Silica membrane purification column for bacteria enrichment and enrichment method

Abstract

The invention discloses a silica gel membrane purification column for bacterium enrichment and an enrichment method. The silica gel membrane purification column comprises a centrifugal tube, a central tube, a sealing ring and a silica gel membrane layer, and the centrifugal tube serves as a container and is used for storing centrifuged filtrate; the central tube is erected in the centrifugal tube; an opening is formed in the lower end of the central tube; the silica gel film layer is laid on the opening in the lower end of the central tube, the number of layers of silica gel films in the silica gel film layer is 8-10, and the aperture of each silica gel film is 1 micron; and the sealing ring is arranged in the central pipe and is pressed on the silica gel film layer. The silica gel membrane purification column can realize effective enrichment and lysis detection of bacteria, after 10 layers of silica gel membranes are overlapped, an interception effect with the aperture smaller than or equal to 0.22 mu m can be formed, the silica gel membrane purification column is easily combined with DNA, bacterial cell lysis and extraction are carried out on the membranes, the detection sensitivity of the bacteria can be remarkably improved, and the detection sensitivity of the bacteria can be remarkably improved. The method not only can be used for enrichment and DNA extraction of bacteria, but also is suitable for enrichment and DNA extraction of fungi.

Description

Technical Field

[0001] The invention relates to the field of bacteria detection, and in particular to a silica gel membrane purification column for bacteria enrichment and an enrichment method. Background Art

[0002] Bacterial DNA detection technology is currently one of the important means of detecting and identifying bacteria. Since bacteria are everywhere, and many bacteria have strong resistance to various environments that are not conducive to their own growth, such as drug resistance, salt and alkali resistance, acid and alkali resistance, disinfectant resistance, etc., the existence of bacteria will more or less have a certain impact on our production and life. Therefore, we need to perform limit detection on various bacteria in our daily production and life. If bacterial contamination exceeds a certain limit, it may cause great risks and harm to product safety and human health.

[0003] At present, the research and development of many bacterial detection technologies are mostly concentrated in the detection stage, such as by designing specific primers, using a high-temperature resistant DNA polymerase (Taq DNA Polymerase) or a constant temperature amplified DNA polymerase (Bst DNA Polymerase) to detect the presence or absence of the target nucleic acid molecule to determine whether the bacteria exist, or by using specific antibodies to identify the specific antigens of the bacteria and then determine whether the sample to be tested is contaminated with bacteria. However, these methods have a common defect, that is, the efficiency of early bacterial enrichment will seriously affect the accuracy of the later detection results. Currently commonly used bacterial enrichment methods include high-speed centrifugal precipitation, antibody-magnetic bead enrichment, membrane filtration, etc. These methods can effectively enrich the bacteria in the sample to be tested to a certain extent, so as to improve the extraction efficiency of nucleic acids and avoid missed detection.

[0004] As for the enrichment method, many detection kits use high-speed centrifugation precipitation, which is the most commonly used method. However, this method is more effective for samples with high bacterial content, but it cannot effectively precipitate and enrich bacteria for samples with extremely low bacterial content (such as <100 CFU / mL) and liquids with high viscosity. The applicability of the antibody-magnetic bead enrichment method is relatively limited, and it can only be used for enrichment detection of certain specific bacteria. If other unknown types of bacteria are mixed in the sample to be tested, they cannot be effectively detected. The membrane filtration method is an extremely effective bacterial enrichment method currently specified in the pharmacopoeia. After the sample passes through a sterile filter membrane with a certain pore size (≤0.22μm or ≤0.1μm), the bacteria in the sample to be tested are retained on the filter membrane, and then the filter membrane is placed on a specific culture medium for culture to observe whether there is a bacterial monoclonal colony to determine whether it contains bacteria. However, this method takes too long to culture, which is not conducive to the rapid and convenient detection of a large number of different samples, and the bacteria adsorbed on the filter membrane are difficult to be washed off, and the bacteria cannot be detected by extracting nucleic acids. Therefore, the bacterial nucleic acid extraction reagents currently available on the market have limited effects on enriching extremely small amounts of bacteria and cannot meet the needs of enriching and rapidly detecting extremely small amounts of bacteria. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a silica gel membrane purification column for bacteria enrichment and an enrichment method.

