Application of klebsiella pneumoniae surface membrane protein and vaccine

Abstract

The invention is applicable to the technical field of bioengineering, and provides application of klebsiella pneumoniae surface film protein and a vaccine, and the target sequence of the klebsiella pneumoniae surface film protein is shown as SEQ ID NO.3 in a sequence table; the klebsiella pneumoniae surface membrane protein can be used for preparing drugs or vaccines for preventing and treating klebsiella pneumoniae infection. The vaccine aiming at the klebsiella pneumoniae is produced on the basis of the klebsiella pneumoniae surface membrane protein, mRNA and circRNA, the method has the characteristics of rapidness, standardization, easiness in scale expansion and good immune effect, and flexible, rapid and efficient vaccine production can be realized.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to an application of Klebsiella pneumoniae surface membrane protein and a vaccine. Background Art

[0002] Klebsiella pneumoniae is one of the major pathogens worldwide, causing widespread nosocomial and community-acquired infections, including pneumonia, liver abscess, digestive tract infection, urinary tract infection, and severe cases of sepsis that endanger patients' lives. In recent years, due to the rapid spread of multidrug-resistant Klebsiella pneumoniae (MDR-KP), especially the prevalence of carbapenem-resistant Klebsiella pneumoniae (CRKP) and highly virulent Klebsiella pneumoniae (hvKP), clinical antibiotic treatment options have become increasingly limited. Data show that from 2005 to 2018, the detection rate of CRKP increased from 3% to 25%, and resistance to commonly used antibiotics also showed a significant upward trend. Clinical combined antibiotic regimens have little effect and may increase drug resistance and treatment failure. Therefore, it is urgent to develop new anti-infection and prevention strategies to combat Klebsiella pneumoniae.

[0003] In this context, vaccine development against Klebsiella pneumoniae provides a promising solution to the antibiotic resistance crisis. Unlike antibiotics, vaccines stimulate the host immune system to recognize and attack specific pathogens. It provides a sustainable way to prevent infection. The development of vaccines against Klebsiella pneumoniae can not only reduce the incidence of community or hospital-acquired infections caused by this pathogen, but also reduce its resistance to antibiotics, thereby alleviating the pressure of treatment selection and curbing the development and spread of resistant strains. In recent years, the progress of messenger RNA (mRNA) and circular RNA (circRNA) vaccine technologies has opened up new directions for the prevention and control of infectious diseases. They introduce mRNA or circRNA encoding disease-specific antigens into the body, use the protein synthesis machinery of host cells to produce antigens, and thus trigger an immune response. The rapidity and editability of nucleic acid vaccine technologies make them suitable as vaccine platforms for high detection and high resistance of difficult-to-treat pathogens.

[0004] Traditional vaccines (inactivated vaccines, adenovirus vector vaccines, recombinant protein vaccines) against pathogens such as viruses and bacteria are very time-consuming and complex to produce, usually taking several months. Each new vaccine requires a tailored production process, and rapid response to pathogen mutations is impossible. Summary of the invention

[0005] The purpose of the present invention is to provide an application of Klebsiella pneumoniae surface membrane protein, aiming to solve the problems raised in the background technology.

[0006] In view of the above problems, an embodiment of the present invention is achieved by using a Klebsiella pneumoniae surface membrane protein in the preparation of a drug or vaccine for preventing and treating Klebsiella pneumoniae infection.

[0007] Preferably, the target sequence of the Klebsiella pneumoniae surface membrane protein is shown in SEQ ID NO.3 in the sequence listing.

[0008] Another object of the present invention is to provide a vaccine for preventing and treating Klebsiella pneumoniae infection, wherein the vaccine is prepared through the nucleotide sequence of the surface membrane protein of Klebsiella pneumoniae; the vaccine is any one or more combinations of DNA vaccine, RNA vaccine and protein vaccine.

[0009] Preferably, the target sequence of the Klebsiella pneumoniae surface membrane protein is shown in SEQ ID NO.3 in the sequence listing.

[0010] Preferably, the vaccine is prepared by constructing an mRNA plasmid or a circRNA plasmid based on the nucleotide sequence of the Klebsiella pneumoniae surface membrane protein.

[0011] Preferably, the nucleotide sequence of the mRNA plasmid is shown in SEQ ID NO.4 in the sequence listing; the nucleotide sequence of the circRNA plasmid is shown in SEQ ID NO.5 in the sequence listing.

[0012] Preferably, the method for preparing the vaccine comprises the following steps: Inserting the target sequence of the Klebsiella pneumoniae surface membrane protein into the CDS region of the mRNA vector or circRNA vector to obtain an mRNA plasmid or a circRNA plasmid; The mRNA plasmid or circRNA plasmid is transformed into competent cells, and the plasmid is extracted, and then the extracted plasmid is linearized to obtain a linearized plasmid; The linearized plasmid was transcribed in vitro to generate RNA; The RNA is encapsulated with a pharmaceutical carrier to obtain the vaccine.

[0013] Preferably, the nucleotide sequence of the mRNA vector is as shown in the sequence listing SEQ ID NO.1.

[0014] Preferably, the nucleotide sequence of the circRNA vector is as shown in the sequence listing SEQ ID NO.2.

[0015] Preferably, the pharmaceutical carrier includes, but is not limited to, any one or more combinations of lipid nanoparticles, polymer nanoparticles, inorganic nanoparticles, solid lipid nanoparticles, nanoemulsions and exosomes.

[0016] Preferably, the administration of the vaccine includes, but is not limited to, one or more combinations of intramuscular injection, subcutaneous injection, intradermal injection, intravenous injection, oral administration, intranasal administration, respiratory administration, transdermal administration, and lymph node targeted administration.

