Genetically engineered bacterium and method for synthesizing astaxanthin by using genetically engineered bacterium

Abstract

The invention discloses a genetically engineered bacterium and a method for synthesizing astaxanthin by using the genetically engineered bacterium. According to the genetically engineered bacterium, a CrtE gene, a CarRP gene and a CarB gene are expressed in an original strain. The genetically engineered bacterium disclosed by the invention can produce beta-carotene and astaxanthin at high yield, and the activation culture of the genetically engineered bacterium does not need to add a defective culture medium or antibiotics, so that the genetically engineered bacterium is beneficial to industrial research of large-scale fermentation of astaxanthin.

Description

Technical Field

[0001] The invention belongs to the field of microorganisms, and specifically relates to a genetically engineered bacterium and a method for synthesizing astaxanthin using the same. Background Art

[0002] Astaxanthin is a keto-carotenoid with strong antioxidant activity. Its oxidative activity is 100 times that of other carotenoids such as β-carotene, lutein and lycopene. Therefore, astaxanthin is widely used in animal feed, food pigments, health care and cosmetics industries, and has a high market value. It is expected that its market value will grow to nearly US$3.4 billion by 2027. At present, the sources of astaxanthin are mainly natural extraction and artificial synthesis. Natural extraction refers to obtaining it from Haematococcus pluvialis, Phaffia rhodozyma and aquatic animals; artificial synthesis includes chemical synthesis and biosynthesis, among which chemical synthesis is the main synthesis pathway of astaxanthin, but chemically synthesized astaxanthin has the characteristics of high by-products and low activity. Compared with it, biosynthesis has the unique advantages of being more environmentally friendly and safe.

[0003] Biosynthesis refers to the technology of transforming some model chassis strains through genetic engineering and making them successfully express astaxanthin. The common model strains are mainly yeast and Escherichia coli. [4] Compared with Escherichia coli, Saccharomyces cerevisiae is a microbial strain that is recognized as safe. It contains the mevalonate (MVA) pathway, which can provide direct precursors for the synthesis of terpenoids such as astaxanthin, including geranyl pyrophosphate (GPP), farnesyl pyrophosphate (FPP), bis(geranyl) diphosphate (GGPP) and squalene epoxide. Therefore, it has a natural advantage in the heterologous synthesis of terpenoids such as astaxanthin.

[0004] The synthetic yield of astaxanthin is the main factor limiting its industrial production. Currently, the production of astaxanthin can be further improved through some metabolic engineering methods, such as promoter optimization, MVA pathway enhancement, lipid droplet regulation, increase in key gene copy number, homologous enzyme optimization, random strain mutagenesis, etc. Among them, optimizing homologous enzymes is the key point to obtain the initial high-yield astaxanthin expression strain chassis. Therefore, this study will optimize the production of astaxanthin synthesized by Saccharomyces cerevisiae through the strategy of combining homologous enzymes from different sources, aiming to further promote the industrial development of astaxanthin synthesis by Saccharomyces cerevisiae.

[0005] The disadvantages of the prior art are as follows:

[0006] 1. The strategies for enhancing the metabolism of astaxanthin are relatively scattered, and the increase in yield is relatively low: At present, the research on astaxanthin biosynthesis is mainly based on the combination of a few metabolic regulation strategies, the regulation direction is not concentrated, and there is little research on the full-pathway optimization of homologous enzymes in the astaxanthin synthesis metabolic pathway.

[0007] 2. Yeast biosynthesis of astaxanthin has low stability, and large-scale industrial fermentation is difficult: Most existing studies have assembled heterologous astaxanthin synthetic genes into plasmid vectors for expression. Although the target compound can be expressed quickly, defective culture media or antibiotics must be used in later fermentation to ensure plasmid replication, which not only affects the growth activity of the strain, but is also not conducive to downstream fermentation and purification research.

[0008] 3. The main model chassis strains for astaxanthin biosynthesis are yeast and Escherichia coli. The engineering modification of Escherichia coli is simpler and more convenient than that of yeast, but it has endogenous toxins, which imposes stricter requirements on the subsequent fermentation extraction process and industrialization standards of astaxanthin. Summary of the invention

[0009] In order to increase the yield of astaxanthin and solve the problems of limited yeast activity, difficulty in purification and toxicity caused by Escherichia coli in yeast biosynthesis, the present invention provides a genetically engineered bacterium and a method for synthesizing astaxanthin using the same.

[0010] The present invention aims to engineer Saccharomyces cerevisiae through CRISPR-Cas9 gene editing technology so that Saccharomyces cerevisiae acquires the ability to heterologously express astaxanthin, and at the same time improves the yield of intracellular astaxanthin synthesized in Saccharomyces cerevisiae through modular optimization of homologous enzyme combinations, namely, optimizing the expression of β-carotene homologous enzymes and optimizing the combination of CrtZ and CrtW / BKT, thereby further promoting the industrial development of biosynthetic astaxanthin.