[0006] In order to solve the above technical problems, the present invention adopts the following technical solutions to achieve the above problems:

[0007] A silica gel membrane purification column for bacterial enrichment comprises a centrifuge tube, a central tube, a sealing ring and a silica gel membrane, wherein:

[0008] The centrifuge tube is used as a container to store the filtrate after centrifugation;

[0009] The central tube is mounted in the centrifuge tube, and an opening is provided at the lower end of the central tube;

[0010] The silica gel membrane is laid on the opening at the lower end of the central tube, and the central tube with the silica gel membrane is used to store the sample before centrifugation; the pore size of the silica gel membrane is 1 μm, and the number of layers of the silica gel membrane is 8 to 10;

[0011] The sealing ring is arranged in the central tube, and the friction between the sealing ring and the inner wall of the central tube ensures its stability, so that the sealing ring can fix the silicone membrane to ensure that it does not move or fall off during the centrifugation process.

[0012] The present invention utilizes the minimum cross-sectional length of bacteria (>0.22 μm) and uses filter pores smaller than bacteria to intercept bacteria, so that the bacteria are enriched on the silica gel membrane. After filtering bacteria using this method, the bacteria will be tightly bound to the silica gel membrane and will not be washed away by the liquid to cause bacterial body loss, which will lead to a large error in subsequent DNA extraction. After a large number of experimental verifications, the present invention can intercept bacteria as low as 1 CFU on the silica gel membrane, and the filtrate does not contain any bacteria at all, which has a greater enrichment advantage.

[0013] In order to get rid of the shortcomings of silica gel membrane filtration method that enriches bacteria but cannot be effectively eluted, in the subsequent operation, the bacteria trapped on the silica gel membrane after passing through the multi-layer silica gel membrane are directly lysed and eluted in situ on the silica gel membrane. We have improved the DNA extraction method for Gram-positive bacteria and Gram-negative bacteria so that it can detect Gram-positive bacteria and Gram-negative bacteria at the same time. The specific method is:

[0014] 1. Bacterial enrichment: We took 1 mL of the liquid to be tested and added it to the silica gel membrane purification column, centrifuged it at room temperature at 13000×g for 1 min, and removed the filtrate;

[0015] 2. Pretreatment: Take solution A, melt and mix at room temperature, add 100 μL of melted solution A to each silica gel membrane purification column, and incubate at 50°C for 30 min. Solution A contains the following components at final concentrations: Tris-HCl (pH=6.0) 10 mM, EDTA 1 mM, NaCl 150 mM, lysozyme 20 mg / mL, mix well, and divide into small portions, and freeze at -20°C;

[0016] 3. Lysis: Take 400 μL of solution B and add it to each silica gel membrane purification column, incubate at room temperature for 2 minutes to lyse the cells and fully release the DNA so that the DNA binds to the silica gel membrane; solution B includes the following components with final concentrations: guanidine thiocyanate solution 4.5 mol / L, sodium acetate solution 0.2 mol / L, pH = 4.8; when preparing, guanidine thiocyanate and sodium acetate are mixed and dissolved, and then acetic acid is used to adjust the pH to 4.8;

[0017] 4. Binding: In order to ensure that the bacterial DNA can fully bind to the silica membrane, we also need to add 250 μL of isopropanol to the silica membrane purification column to promote the binding of a very small amount of DNA to the silica membrane. After gently mixing, let it stand at room temperature for 1 minute, then centrifuge at room temperature for 1 minute at 13,000 × g, and remove the filtrate.

[0018] 5. Washing: Take 600 μL of solution C and add it to the silica gel membrane purification column, centrifuge at room temperature 13000×g for 1 min, remove the filtrate, and repeat this twice; solution C: Tris-HCl (pH=7.5) 10 mM, 80% ethanol;

[0019] 6. Elution: Add sterile water to the silica membrane purification column, centrifuge at 13000×g for 1 min at room temperature to elute the DNA for PCR or qPCR detection.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The silica gel membrane purification column of the present invention can realize effective enrichment and lysis detection of bacteria by stacking 8 to 10 layers of silica gel membranes. Although the pore size of each layer of silica gel membrane is about 1 μm, after 10 layers are stacked, it finally forms a structure with a pore size of ≤0.22 μm and realizes the interception effect of the membrane filtration method. In addition, it is a silica gel membrane that is easy to bind to DNA. Directly lysing and extracting bacterial cells on this membrane will significantly improve the detection sensitivity of bacteria. This method can be used not only for bacterial enrichment and DNA extraction, but also for fungal enrichment and DNA extraction. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a schematic diagram of the structure of the silica gel membrane purification column of the present invention;