[0017] Preferably, the administration dosage form of the vaccine includes but is not limited to one or more combinations of injection dosage forms, oral dosage forms, nasal dosage forms, respiratory dosage forms, transdermal dosage forms, multiple-dose dosage forms, single-dose dosage forms, single-dose vials, needle-free dosage forms and nanoparticle dosage forms.

[0018] Compared with the prior art, the present invention has the following advantages: The present invention produces a vaccine against Klebsiella pneumoniae based on the surface membrane protein, mRNA and circRNA of Klebsiella pneumoniae, which has the characteristics of being rapid, standardized, easy to scale up and having good immune effects, and can realize flexible, rapid and efficient vaccine production. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 A schematic diagram of the technical solution provided in the embodiment of the present invention.

[0020] Figure 2 1 is a nucleic acid gel electrophoresis experimental result diagram of the RNA prepared in Example 1; in the figure, A is a nucleic acid gel electrophoresis experimental result diagram of the RNA plasmid before and after enzyme cleavage; B is a nucleic acid gel electrophoresis experimental result diagram of the RNA obtained by in vitro transcription and purification.

[0021] Figure 3 The expression of mRNA-LNP in cells.

[0022] Figure 4 The expression of circRNA-LNP in cells.

[0023] Figure 5 This is a diagram showing the nucleic acid gel electrophoresis experimental results of the DNA prepared in Example 3.

[0024] Figure 6 This is a diagram showing the nucleic acid gel electrophoresis experimental results of the PCR product in Example 4.

[0025] Figure 7 This is a graph showing the results of the nucleic acid gel electrophoresis experiment of the bacterial batch product in Example 4.

[0026] Figure 8 This is a diagram of the SDS-PAGE analysis results. Fig. 9 This is a graph showing the results of Western blot analysis.

[0027] Fig.10 This is the statistical result of positive cells.

[0028] Fig.11 The figure is a comparison chart of absorbance measurement results of different groups.

[0029] Fig.12 The figure is a comparison of the survival rates of mice in different groups. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0031] The technical solution provided by the embodiment of the present invention mainly solves the following technical problems: 1. Pathogenic mechanism of multidrug-resistant Klebsiella pneumoniae: In-depth study of the role and mechanism of Klebsiella pneumoniae surface membrane proteins in its survival, pathogenicity, and escape from host immune response, in order to clarify the key functions of membrane proteins in the bacterial immune process.

[0032] 2. Design and effect evaluation of messenger RNA (mRNA) and circular RNA (circRNA) vaccines: Solve the problem of how to design mRNA and circRNA vaccines based on Klebsiella pneumoniae as a model, and verify their antigen expression efficiency, immunogenicity and protective effect through in vitro and in vivo experiments, so as to provide a scientific basis for the research and development of bacterial vaccines.

[0033] 3. Optimization of lipid nanoparticle (LNP) delivery system: To address the challenges of mRNA and circRNA in pulmonary administration, optimize the LNP delivery system, achieve effective LNP encapsulation of mRNA and circRNA (mRNA-LNP, circRNA-LNP) and stable release, and study the key quality attributes of the delivery system.

[0034] 4. New strategies for the prevention and control of Klebsiella pneumoniae infection: Enhance lung immune response through mRNA-LNP and circRNA-LNP vaccines to prevent Klebsiella pneumoniae infection, providing a new alternative to traditional antibiotics.

[0035] 5. Acquisition of preclinical safety and efficacy data: Establish a complete animal model experiment to evaluate the effectiveness, safety and potential clinical application value of mRNA-LNP and circRNA-LNP vaccines in the prevention of Klebsiella pneumoniae infection.

[0036] Specifically, Figure 1 As shown (taking mRNA as an example), the technical solution adopted in the embodiment of the present invention is as follows: 1. Design and screening of mRNA and circRNA vaccines targeting Klebsiella pneumoniae: The study will use genetic engineering technology to design and synthesize mRNA and circRNA vaccines with high stability and persistent antigen expression ability against Klebsiella pneumoniae, so as to effectively stimulate the immune response against Klebsiella pneumoniae.

[0037] 2. Design and synthesis of Klebsiella pneumoniae mRNA-LNP and circRNA-LNP vaccine preparations for pulmonary delivery: Use currently known plasmids (containing T7 promoter) that can transcribe to generate mRNA and circRNA, insert any target sequence, i.e., CDS sequence, into it to form a complete mRNA and circRNA plasmid, and linearize the plasmid with a single restriction site. Use the T7 in vitro transcription kit to perform in vitro transcription on the linearized plasmid to generate a large amount of RNA. Use the zymo RNA clean&concentrator kit to purify the RNA. The synthesized and purified RNA is verified by nucleic acid gel to ensure its integrity and purity. The ionizable lipid SM-102, DOPE lipid, cholesterol, and PEG lipid are mixed together in a molar ratio of 50:10:38.5:1.5, and a certain amount of ethanol is added to form an oil phase that encapsulates RNA, i.e., a lipid nanoparticle (LNP) reagent. The aqueous phase is prepared by mixing the RNA solution with citrate in a vial equipped with a magnetic stirrer. The final concentration of citrate in the aqueous phase is 0.05M, and the pH value is between 4.5-5.0. The final volume ratio of the aqueous phase to the oil phase is 3:1. The LNP is injected into the aqueous phase by solvent injection to form a lipid nanoparticle reagent. The prepared lipid nanoparticles are tested for their release effect in the respiratory tract using the luciferase gene to ensure that they can effectively penetrate the respiratory barrier and achieve the best immune effect.

