performed using TE buffer at pH 9.

11. The method according to any one of the preceding claims, wherein the polyA tail is between 3 and 50 nucleotides.

12. The method according to any one of claims 3 to 11, wherein generating the RNA library comprises the following steps: The polyadenylated total RNA is eluted from the substrate, and the RNA library is generated from the eluted polyadenylated RNA library using an RNA library preparation kit.

13. The method according to any one of claims 3 to 12, wherein generating the RNA library comprises: i) contacting the isolated RNA with a reverse transcriptase (RT) to produce a first cDNA strand complementary to the RNA; ii) contacting the first cDNA strand with a reverse transcriptase (RT) or a DNA polymerase to generate a second cDNA strand complementary to the first cDNA strand; iii) amplifying the second strand cDNA to form a PCR template and isolating the PCR template; and iv) generating an RNA library from said PCR template.

14. The method according to any one of claims 3 to 13, wherein the RNA library is an mRNA library.

15. The method of claim 14, wherein the PCR template is further processed by tagmentation to generate a spatial transcriptomics library.

16. The method of claim 15, wherein the tagmentation comprises on-bead tagmentation, wherein the beads comprise a plurality of bead-linked transposomes (BLTs).

17. The method of claim 16, wherein the BLT comprises: i) a plurality of oligonucleotides comprising a first clustering sequence (P7), a first index sequence, and a read 1 sequencing primer (Rd1 SP); as well as ii) a plurality of oligonucleotides comprising a second clustering sequence (P5), a second index sequence and a read 2 sequencing primer (Rd2 SP).

18. A method for improving the capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation, the method comprising: (a) capturing mRNA transcripts from a sample on a substrate; (b) contacting the substrate with a high processivity reverse transcriptase (RT) to produce a first cDNA strand complementary to the mRNA transcript; (c) contacting the first cDNA strand with a DNA polymerase to generate a second cDNA strand complementary to the first cDNA strand; and (d) amplifying the second strand cDNA to form a PCR template and isolating the PCR template.

19. A method for improving the capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation, the method comprising: (a) capturing mRNA transcripts from a sample on a substrate; (b) contacting the substrate with a reverse transcriptase (RT) to generate a first cDNA strand complementary to the mRNA transcript; (c) contacting the first cDNA strand with a high-processivity reverse transcriptase (RT) or a high-processivity DNA polymerase to generate a second cDNA strand complementary to the first cDNA strand; as well as (d) amplifying the second strand cDNA to form a PCR template and isolating the PCR template.

20. A method for improving the capture efficiency of mRNA transcripts for in situ mRNA transcript library preparation, the method comprising: (a) capturing mRNA transcripts from a sample on a substrate; (b) contacting the substrate with a high processivity reverse transcriptase (RT) to produce a first cDNA strand complementary to the mRNA transcript; (c) contacting the first cDNA strand with the high processivity reverse transcriptase (RT) or high processivity DNA polymerase to generate a second cDNA strand complementary to the first cDNA strand; as well as (d) amplifying the second strand cDNA to form a PCR template and isolating the PCR template.

21. A method for improving the nucleotide length of a polynucleotide used to generate an in situ transcriptome library, the method comprising: (a) capturing mRNA transcripts from a sample on a substrate; (b) contacting the substrate with a high processivity reverse transcriptase (RT) to produce a first cDNA strand complementary to the mRNA transcript; (c) contacting the first cDNA strand with a high-processivity reverse transcriptase (RT) or a high-processivity DNA polymerase to generate a second cDNA strand complementary to the first cDNA strand; (d) amplifying the second strand cDNA to form a PCR template and isolating the PCR template.

22. The method of any one of claims 18 to 21, wherein the high processivity RT is Superscript IV, a thermostable group II intron RT (TGIRT), or a marathon RT.

23. The method of any one of claims 18 to 22, wherein the high processivity DNA polymerase is Klenow exo-, Bst 3.0 or phi29.

24. A method for preparing an mRNA transcriptome library from a tissue sample, the method comprising: (a) contacting total RNA isolated from the sample with polynucleotide kinase (PNK) to modify 3' phosphate to hydroxyl, thereby generating end-repaired total RNA; (b) contacting the total RNA with polynucleotide kinase (PNK) to modify the 3' phosphate to a hydroxyl group, thereby generating end-repaired total RNA; (c) contacting the end-repaired total RNA with polyadenylate polymerase (PAP) and adenosine nucleotides to produce polyadenylated total RNA; (d) releasing the polyadenylated total RNA from the tissue sample; (e) capturing the polyadenylated total RNA on a substrate comprising one or more oligonucleotides comprising a poly T sequence; (f) depleting ribosomal RNA from the total RNA, leaving polyadenylated mRNA; (g) contacting the polyadenylated mRNA with a reverse transcriptase (RT) to produce a first cDNA strand complementary to the mRNA transcript; (h) contacting the first cDNA strand with a high processivity reverse transcriptase (RT) or a high processivity DNA polymerase to generate a second cDNA strand complementary to the first cDNA strand, thereby generating a PCR template; (i) eluting the PCR template; as well as (j) generating an mRNA library from the PCR template.

25. The method of any one of claims 18 to 24, wherein the substrate is a bead, a bead array, a spotted array, a flow cell, clustered particles arranged on the surface of a chip, a membrane or a plate.

26. The method of any one of claims 18 to 25, wherein the sample is a fresh frozen tissue sample or a formalin fixed paraffin embedded (FFPE) sample.

27. The method of any one of claims 24 to 26, wherein releasing comprises contacting the sample with a lysis buffer, a permeabilization buffer and / or a reagent to deparaffinize the FFPE sample.

28. The method according to any one of claims 24 to 27, wherein when the sample is a FFPE sample on a slide, the method comprises permeabilizing and collagenase treating the sample on the slide before contacting the RNA with PNK.

29. The method according to any one of claims 26 to 28, further comprising decrosslinking the FFPE sample, optionally wherein the decrosslinking is performed using TE buffer at pH 9.

30. The method of any one of claims 24 to 29, wherein the polyA tail is between 3 and 50 nucleotides.

31. The method according to any one of claims 24 to 30, wherein generating the RNA library comprises the following steps: The polyadenylated total RNA is eluted from the substrate, and the RNA library is generated from the eluted polyadenylated RNA library using an RNA library preparation kit.

32. The method of any one of claims 24 to 31, wherein generating the RNA library comprises: i) contacting the isolated RNA with a reverse transcriptase (RT) to produce a first cDNA strand complementary to the RNA; ii) contacting the first cDNA strand with a reverse transcriptase (RT) or a DNA polymerase to generate a second cDNA strand complementary to the first cDNA strand; iii) amplifying the second strand cDNA to form a PCR template and isolating the PCR template; as well as iv) generating an mRNA library from said PCR template.

33. The method according to any one of claims 24 to 32, wherein the RNA library is an mRNA library.

34. The method of claim 33, wherein the PCR template is further processed by tagmentation to generate a spatial transcriptomics library.

35. The method of claim 34, wherein the tagmentation comprises on-bead tagmentation, wherein the beads comprise a plurality of bead-linked transposomes (BLTs).

36. The method of claim 35, wherein the BLT comprises: i) a plurality of oligonucleotides comprising a first clustering sequence (P7), a first index sequence, and a read 1 sequencing primer (Rd1 SP); as well as ii) a plurality of oligonucleotides comprising a second clustering sequence (P5), a second index sequence and a read 2 sequencing primer (Rd2 SP).

37. The method of any one of claims 24 to 36, wherein the reverse transcriptase is a high processivity reverse transcriptase.

Images