[0023] Figure 2 The bacterial retention effect of Staphylococcus aureus after different filtration times, from left to right are the filtrate after 3 filtrations, the filtrate after 1 filtration and the culture colony of the original bacterial solution;

[0024] Figure 3 The retention and enrichment effects of the silica membrane purification column on bacteria at different dilution multiples; the upper picture from left to right is 10 -8 , 10 -7 , 10 -6 The colony images of the bacterial suspension diluted 10 times; the lower image from left to right is 10 -8 , 10 -7 , 10 -6 Culture colony image of the filtrate after filtering the bacterial suspension diluted by times;

[0025] Figure 4 For silica gel membrane purification column 10 -5 The culture colonies of the original bacterial solution (left) and the filtrate (right) of the E. coli diluted by 100 times;

[0026] Figure 5 This is a diagram showing the effect of E. coli DNA extraction at different dilution multiples detected by qPCR;

[0027] Figure 6 For silica gel membrane purification column 10 -6 Culture colonies of the original bacterial solution (left) and filtrate (right) of Staphylococcus aureus diluted 100 times;

[0028] Figure 7This is a diagram showing the effect of DNA extraction of Staphylococcus aureus at different dilution multiples detected by qPCR;

[0029] Figure 8 For silica gel membrane purification column 10 -6 The culture colony images of the original bacterial solution (right) and the filtrate (left) of Bacillus subtilis diluted by 100 times;

[0030] Fig. 9 This is a diagram showing the effect of DNA extraction of Bacillus subtilis at different dilution multiples detected by qPCR;

[0031] In the figure: 1-centrifuge tube, 2-center tube, 3-sealing ring, 4-silicone membrane. DETAILED DESCRIPTION

[0032] In order to allow those skilled in the art to understand the present invention more clearly and intuitively, the present invention will be further described below in conjunction with the accompanying drawings.

[0033] Example 1

[0034] The present invention is based on the original silica gel membrane purification column structure, and a commercially available silica gel membrane with a pore size of 1 μm is laid in a central tube with 10 layers of silica gel membrane to efficiently enrich a large amount or a very small amount of bacteria.

[0035] like Figure 1 As shown, the structure of the silica gel membrane purification column includes a centrifuge tube 1, a central tube 2, a sealing ring 3 and a silica gel membrane 4, wherein:

[0036] The centrifuge tube 1 is used as a container to store the filtrate after centrifugation;

[0037] The central tube 2 is mounted in the centrifuge tube 1, and an opening is provided at the lower end of the central tube 2;

[0038] The silicone membrane 4 is laid on the opening at the lower end of the central tube 2, and the central tube 2 on which the silicone membrane 4 is laid is used to store the sample before centrifugation;

[0039] The sealing ring 3 is arranged in the central tube 2, and the friction between the sealing ring 3 and the inner tube wall of the central tube 2 ensures its stability, so that the sealing ring 3 can fix the silicone membrane 4 to ensure that it does not move or fall off during the centrifugation process.

[0040] From the perspective of various separation technology principles, membrane filtration is currently the only most effective bacterial enrichment method. It utilizes the minimum cross-sectional length of bacteria (>0.22μm) and uses filter pores smaller than bacteria to intercept bacteria, so that bacteria are enriched on the filter membrane. However, after filtering bacteria with this method, the bacteria will be tightly bound to the filter membrane and difficult to elute with a trace amount of eluent, resulting in a large error in subsequent DNA extraction. To this end, we used a silica membrane with a pore size of about 1μm based on the silica membrane purification column commonly used in DNA purification, stacked 10 layers of silica membrane together, and then added a sealing ring to press it. Due to the disorder of the silica membrane pores and the multi-layer superposition effect, a filtration effect with a pore size of less than 0.22μm was finally produced. After a large number of experiments, we have verified that this method can intercept 1CFU of bacteria on the silica membrane, and the filtrate does not contain any bacteria at all.