[0038] 3. In vitro and in vivo experiments to evaluate the antigen expression and effect of Klebsiella pneumoniae circRNA-LNP vaccine: In vitro experiments: The above-synthesized RNA and RNA-LNP preparations were transfected into Hela cells, and their intracellular proteins were stained to evaluate the antigen expression of the vaccine. In vivo experiments: The above-synthesized RNA and RNA-LNP were inoculated into mice according to the standard immunization process. Two weeks after the last immunization, the blood, lungs, spleen, lymph nodes, etc. of the mice were obtained to evaluate the humoral and cellular immune response effects of the RNA vaccine, and the body weight, temperature changes, and biochemical indicators such as liver and kidney function in the mice were monitored to further evaluate the safety and efficacy of the vaccine.

[0039] 4. Verify the effectiveness of mRNA-LNP and circRNA-LNP vaccines of Klebsiella pneumoniae in preventing Klebsiella pneumoniae in mice: Evaluate the protective effect of mRNA-LNP and circRNA-LNP vaccines against Klebsiella pneumoniae infection in a mouse model to determine their effectiveness under actual pathogen challenges.

[0040] The experimental methods in the following examples without specifying specific experimental conditions are usually carried out according to conventional experimental conditions or the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents, raw materials and equipment used in the present invention can be obtained from commercial sources.

[0041] Example 1: This example provides a vaccine for preventing and treating Klebsiella pneumoniae infection, including two vaccines, mRNA-LNP and circRNA-LNP. The preparation method of the vaccine comprises the following steps: S1, inserting the target sequence of the Klebsiella pneumoniae surface membrane protein into the CDS region of the mRNA vector or circRNA vector to obtain an mRNA plasmid or a circRNA plasmid; S2, transforming the mRNA plasmid or circRNA plasmid into competent cells, extracting the plasmid, and then linearizing the extracted plasmid to obtain a linearized plasmid; S3, performing in vitro transcription on the linearized plasmid to generate RNA; S4. Encapsulating RNA with lipid nanoparticle reagent to obtain the vaccine.

[0042] Among them, the nucleotide sequence of the mRNA vector (plasmid backbone) is shown in the sequence listing SEQ ID NO.1; the nucleotide sequence of the circRNA vector (plasmid backbone) is shown in the sequence listing SEQ ID NO.2; the target sequence of the Klebsiella pneumoniae surface membrane protein (KPompA) is located at the 3097823-3098590 DNA sequence in the Klebsiella pneumoniae 35657 standard strain, specifically as shown in the sequence listing SEQ ID NO.3; the nucleotide sequence of the mRNA plasmid (containing the mRNA plasmid backbone + KPompA CDS region) is shown in the sequence listing SEQ ID NO.4; the nucleotide sequence of the circRNA plasmid (containing the circRNA plasmid backbone + KPompA CDS region) is shown in the sequence listing SEQ ID NO.5.

[0043] In practical application, the vaccine is prepared as follows: (1) The double-stranded DNA molecule of the target sequence of the surface membrane protein of Klebsiella pneumoniae was inserted into the CDS region of the nucleotide sequence of the mRNA vector and the nucleotide sequence of the circRNA vector, respectively, to obtain mRNA and circRNA plasmids, which were named Plasmid-mRNA and Plasmid-circRNA. They were sent to GenScript Biotech Co., Ltd. for synthesis. After synthesis, the obtained plasmid was transformed into DH5α competent cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd.); the transformation method is as follows: 100 ng of Plasmid-mRNA or Plasmid-circRNA was added to 50 μL of DH5α, placed on ice for 30 minutes, heated in a 42°C water bath for 1 minute, and immediately placed on ice for 2 minutes after heat shock. 500 μL of non-antibiotic LB was added to the EP tube, and the tube was placed in a 37°C shaker for culture. After 1 hour, the tube was taken out and centrifuged at 4000 rpm for 2 minutes to obtain bacterial precipitation. The supernatant was discarded, and the precipitate was resuspended with the remaining supernatant and dropped onto an agarose plate containing the corresponding resistance of the plasmid, divided into four zones, and inverted and placed in a 37°C incubator for overnight culture.

[0044] (2) Use the plasmid extraction kit of Beijing Tiangen Biochemical Technology Co., Ltd. to extract the plasmid. The plasmid extraction method is as follows: Pick the monoclonal strain obtained by the above transformation and place it in 5 mL of LB containing the corresponding resistance for overnight culture. The operation steps are as follows: 1. Column balancing step: Add 500ul of balancing solution BL to the adsorption column CP3 (the adsorption column is placed in the collection tube), centrifuge at 12,000rpm (~13,400Xg) for 1min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube. (Please use the column that has been processed on the same day) 2. Take 5 mL of overnight cultured bacterial solution and add it to a centrifuge tube. Use a regular desktop centrifuge and centrifuge at 12000rpm (~13400xg) for 1 min. Remove the supernatant as much as possible (if there is a lot of bacterial solution, you can collect the bacterial precipitate into one centrifuge tube through multiple centrifugation).

[0045] 3. Add 250 μL of solution P1 (RNase A must be added first) to the centrifuge tube with bacterial pellets, and use a pipette or vortex oscillator to thoroughly suspend the bacterial pellet. Note: If there are bacterial lumps that are not thoroughly mixed, it will affect lysis, resulting in low extraction volume and purity.