[0011] The invention of the present invention mainly includes the following aspects:

[0012] a. Modular optimization of homologous enzyme combinations for astaxanthin synthesis: The present invention obtains a high-yield β-carotene strain chassis by optimizing the combination of phytoene synthase, lycopene cyclase and phytoene dehydrogenase, and further optimizes the CrtZ and CrtW / BKT combinations on the basis of high-yield β-carotene. The optimized combination of homologous enzymes covers the entire astaxanthin synthesis pathway, which provides an important reference for the selection of homologous enzymes for astaxanthin synthesis.

[0013] b. Construction of an engineered strain capable of stably genetically expressing astaxanthin: The present invention utilizes CRISPR / Cas9 gene editing technology to insert the heterologous astaxanthin expression gene into the yeast genome, thereby making the genetic performance of the constructed engineered strain stable, which is beneficial to the industrial research of large-scale fermentation of astaxanthin.

[0014] Through the above steps, the present invention utilizes CRISPR / Cas9 gene editing technology to integrate and express the optimal combination of modularly optimized astaxanthin synthesis homologous enzymes into the genome, thereby obtaining an engineered strain with high astaxanthin production and stable genetic expression, which provides an important reference solution for the selection of homologous enzymes for astaxanthin.

[0015] The first aspect of the present invention provides a genetically engineered bacterium, wherein the genetically engineered bacterium expresses the CrtE gene, the CarRP gene and the CarB gene in a starting strain.

[0016] In some embodiments of the present invention, the nucleotide sequences of the CrtE gene, the CarRP gene and the CarB gene are shown as SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0017] In some embodiments of the present invention, the genetically engineered bacteria also express the CrtZ gene and the CrtW gene.

[0018] In some preferred embodiments of the present invention, the nucleotide sequences of CrtZ and CrtW are shown as SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

[0019] In some embodiments of the present invention, the starting strain is Saccharomyces cerevisiae.

[0020] In some preferred embodiments of the present invention, the yeast is MATα his3Δ1 leu2Δ0 ura3Δ0synLYS2, MET15, HO::SUP61 synII, synIII, synVI, synIXR.

[0021] 2369R is an existing strain and has been published at doi: 10.1016 / j.cell.2023.09.025. Epub 2023 Nov 8. PMID: 37944511.

[0022] In some embodiments of the present invention, the CrtE gene, CarRP gene, CarB gene, CrtZ gene and CrtW gene are inserted into the genome of the starting strain.

[0023] In some preferred embodiments of the present invention, the insertion site is selected from one or more of the following:

[0024] The CrtE gene is inserted between the LSB6 and GSH1 genes of the Xth chromosome of the Saccharomyces cerevisiae;

[0025] The CarRP gene is inserted between the RPO21 and SCM3 genes of chromosome IV of the Saccharomyces cerevisiae;

[0026] The CarB gene is inserted between the IPI3 and PBR1 genes of chromosome XIV of the Saccharomyces cerevisiae;

[0027] The CrtZ gene is inserted between the SOK2 and SPO20 genes of the XIII chromosome of the Saccharomyces cerevisiae;

[0028] The CrtW gene is inserted between the RPS25B and NUP2 genes of chromosome XII of the Saccharomyces cerevisiae.

[0029] The second aspect of the present invention provides a method for synthesizing astaxanthin, the method comprising: fermenting using the genetically engineered bacteria as described in the first aspect of the present invention.

[0030] In some preferred embodiments of the present invention, the fermentation is shake flask fermentation or fermentor fermentation.

[0031] In some embodiments of the present invention, the method comprises the following steps: inoculating the genetically engineered bacteria into a fermentation medium for fermentation culture.

[0032] In some preferred embodiments of the present invention, the fermentation medium is SC liquid medium or YPD liquid medium, such as YPD liquid medium.

[0033] In some embodiments of the invention, the fermentation conditions include one or more of the following:

[0034] The temperature is 28-37°C, for example 30°C;

[0035] The shaking speed is 0-400 rpm, for example, 220 rpm;

[0036] The fermentation time is 1-5 days, for example 3 days.

[0037] In some embodiments of the present invention, the method further comprises inoculating into a seed medium for overnight culture before inoculating into a fermentation medium.

[0038] In some preferred embodiments of the present invention, the seed culture medium is YPD liquid culture medium;

[0039] The overnight culture conditions include one or more of the following:

[0040] The temperature is 28-37°C, for example 30°C;

[0041] The shaking speed is 0-400 rpm, for example 220 rpm.

[0042] The third aspect of the present invention provides a composition comprising CrtE gene, CarRP gene and CarB gene or enzymes translated therefrom.

[0043] In some embodiments of the present invention, the nucleotide sequences of the CrtE gene, CarRP gene and CarB gene are shown as SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively; the amino acid sequence of the enzyme is translated from the nucleotide sequences shown as SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.

[0044] In some preferred embodiments of the present invention, the composition further comprises genes and / or enzymes of CrtZ and CrtW.