[0041] There are many pore size specifications of silica gel membrane, such as 0.35μm, 0.7μm, 1μm, etc., and the silica gel membrane needs to have a retention effect on bacteria, and the pore size effect of the silica gel membrane must be less than 0.22μm. If a small-pore silica gel membrane (such as 0.35μm and 0.7μm) is used, the number of layers of the silica gel membrane is 4 layers of 0.35μm and 6 layers of 0.7μm to achieve a natural filtration effect of less than 0.22μm pore size. However, the present invention needs to use high-speed centrifugation to remove the filtrate during the bacterial enrichment process. In this process, if the number of layers of the silica gel membrane is too small, there will be a problem of perforation of the silica gel membrane during the high-speed centrifugation process, thereby reducing the enrichment effect; in addition, the silica gel membrane with a pore size of 0.7μm is more likely to retain impurities such as large molecular proteins, which reduces the purity of DNA and is not conducive to subsequent experiments. The use of more layers of small-pore silica gel membranes not only increases the cost (small-pore silica gel membranes are more expensive), but also greatly prolongs the centrifugal filtration time, which reduces the filtration efficiency. Therefore, in the present invention, 8 to 10 layers of silica gel membranes with a larger pore size of 1 μm are selected to filter bacteria, and through the disorder of the silica gel membrane pores and the multi-layer superposition effect, a filtering effect with a pore size less than 0.22 μm is finally produced.

[0042] Silica gel membrane pore size Number of layers cost Enrichment effect 0.35μm 4 high Failure, centrifugal penetration 0.7μm 6 high Failure, centrifugal penetration 1μm 8 Low qualified 1μm 10 Low qualified 1μm 11 Low Qualified, affecting elution

[0043] Similarly, using more layers of 1μm pore size silica membrane will not only greatly prolong the filtration time, but too many layers will increase the amount of elution solution used during elution, resulting in lower bacterial nucleic acid concentration and reduced detection sensitivity. It will also lead to lower DNA elution efficiency. Therefore, 8 to 10 layers are the most appropriate number of layers.

[0044] Example 2

[0045] In situ bacterial lysis, DNA adsorption and elution on silica gel molds enriched with bacteria

[0046] 1. Bacterial enrichment: We took 1 mL of the liquid to be tested and added it to the silica gel membrane purification column, centrifuged it at room temperature at 13000×g for 1 min, and removed the filtrate;

[0047] 2. Pretreatment: Take solution A, melt and mix at room temperature, add 100 μL of melted solution A to each silica gel membrane purification column, and incubate at 50°C for 30 min. Solution A contains the following components at final concentrations: Tris-HCl (pH=6.0) 10 mM, EDTA 1 mM, NaCl 150 mM, lysozyme 20 mg / mL, mix well, divide into small portions, and freeze at -20°C;

[0048] 3. Lysis: Take 400 μL of solution B and add it to each silica gel membrane purification column, incubate at room temperature for 2 minutes to lyse the cells and fully release the DNA so that the DNA binds to the silica gel membrane; solution B includes the following components with final concentrations: guanidine thiocyanate solution 4.5 mol / L, sodium acetate solution 0.2 mol / L, pH = 4.8; when preparing, guanidine thiocyanate and sodium acetate are mixed and dissolved, and then acetic acid is used to adjust the pH to 4.8;

[0049] 4. Binding: In order to ensure that the bacterial DNA can fully bind to the silica membrane, we also need to add 250 μL of isopropanol to the silica membrane purification column to promote the binding of a very small amount of DNA to the silica membrane. After gently mixing, let it stand at room temperature for 1 minute, then centrifuge at room temperature for 1 minute at 13,000 × g, and remove the filtrate.

[0050] 5. Washing: Take 600 μL of solution C and add it to the silica gel membrane purification column, centrifuge at room temperature 13000×g for 1 min, remove the filtrate, and repeat this twice; solution C: Tris-HCl (pH=7.5) 10 mM, 80% ethanol;

[0051] 6. Elution: Add sterile water to the silica membrane purification column, centrifuge at 13000×g for 1 min at room temperature to elute the DNA for PCR or qPCR detection.

[0052] Actual effect verification

[0053] In order to verify the effectiveness of the present invention in enriching extremely trace bacteria and the high efficiency of DNA extraction, we selected three bacteria for verification, namely Escherichia coli, Staphylococcus aureus, and Bacillus subtilis. Escherichia coli is a Gram-negative bacterium, while Staphylococcus aureus and Bacillus subtilis are Gram-positive bacteria.