[0046] 4. Add 250 μL of solution P2 to the centrifuge tube and gently turn it upside down 6-8 times to fully lyse the bacteria. Note: Mix gently and do not shake violently to avoid interrupting the genomic DNA and causing the extracted plasmid to be mixed with genomic DNA fragments. At this time, the bacterial solution should become clear and viscous. The time used should not exceed 5 minutes to avoid damage to the plasmid. If it does not become clear, it may be due to excessive bacteria and incomplete lysis. The amount of bacteria should be reduced.

[0047] 5. Add 350μL of solution P3 to the centrifuge tube, and immediately and gently turn it upside down 6-8 times to mix thoroughly. A white flocculent precipitate will appear. Centrifuge at 12000 rpm (~13400xg) for 10 min. Note: Mix immediately after adding P3 to avoid local precipitation. If there is still a tiny white precipitate in the supernatant, centrifuge again and take the supernatant.

[0048] 6. Use a pipette to transfer the supernatant collected in the previous step to the adsorption column CP3 (the adsorption column is placed in the collection tube). Be careful not to suck out the precipitate. Centrifuge at 12000 rpm (~13400Xg) for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CP3 in the collection tube.

[0049] 7. Add 600 μL of rinsing solution PW (anhydrous ethanol must be added first) to the adsorption column CP3, centrifuge at 12000 rpm (~13400xg) for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CP3 in the collection tube.

[0050] 8. Repeat step 7.

[0051] 9. Place the adsorption column CP3 in the collection tube and centrifuge at 12000 rpm (~13400xg) for 2 minutes to remove the residual rinse solution in the adsorption column. Note: Residual ethanol in the rinse solution will affect subsequent enzyme reactions (enzyme digestion, PCR, etc.). To ensure that downstream experiments are not affected by residual ethanol, it is recommended to open the adsorption column CP3 and place it at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material.

[0052] 10. Place the adsorption column CP3 in a clean centrifuge tube, add 50-100 μL of elution buffer EB to the middle part of the adsorption membrane, place at room temperature for 2 min, and centrifuge at 12000 rpm (~13400xg) for 2 min to collect the plasmid solution into the centrifuge tube. Note: The volume of the elution buffer should not be less than 50 μL. Too small a volume will affect the recovery efficiency. The pH value of the elution buffer has a great influence on the elution efficiency. If sequencing is performed later, ddH2O should be used as the elution buffer, and its pH value should be within the range of 7.0-8.5. A pH value lower than 7.0 will reduce the elution efficiency. The DNA product should be stored at -20°C to prevent DNA degradation. In order to increase the recovery rate of the plasmid, the obtained solution can be added back to the adsorption column, placed at room temperature for 2 min, centrifuged at 12000 rpm (~13400xg) for 2 min, and the plasmid solution can be collected into a centrifuge tube.

[0053] (3) The plasmid extracted above was digested with a single restriction site enzyme (BspQI, purchased from Hongene Biotech) according to the enzyme instructions to linearize the plasmid. The linearization method is as follows: 1. In ice water, mix the following reaction components in the given order: 1 μg of DNA, 5 μL of 10x Cut buffer, 10 units of BspQI, and make up the total volume of the reaction components to 50 μL.

[0054] 2. Incubate at 50°C for 60 min.

[0055] 3. Keep at 80℃ for 2 min to inactivate the enzyme.

[0056] (4) The linearized plasmid was purified and recovered using a common DNA product purification kit (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.). The recovery method is as follows: 1. Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400 x g) for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube (use the column treated on the same day).

[0057] 2. Estimate the volume of the enzyme digestion reaction solution, add 5 times the volume of Binding Solution PB to it, and mix thoroughly (no need to remove paraffin oil or mineral oil). Note: If the PCR reaction system is 50μL (excluding the volume of paraffin oil), add 250μL of Binding Solution PB.

[0058] 3. Add the solution obtained in the previous step to an adsorption column CB2 (the adsorption column is placed in the collection tube), place it at room temperature for 2 minutes, centrifuge it at 12000 rpm (~13400xg) for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube. Note: The volume of the adsorption column is 800μL. If the sample volume is greater than 800μL, it can be added in batches.

[0059] 4. Add 600 μL of rinse solution PW (add anhydrous ethanol before use) to the adsorption column CB2, centrifuge at 12000 rpm (~13400xg) for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube.

[0060] 5. Repeat step 4.

[0061] 6. Place the adsorption column CB2 back into the collection tube and centrifuge at 12000 rpm (~13400xg) for 2 min to remove as much rinse solution as possible.

[0062] Place the adsorption column CB2 at room temperature for several minutes to dry it thoroughly to prevent the residual rinsing solution from affecting the next experiment.

[0063] (5) The linearized plasmid was transcribed in vitro and capped using the T7 in vitro transcription kit (purchased from Hongene Biotech) to generate a large amount of RNA. The in vitro transcription method is as follows: 1. The following amounts are suitable for a single 22 μL reaction system; the reaction system is as follows: 2 μL of 100 mM ATP solution, 2 μL of 100 mM GTP solution, 2 μL of 100 mM CTP solution, 2 μL of 100 mM N1-Me-pUTP solution (purchased from Hongene Biotech) 2 μL, 100 mM (3'-OMe-m 7 G)(5') ppp(5')(2'-OMeA)pG solution (purchased from hongene biotech) 2μL, DNA template 1μg, 5x Reaction Buffer 4μL, Enzyme Mix 1.5μL, and nuclease-free water to make up to 22μL.

[0064] 2. Mix well and incubate at 37°C for 2 hours.

[0065] 3. Add 1 μL DNase I (RNase-free, purchased from Hongene Biotech), mix well and incubate at 37 ° C for 30 minutes.

[0066] (6) Purify RNA using the zymo RNA clean&concentrator kit. The purification method is as follows: 1. Add 2 volumes of RNA binding buffer to the RNA EP tube obtained above and mix well.

[0067] 2. Add an equal volume of ethanol (95-100%) and mix well.

[0068] 3. Transfer the sample to Zymo-SpinTM IICR chromatographic column 3 and centrifuge at 10000g-16000g for 30-60s. Discard the flow-through.

[0069] 4. Add 400 μL RNA preparation buffer to the column and centrifuge at 10000g-16000g for 30-60s. Discard the flow-through.

[0070] 5. Add 700 μL RNA cleaning buffer to the column and centrifuge at 10000g-16000g for 30-60s. Discard the flow-through.

[0071] 6. Add 400 μL RNA washing buffer to the column and centrifuge at 10000g-16000g for 1 minute to ensure that the washing buffer is completely removed. Carefully transfer the column to an RNase-free tube.

[0072] 7. Add 50 μL of DNase / RNase-free water directly to the column matrix and centrifuge.

[0073] The eluted RNA can be used immediately or stored frozen. The synthetic purified RNA is subjected to nucleic acid gel electrophoresis to ensure its integrity and purity. The results are as follows Figure 2 The results showed that the nucleic acid gel electrophoresis experiment showed a single band after enzyme digestion and in vitro transcription and purification.

[0074] (7) Preparation and preparation of LNP reagent: The raw materials SM-102 lipid, DOPE lipid, cholesterol, and PEG lipid (DMG-PEG2000) were purchased from TargetMol. First, prepare a stock solution of each lipid component in ethanol. The stock solution concentration of each lipid except SM-102 is 10 mg / mL, and SM-102 is 25 mg / mL. The molar amount of SM-102 should be determined based on the ratio of N (amine group in ionizable lipid) to P (phosphorus group in RNA) of 6:1. The molar ratio of SM-102 to other lipids is SM-102: DOPE: cholesterol: PEG lipid = 50: 10: 38.5: 1.5; mix the four lipid components together and add a certain amount of ethanol to obtain the LNP reagent. Reach a final volume of 300 μL of organic phase in the EP tube.

[0075] (8) Encapsulating the RNA obtained above with an LNP reagent, as follows: 1. Prepare the aqueous phase by mixing the RNA solution with citrate buffer in a 4 mL vial equipped with a magnetic stirrer. The final volume of the aqueous phase should be 900 μL, and the concentration of citrate buffer in the aqueous phase should be 50 mM; make sure to use RNase-free water to dilute the RNA and citrate buffer.

[0076] 2. Place the 4 mL vial containing the aqueous phase on a magnetic stirrer set at 1000 rpm. Using a 200 μL pipette, flush the lipid mixture prepared above into the center of the turbulence created by stirring. Stir the mixture for 5 minutes and then incubate at room temperature for another 5 minutes.

[0077] 3. Transfer the prepared mixture to a dialysis kit. The mixture was dialyzed in PBS (>1L) for 4 hours at 4°C with magnetic stirring. After dialysis, the preparation was concentrated at 5000rcf using an Amicon ultracentrifugal filter (2mL MWCO 10KDa) until the desired volume was reached to obtain the mRNA-LNP vaccine or circRNA-LNP vaccine. The mRNA-LNP or circRNA-LNP was stored at 4°C until they were ready for use.

[0078] Example 2: The mRNA-LNP vaccine and circRNA-LNP vaccine prepared above were expressed intracellularly, and the specific method was as follows: 1. Plate: Hela cells were plated at 1×10 4 The cells were plated into a 24-well plate with a slide and transfected when the cell confluence reached 60-80%. mRNA was added to each well with a final dose of 1µg / well using the commercially available Lipofectamine MessengerMAX transfection kit. The plates were placed in an incubator at 37°C with 5% CO2 and incubated for 24 hours.

[0079] 2. Discard the culture medium in each well and wash once with PBS. Add 500 μL of 4% paraformaldehyde to each well to fix the cells at room temperature for 15 minutes. Then wash the cells three times with PBS.

[0080] 3. Add 0.2% TritonX-100 to each well and permeabilize the membrane for 15 minutes at room temperature. Then wash 3 times with PBS. 4. Add 500 μL of 4% goat serum to each well for blocking and incubate at room temperature for 30 minutes.

[0081] 5. Add 100 μL of primary antibody (primary antibody diluted 1:500) to each well and incubate at room temperature for 1 hour. Then wash 3 times with PBS.

[0082] 6. Add 100 μL of secondary antibody (diluted 1:1000) to each well and incubate at room temperature for 1 hour. Then wash 3 times with PBS.

[0083] 7. Add 300 μL of hochest (1:5000 dilution) to each well and incubate at room temperature for 10 minutes. Wash three times with PBS.

[0084] 8. Drop a drop of anti-fluorescence quencher on the slide, place the slide on the quencher, and seal the slide with sealing liquid.

[0085] 9. Place the slide under a fluorescence microscope for observation. Figure 3 and Figure 4 The experimental results show the expression of RNA in cells (blue is the nucleus and red is the protein).

[0086] Example 3: This example provides a method for preparing a DNA-LNP vaccine of KP ompA: (1) Extract genomic DNA of Klebsiella pneumoniae standard strain 35657.

[0087] (2) Design specific primers based on the above-mentioned known Klebsiella pneumoniae surface membrane protein gene sequence.

[0088] The primer sequences are as follows: F1: CAGGGCGTTCAGCTGACC (as shown in the sequence list SEQ ID NO.6); R1: TTAAGCCGCCGGCTGAGTTAC (as shown in the sequence list SEQ ID NO.7).