[0054] (1) Escherichia coli, Staphylococcus aureus and Bacillus subtilis were inoculated into LB liquid medium respectively and cultured in a constant temperature shaker at 37°C overnight;

[0055] (2) Take 100 μL of bacterial solution and add it to a sterilized 1.5 mL centrifuge tube. Then take 900 μL of high temperature and high pressure sterilized physiological saline and add it to the tube. Mix well to make 10 -1 dilute the bacterial suspension; then take 100 μL 10 -1 The diluted bacterial suspension was added to a sterilized 1.5 mL centrifuge tube, and 900 μL of high temperature and high pressure sterilized physiological saline was added to it and mixed thoroughly to make 10 -2 Dilute the bacterial suspension in multiples, and dilute the bacterial suspension in a gradient manner until it is diluted to 10 -9 Dilution multiples of bacterial suspension.

[0056] (3) Take 10 high temperature and high pressure sterilized silica gel membrane purification columns and number them 10 in the above order. -1 , 10 -2 , 10 -3 …10 -9 100 μL of the above gradient diluted bacterial suspension was added to the corresponding silica membrane purification column. The Blank group was added with an equal amount of sterile water as a control, and centrifuged at 12000×g for 1 min at room temperature.

[0057] (4) Prepare LB solid culture medium. Take 100 μL of the diluted bacterial suspension and add it to the solid culture medium plate. Use a sterile applicator to spread it. Take 100 μL of the filtrate obtained from the bacterial suspension after filtering through the silica gel membrane purification column and add it to the solid culture medium plate. Use a sterile applicator to spread it. Incubate the plate upside down in a 37°C constant temperature incubator overnight.

[0058] (5) Discard the remaining filtrate, add 100 μL of solution A to each purification column, and then place it in a 50°C metal bath and incubate for 30 min.

[0059] (6) Remove the silica gel membrane purification columns from the metal bath, add 400 μL of solution B to each purification column, and let stand at room temperature for 5 min.

[0060] (7) Add 250 μL of isopropanol to each silica gel membrane purification column and let it stand at room temperature for 1 min.

[0061] (8) Centrifuge at 12,000 × g for 1 min at room temperature and discard the filtrate.

[0062] (9) Add 600 μL of solution C to each silica membrane, centrifuge at 12,000 × g for 1 min at room temperature, and discard the filtrate.

[0063] (10) Repeat step (9) once.

[0064] (11) Place the empty purification column in a centrifuge and centrifuge at 12,000 × g for 3 min at room temperature.

[0065] (12) Transfer the adsorption column to a new sterilized 1.5 mL centrifuge tube, add 100 μL of sterilized water, and let stand at room temperature for 5 min.

[0066] (13) Centrifuge at 12,000 × g for 1 min at room temperature and transfer the filtrate to a new sterile centrifuge tube for later use as a template in the qPCR reaction system.

[0067] (14) Specific amplification primers and probes for Escherichia coli, Staphylococcus aureus, and Bacillus subtilis were synthesized, and the qPCR reaction system was prepared according to the ratio in Table 1, with 3 replicates in each group, and then qPCR detection was performed according to the procedure in Table 2.

[0068] Table 1 qPCR reaction system ratio

[0069] Reagent name Volume / μL Final concentration 2×qPCR Mix 10 1× Forward Primer 0.5 0.25μM Reverse primer 0.5 0.25μM Probe 0.3 0.15μM template 7.7 total 20

[0070] Table 2qPCR reaction procedure

[0071]

[0072] E. coli upstream primer F: TGGTCTTGACATCCACGGAAGT (SEQ ID NO.1)

[0073] E. coli downstream primer R: CTTTGAGTTCCCGGCCGGAC (SEQ ID NO.2)

[0074] E. coli probe: TGTGCCTTCGGGAACCGTGAGACAGGTGC (SEQ ID NO. 3)

[0075] Staphylococcus aureus upstream primer F: ATCCTTTGACAACTCTAGAGATAGAGCCTT (SEQ ID NO.4)

[0076] Staphylococcus aureus downstream primer R: TGTAGCACGTGTGTAGCCCAAAT (SEQ ID NO.5)