[0089] (3) Perform PCR amplification to obtain the target gene fragment, and send it to Kumei Biotechnology Co., Ltd. for sequencing to confirm that the base sequence is correct. The PCR amplification system and procedure are shown in Table 1 and Table 2 respectively.

[0090]

[0091] (4) LNP encapsulation. Encapsulate the DNA fragments using the RNA encapsulation method in Example 2 to obtain a DNA-LNP vaccine. Store the DNA-LNPs at 4°C until they are ready for use.

[0092] Experimental results: The target gene fragment was obtained by PCR amplification and sequenced correctly. The results of nucleic acid gel electrophoresis experiment are as follows Figure 5 shown.

[0093] Example 4: This example provides a method for preparing a KP ompA protein vaccine: (1) Extract Klebsiella pneumoniae genomic DNA.

[0094] (2) Design specific primers based on the above-mentioned known Klebsiella pneumoniae surface membrane protein gene sequence (F2 = protective base GA + restriction site bgl II + KP ompA sequence, R2 = protective base ACGC + restriction site SalI + KP ompA sequence).

[0095] The primer sequences are as follows: F2: GAAGATCTCAGGGCGTTCAGCTGACC (as shown in the sequence listing SEQ ID NO.8); R2: ACGCGTCGACTTAAGCCGCCGGCTGAGTTAC (as shown in the sequence listing SEQ ID NO.9).

[0096] (3) Perform PCR amplification to obtain the target gene fragment. The implementation method is the same as Example 3.

[0097] (4) The target gene fragment is digested by enzymes, and after digestion, it is connected with the prokaryotic vector pet28a that has been double-digested with enzymes (BamHI, SalI) to construct a prokaryotic vector for protein purification. Since the KPompA fragment contains a BamHI digestion site, if BamHI is used for digestion, the BamHI enzyme will chop up the target gene fragment. To avoid this situation, the embodiment of the present invention uses BglII with the same sticky ends as BamHI instead of BamHI and SalI for double digestion, and the target gene fragment after digestion is recovered using the above-mentioned common DNA product purification kit. After recovery, it is connected with pet28a that has been double-digested with enzymes (BamHI, SalI).

[0098] The enzyme digestion method is as follows: the enzyme needs to be shaken and mixed before use, and the enzyme digestion system can be multiplied as needed. The enzyme digestion system is shown in Table 3 (then placed in a 37°C incubator for 6-18 hours).

[0099] The connection system is shown in Table 4. The connection product is placed in a 16°C metal bath overnight for connection:

[0100] (5) The recombinant plasmid KpompA-Pet28a was transformed into DH5α. The transformation method is shown in Example 1. On the second day, a single clone was selected for colony PCR verification.

[0101] The colony PCR system is shown in Table 5. After mixing and shaking, PCR is performed:

[0102] The colony PCR program is shown in Table 6:

[0103] Positive clones were picked for shaking and preservation (200 μL 50% glycerol + 800 μL bacterial solution), and the remaining bacterial solution was used to extract plasmids, which were then sent to Kumei Biotechnology Co., Ltd. for sequencing.

[0104] Experimental results: The results of nucleic acid gel electrophoresis of PCR products are as follows Figure 6 As shown in the figure, the nucleic acid gel electrophoresis results of the bacterial batch product are as follows Figure 7 shown.

[0105] (6) Transform the correctly sequenced plasmid into Rosetta (DE3) competent cells, pick a single clone and put it into 5 ml LB containing kanamycin resistance. Add the overnight cultured bacterial solution to 1L LB containing kanamycin resistance at a ratio of 1:200. Add 200mM IPTG and induce expression at 18℃ overnight. Collect the bacterial precipitate from 1L bacterial solution using a high-speed floor centrifuge, and crush the bacterial precipitate using a poly cell disruptor. Purify the protein by methods such as his tag affinity chromatography.

[0106] The method for purifying the protein is as follows: Experimental Materials: Ni-NTA resin: used for purification of His-tagged proteins (purchased from QIAGEN, catalog number 124114376).

[0107] Buffer: Lysis buffer: 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 10 mM imidazole, 1 mM PMSF, 1 mg / mL lysozyme.

[0108] Wash buffer: 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 20 mM imidazole.

[0109] Elution buffer: 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 250 mM imidazole.

[0110] Dialysis buffer: 50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 10% glycerol.

[0111] Chromatography column: used to pack Ni-NTA resin.

[0112] SDS-PAGE reagent: used to detect protein purity.

[0113] Dialysis bags and dialysis buffer: used to remove imidazole.

[0114] Experimental steps: (1) Cell lysis Collect cells: Centrifuge the cells expressing the target protein (such as Rosetta) (4000 rpm, 10 min, 4°C) and discard the supernatant.

[0115] Resuspend cells: Resuspend the cell pellet in lysis buffer.

[0116] Lyse cells: Use a cell disruptor to disrupt the cells.

[0117] Centrifugation: Centrifuge the lysate (12000 rpm, 30 min, 4°C) and collect the supernatant (containing soluble protein).

[0118] (2) Preparation of Ni-NTA resin Column packing: Load Ni-NTA resin into the chromatography column and equilibrate the column with lysis buffer (at least 5 column volumes).

[0119] Sample loading: Slowly add the supernatant of cell lysate to the chromatography column and control the flow rate (1 mL / min).

[0120] Collect the flow-through: Collect the flow-through for subsequent analysis.

[0121] (3) Washing Wash non-specifically bound proteins: Wash the column with wash buffer (at least 10 column volumes) to remove unbound proteins.

[0122] Collect wash solution: Collect the wash solution for later analysis.

[0123] (4) Elution Elution of target protein: Elute the target protein with elution buffer (5 column volumes) and collect the eluate (1 mL per tube).

[0124] Protein detection: Detect the target protein in the eluate by SDS-PAGE.

[0125] (5) Dialysis Removal of imidazole: Place the eluate into a dialysis bag and dialyze in dialysis buffer (4°C, 12-24 hours) to remove imidazole.

[0126] Buffer exchange: Change the dialysis buffer every 4-6 hours.

[0127] (6) Protein concentration determination Bradford method: Determine the concentration of purified protein.

[0128] SDS-PAGE analysis: to detect protein purity and molecular weight, such as Figure 8 shown.

[0129] Western blot analysis: Use His tag antibody to verify the target protein, such as Fig. 9 shown.

[0130] (7) Take 5 μg of purified protein and mix it with an equal volume of complete Freund's adjuvant for the first immunization, and mix it with an equal volume of incomplete Freund's adjuvant for the second and third immunizations to immunize mice.

[0131] Example 5: Animal experiments were conducted on the vaccine prepared above, as follows: Animal grouping: Control group: received 50 μL of PBS. Vaccine experimental group: received 50 μL of 10 μg DNA-LNP, 50 μL of 10 μg mRNA-LNP, 50 μL of 10 μg circRNA-LNP, and 50 μL of 5 μg purified KP-ompA protein.

[0132] Immunization dose and route: Route: intramuscular injection (im) and / or intranasal inoculation (in).

[0133] Immunization time: Standard protocol: First immunization: im, time point is day 0 (prime). Second immunization: im, time point is day 14 (boost). Third immunization: im or in, time point is day 28 (boost). Blood was collected through the eye socket 14 days after the last immunization, and the lungs and spleen of the mice were dissected.

[0134] Cellular immunity experiments and humoral immunity experiments were performed. All materials required for cellular immunity can be purchased from Thermo Fisher Scientific; the cellular immunity method is as follows: 1. Preparation of single cell suspension from lung / spleen / blood 1. Obtain all lung / spleen tissues: Wash the mouse lung / spleen in a culture dish containing 5-10 mL 2% FCS (DPBS + 2% FBS) buffer, then place in a 1 mg / mL collagenase D and 0.1 mg / mL (100U / mL) DNase I buffer (dissociation medium) prepared with 2% FCS and place on ice (for spleen processing, skip to step 3 directly, and for blood processing, skip to step 4 directly).

[0135] 2. Place the lung tissue in a six-well plate, cut the lung into paste in the six-well plate, transfer the chopped lung tissue and dissociation medium into a 15 mL tube with a pipette, and make up to 5 mL with dissociation medium. Cover tightly and incubate at 37°C for 45 minutes (100-150rpm). Add 5 mL of pre-cooled DPBS to terminate the reaction.

[0136] 3. Pre-wet the filter with 5 mL 2% FCS and a 15 mL centrifuge tube. Place the tissue on the cell strainer, which is placed in a 15 mL centrifuge tube. Use a 1 mL syringe plunger to gently grind the homogenate and filter the cell suspension. Rinse the mesh with 5 mL DPBS.

[0137] 4. Centrifuge at 300xg for 5 minutes at room temperature, carefully remove the centrifuge tube and discard the supernatant.

[0138] 5. Resuspend the cells in 2 mL of pre-cooled 1X red blood cell lysis buffer. Incubate at room temperature for 5 minutes, shaking occasionally, and stop with 10 mL of cold DPBS. Centrifuge at 400g for 5 minutes at 4°C and discard the supernatant.

[0139] 6. Resuspend in 1 mL DPBS in a 1.5 ml EP tube and wash once. Resuspend in 1 mL DPBS and count the cells. Adjust the final cell concentration to 1 × 10 7 cells / mL, transfer the cell suspension to a 1.5mL centrifuge tube, 100uL / tube, the final cell concentration is 1×10 6 Add DPBS to make up to 1 mL and prepare for staining live and dead cells.

[0140] 2. Stain for Live / Dead: Thaw the dye vial and dilute the LIVE / DEAD fixable dead cell stain by adding 50 µL DMSO to the vial.

[0141] 1. Add 1 µL of diluted stain to every 1 mL of cells; mix the cells and stain and incubate at 4°C in the dark for 30 minutes.

[0142] 2. Wash the cells twice with 1 mL of flow cytometry buffer, 400 g for 5 min.

[0143] 3. Antibody blocker blocks Fc-mediated nonspecific staining (before use, quickly centrifuge the antibody to restore the maximum volume): Pre-incubate CD16 / CD32 antibody at 1uL / 50 μL sample at 4°C / on ice for 15 minutes.

[0144] IV. Surface antigen staining (Before use, quickly centrifuge the antibody to recover the maximum volume. All cell staining operations should be performed on ice or at 4°C and away from light as much as possible.) Add 50 μL of cell suspension (1×10 6 cells).

[0145] 1. Cd45 Cd4 Cd8a cd69 cd103: 2.5μL Cd45 (0.5μg / test 0.2mg / mL), 0.5μL Cd4 (0.25μg / test 0.5mg / mL), 2.5μL Cd8a (0.5μg / test 0.2mg / mL), 5μL Cd103 (1μg / test 0.2mg / mL), 1.25μL Cd69 (0.25μg / test 0.2mg / mL), vortex gently to mix. Incubate at 4℃ / on ice, away from light for 30 minutes.

[0146] 2. Wash the cells with 1 mL / tube of flow cytometry staining buffer. Centrifuge at 500 x g for 5 minutes at room temperature. Discard the supernatant. Wash twice. Discard the supernatant of the last wash, retain 100 μL of residual volume, pulse vortex to mix the sample (completely dissociate cell clumps), and put it on the flow cytometer to count the positive cells.