[0077] Staphylococcus aureus probe: CCTTCGGGGGCAGAGTGACAGGTGGTGC (SEQ ID NO.6)

[0078] Bacillus subtilis upstream primer F: CCTCTGACAATCCTAGAGATAGGACGT (SEQ ID NO.7)

[0079] Bacillus subtilis downstream primer R: GGCTTAACCTCGCGGTTTCG (SEQ ID NO.8)

[0080] Bacillus subtilis probe: CTTCGGGGGACAAAGTGACAGGTGGTGCATGG (SEQ ID NO.9)

[0081] (15) Test results

[0082] In order to verify the retention and enrichment effect of the silica membrane purification column on bacteria, we used a high concentration of Staphylococcus aureus (smaller volume) for verification. We took 100 μL of Staphylococcus aureus cultured overnight on a shaker, and used the dilution coating method to spread the bacterial solution onto LB solid culture medium without any antibiotics. At the same time, we took another 100 μL and added it to the improved silica membrane purification column. Centrifuged it at 12000×g for 1 minute at room temperature, and spread the filtrate obtained by filtration onto LB solid culture medium. In order to determine the effect of the number of filtration times on bacterial retention, we also made another group of filtration treatment groups, filtering the bacterial solution repeatedly three times before spreading it onto LB solid culture medium. Figure 2 As shown in the figure, even with extremely high concentration of bacterial suspension, after being filtered through the silica gel membrane purification column, all Staphylococcus aureus were intercepted and enriched on the silica gel membrane purification column. Even after only one filtration, all bacteria were intercepted, and multiple filtrations would not wash the bacteria intercepted on the silica gel membrane into the filtrate, indicating that this method can firmly intercept and enrich the bacteria on the silica gel membrane of the silica gel membrane purification column and will not cause them to be lost.

[0083] In order to determine whether this method is still effective for the interception and enrichment of extremely small amounts of bacteria, we diluted Staphylococcus aureus with sterile saline, then took 100 μL of the diluted bacterial suspension, applied it directly, filtered it, and then applied it with the filtrate, and then placed it in a constant temperature incubator for overnight culture. Figure 3 As shown, we selected 10 -6 , 10 -7 , 10 -8 Three dilution series were used for verification, 10 -6 The total number of Staphylococcus aureus colonies under the dilution multiple is 120 CFU, 10 -7 The total number of Staphylococcus aureus colonies under the dilution multiple is 9 CFU, 10 -8 The total number of Staphylococcus aureus colonies under the dilution multiple is 1 CFU, and the filtrate after filtration, whether it is 10 -6 Still 10 -8The filtrates of different dilutions did not contain any bacteria, which demonstrated the effectiveness of this method in bacterial enrichment. Moreover, both high-concentration bacterial suspensions and extremely small amounts of bacterial suspensions could be effectively retained and enriched.

[0084] like Figure 4 As shown, in 10 -5 The number of live E. coli cells at the dilution multiple is still very high, but after passing through the silica gel membrane purification column, the bacterial solution does not contain any E. coli, indicating that in the presence of high concentrations of cells, this method can effectively intercept the E. coli in the sample to be tested and enrich them all on the silica gel membrane. Figure 5 It can be seen that in 10 -9 The E. coli genomic DNA can still be effectively retained and detected at the dilution multiple, indicating that this method is very effective for enriching and extracting DNA from extremely small amounts of Gram-negative bacteria;

[0085] In order to verify whether this method is also applicable to the enrichment and DNA extraction of extremely small amounts of Gram-positive bacteria, we selected Staphylococcus aureus and Bacillus subtilis for verification. Bacillus subtilis and Escherichia coli are similar in shape and size, while Staphylococcus aureus is smaller in size and is suitable as a representative species of smaller cocci. Figure 6 As shown, in 10 -6 At the dilution multiple, the number of Staphylococcus aureus was about 16 CFU, and the filtrate did not contain any colonies at all, indicating that this method also has a strong retention and enrichment effect on smaller cocci. -7 The theoretical bacterial count under the dilution multiple should be ≤1.6CFU. -8 The theoretical bacterial count under the dilution multiple should be ≤0.16CFU. Figure 7 We can see that qPCR can detect a minimum of 10 -8 Staphylococcus aureus DNA at different dilutions;

[0086] exist Figure 8 In 10 -6 The number of cells at the dilution multiple is about 115 CFU, and the dilution multiple is 10 -8 The theoretical cell number is ≤1.1CFU, and when diluted to 10 -9 The theoretical cell number is <0.2CFU. Fig. 9 We can see that the minimum limit that this method can detect is 10 -8 The DNA at the dilution multiple can reach the detection limit of ≤1.1CFU.

[0087] In summary, effective enrichment and lysis detection of bacteria can be achieved by stacking 10 layers of silica gel molds. Although the pore size of each layer of silica gel membrane is about 1μm, after 10 layers are stacked, it finally forms a structure with a pore size of ≤0.22μm and achieves the interception effect of the membrane filtration method. In addition, it is a silica gel membrane that is easy to bind to DNA. Directly lysing and extracting bacterial cells on this membrane will significantly improve the detection sensitivity of bacteria. This method can not only be used for bacterial enrichment and DNA extraction, but also for fungal enrichment and DNA extraction.

[0088] The above description of the embodiments is to facilitate the understanding and application of the present invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the embodiments herein, and improvements and modifications made to the present invention by those skilled in the art based on the disclosure of the present invention should be within the scope of protection of the present invention.

Claims

1. A silica gel membrane purification column for bacterial enrichment, characterized in that: It includes a centrifuge tube, a central tube, a sealing ring and a silicone membrane layer, wherein: The centrifuge tube is used as a container to store the filtrate after centrifugation; The central tube is mounted in the centrifuge tube, and an opening is provided at the lower end of the central tube; The silicone membrane layer is laid on the opening at the lower end of the central tube, the number of silicone membrane layers in the silicone membrane layer is 8 to 10, and the pore size of the silicone membrane is 1 μm; The sealing ring is arranged in the central tube and pressed on the silicone film layer.

2. Use of the silica gel membrane purification column as claimed in claim 1 in enriching bacteria.

3. The use according to claim 2, characterized in that The bacteria include Gram-positive bacteria, Gram-negative bacteria, and fungi.

4. A bacterial enrichment method, characterized in that: The bacterial suspension is added to the silica gel membrane purification column as claimed in claim 1, and the filtrate is removed by centrifugation at room temperature.

5. Use of the silica gel membrane purification column as claimed in claim 1 in bacteria detection.

6. The use according to claim 5, characterized in that The bacteria include Gram-positive bacteria, Gram-negative bacteria, and fungi.

7. A bacteria detection method based on the silica gel membrane purification column according to claim 1, characterized in that: The steps include: S1. Enriching bacteria using the silica gel membrane purification column according to claim 1; S2. Pretreatment: Take solution A, melt it at room temperature and mix it, add the melted solution A to the silica gel membrane purification column for incubation; solution A contains the following components at final concentrations: Tris-HCl (pH=6.0) 10mM, EDTA 1mM, NaCl 150mM, lysozyme 20mg / mL, mix it and divide it into small portions, and freeze it at -20°C; S3, lysis: adding solution B for lysis to the silica gel membrane purification column for incubation to lyse the cells and fully release the DNA so that the DNA binds to the silica gel membrane; S4, washing: add solution C to a silica gel membrane purification column, centrifuge at room temperature and remove the filtrate; solution C: Tris-HCl (pH = 7.5) 10mM, 80% ethanol; S5. Elution: Add sterile water to the silica membrane purification column, centrifuge at room temperature to elute the DNA, and perform PCR or qPCR detection according to the steps of bacterial detection.

8. The method according to claim 7, characterized in that The solution B comprises the following components with final concentrations: 4.5 mol / L guanidine thiocyanate solution, 0.2 mol / L sodium acetate solution, pH=4.8; during preparation, guanidine thiocyanate and sodium acetate are mixed and dissolved, and then the pH is adjusted to 4.8 with acetic acid.

9. The method according to claim 7, characterized in that The bacteria include Gram-positive bacteria, Gram-negative bacteria, and fungi.

10. The method according to claim 7, characterized in that After lysis, a binding step is also included: isopropanol is added to the silica membrane purification column to promote the binding of DNA to the silica membrane, and the mixture is gently mixed and allowed to stand at room temperature, and then the filtrate is removed after centrifugation.

Images