[0147] The experimental results are as follows Fig.10 As shown: CD62-CD44+ indicates the presence of effector T cells. This experiment proves that vaccine immunization of mice can produce effector T cells against Klebsiella pneumoniae.

[0148] Blood was collected from the eye sockets, centrifuged at 12000rpm and 4℃, and the supernatant was tested by Elisa. The method of Elisa testing antibody titer is as follows: 1. Coating: Dilute the purified antigen with coating solution to a concentration of 10 μg / well, add 100 μL per well to a 96-well ELISA plate, and incubate overnight at 4°C. The next day, discard the coating solution and wash the plate 3 times with washing solution, soaking for 1-2 minutes each time.

[0149] 2. Blocking: Add 200 μL of blocking solution to each well and incubate at 37°C for 1 hour. Discard the blocking solution and wash the plate 3 times with washing solution, soaking for 1-2 minutes each time.

[0150] 3. Sample addition: dilute the antibody serum to be tested by a certain multiple, add 100 μL to each well of the blocked ELISA plate. Incubate at 37°C for 1 hour, wash the plate 3 times with washing solution, soaking for 1-2 minutes each time.

[0151] 4. Add enzyme-labeled antibody: dilute the HRP-labeled antibody with blocking solution to 1:2500, add 100 μL to each well, incubate at 37°C for 1 hour, wash the plate 3 times with washing solution, soak for 1-2 minutes each time.

[0152] 5. Color development: Add 100 μL TMB substrate solution to each well and incubate at 37°C in the dark for 15-30 minutes. Add 50 μL stop solution to each well to terminate the color development reaction.

[0153] 6. Determination: Use an enzyme-labeled instrument to measure the absorbance (OD) value of each well at a wavelength of 450 nm.

[0154] Elisa tests were performed on the experimental group (adding mRNA-LNP) and the control group (adding PBS) according to the above method. The results are as follows Fig.11 As shown; the results showed that the IgG in the experimental group was significantly higher than that in the control group.

[0155] After immunization, the mice in the above groups were challenged with Klebsiella pneumoniae to observe the protective effect of the vaccine on the mice. The results are as follows: Fig.12 As shown; the results showed that the PBS group had a higher mortality rate after Klebsiella pneumoniae infection than the vaccinated mice.

[0156] The present invention demonstrates that membrane protein-specific antibodies can protect mice from virulent Klebsiella pneumoniae and provide evidence for mRNA-LNP or circRNA-LNP vaccine platforms for the treatment and prevention of Klebsiella pneumoniae. These findings are of great importance considering the global antibiotic resistance crisis and the lack of effective vaccine candidates.

[0157] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Use of a Klebsiella pneumoniae surface membrane protein in the preparation of a drug or vaccine for preventing and treating Klebsiella pneumoniae infection, characterized in that: The target sequence of the Klebsiella pneumoniae surface membrane protein is shown in the sequence table SEQ ID NO.

3.

2. A vaccine for preventing and treating Klebsiella pneumoniae infection, characterized in that: The vaccine is prepared through the nucleotide sequence of the surface membrane protein of Klebsiella pneumoniae; the vaccine is a combination of any one or more of a DNA vaccine, an RNA vaccine and a protein vaccine; the target sequence of the surface membrane protein of Klebsiella pneumoniae is shown in the sequence table SEQ ID NO.

3.

3. The vaccine for preventing and treating Klebsiella pneumoniae infection according to claim 2, characterized in that: The vaccine is prepared by constructing an mRNA plasmid or a circRNA plasmid based on a nucleotide sequence encoding the Klebsiella pneumoniae surface membrane protein.

4. The vaccine for preventing and treating Klebsiella pneumoniae infection according to claim 3, characterized in that: The nucleotide sequence of the mRNA plasmid is shown in the sequence list SEQ ID NO.4; the nucleotide sequence of the circRNA plasmid is shown in the sequence list SEQ ID NO.

5.

5. The vaccine for preventing and treating Klebsiella pneumoniae infection according to claim 3, characterized in that: The preparation method of the vaccine comprises the following steps: Inserting the target sequence of the Klebsiella pneumoniae surface membrane protein into the CDS region of the mRNA vector or circRNA vector to obtain an mRNA plasmid or a circRNA plasmid; The mRNA plasmid or circRNA plasmid is transformed into competent cells, and the plasmid is extracted, and then the extracted plasmid is linearized to obtain a linearized plasmid; The linearized plasmid was transcribed in vitro to generate RNA; The RNA is encapsulated with a pharmaceutical carrier to obtain the vaccine.

6. The vaccine for preventing and treating Klebsiella pneumoniae infection according to claim 5, characterized in that: The pharmaceutical carrier includes any one or more combinations of lipid nanoparticles, polymer nanoparticles, inorganic nanoparticles, solid lipid nanoparticles, nanoemulsions and exosomes.

7. The vaccine for preventing and treating Klebsiella pneumoniae infection according to claim 2, characterized in that: The administration of the vaccine includes one or more combinations of intramuscular injection, subcutaneous injection, intradermal injection, intravenous injection, oral administration, intranasal administration, respiratory tract administration, transdermal administration, and lymph node targeted administration.

8. The vaccine for preventing and treating Klebsiella pneumoniae infection according to claim 2, characterized in that: The dosage forms of the vaccine include one or more combinations of injection forms, oral forms, nasal forms, respiratory forms, transdermal forms, multiple-dose forms, single-dose forms, single-dose vials, needle-free forms and nanoparticle forms.

Images