[0045] In some more preferred embodiments of the present invention, the nucleotide sequences of CrtZ and CrtW are shown as SEQ ID NO: 4 and SEQ ID NO: 5, respectively; the amino acid sequence of the enzyme is translated from the nucleotide sequences shown as SEQ ID NO: 4 and SEQ ID NO: 5.

[0046] The fourth aspect of the present invention provides the use of the genetically engineered bacteria as described in the first aspect of the present invention or the composition as described in the third aspect of the present invention in the production of astaxanthin.

[0047] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0048] The reagents and raw materials used in the present invention are commercially available.

[0049] The positive and progressive effects of the present invention are: a. Obtaining the optimal homologous enzyme combination for the entire astaxanthin synthesis pathway: Different homologous enzyme combinations are crucial to the expression yield of the compound. The present invention optimizes the homologous enzyme combination for astaxanthin synthesis to obtain the genetically engineered bacteria of the present invention, which can produce high levels of β-carotene and astaxanthin, laying the foundation for further enhancing astaxanthin production in combination with other metabolic regulation strategies.

[0050] b. The genetically engineered bacteria of the present invention are beneficial to the large-scale fermentation of astaxanthin: The present invention uses CRISPR-Cas9 gene editing technology to insert the astaxanthin synthesis gene into the yeast genome, so that the activated culture of the engineered strain does not require the addition of defective culture medium or antibiotics, which is beneficial to the industrial research of large-scale fermentation of astaxanthin. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 Pathway diagram for astaxanthin synthesis in Saccharomyces cerevisiae.

[0052] Figure 2 The effects of different combinations of phytoene synthase and lycopene cyclase on β-carotene.

[0053] Figure 3 The effect of different phytoene dehydrogenase CarB on the expression of β-carotene.

[0054] Figure 4 The effects of different combinations of CrtZ and CrtW / BKT homologous enzymes on the expression of astaxanthin. DETAILED DESCRIPTION

[0055] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0056] The synthesis pathway of astaxanthin in the Saccharomyces cerevisiae chassis is as follows Figure 1 As shown in the figure, the synthesis pathway uses geranylgeranyl diphosphate (GGPP) in the mevalonate (MVA) pathway of Saccharomyces cerevisiae as the direct precursor, and phytoene is produced by the bifunctional enzyme phytoene synthase / lycopene cyclase (CarRP) or phytoene synthase (CrtB), and lycopene is produced by phytoene dehydrogenase (CarB), and β-carotene is produced by the bifunctional enzyme CarRP or lycopene cyclase (CrtY), and finally astaxanthin is produced by the joint action of β-carotene hydroxylase (CrtZ) and β-carotene ketolase (CrtW / BKT).

[0057] The present invention aims to use CRISPR-Cas9 gene editing technology to heterologously express the synthesis pathway of astaxanthin and obtain a yeast strain that can stably inherit and produce high astaxanthin by modularly optimizing the combination of homologous enzymes, thereby promoting the industrial development of astaxanthin. This technical solution is achieved by the following steps:

[0058] Step 1: Obtain a yeast strain chassis that produces high β-carotene

[0059] 1. Optimization of phytoene synthase and lycopene cyclase

[0060] The CrtE-Sa (SEQ ID NO: 1) gene from Sulfolobus acidocaldarius and the CarB-Bt (SEQ ID NO: 3) gene from Blakeslea trispora were integrated into the genome of Saccharomyces cerevisiae, and the monofunctional phytoene synthase CrtB and lycopene cyclase CrtY were co-expressed to construct a yeast strain capable of expressing β-carotene. Among them, the phytoene synthase CrtB includes CrtB-Pa (sequence: SEQ ID NO: 6) derived from Pantoea ananatis and CrtB-Pg (sequence: SEQ ID NO: 7) derived from Pantoea agglomerans CGMCC 1.2244, and the lycopene cyclase CrtY includes CrtY-Pa (sequence: SEQ ID NO: 8) derived from Pantoea ananatis and CrtY-Pg (sequence: SEQ ID NO: 9) derived from Pantoea agglomerans CGMCC 1.2244.

[0061] 2. Optimize phytoene dehydrogenase

[0062] The CrtE-Sa (SEQ ID NO: 1) genes from Sulfolobus acidocaldarius and the CarRP-Bt (SEQ ID NO: 2) genes from Blakeslea trispora were integrated into the genome of Saccharomyces cerevisiae, and CarB-Bt (SEQ ID NO: 3) from Blakeslea trispora, CarB-Mc (SEQ ID NO: 10) from Mucor circinelloides and CarB-Xd (SEQ ID NO: 11) from Xanthophyllomyces dendrorhous were co-expressed to obtain a yeast strain chassis with high β-carotene production.

[0063] Step 2 Optimize the combination of CrtZ and CrtW / BKT to obtain a yeast strain with high astaxanthin production

[0064] Based on the yeast strain chassis with high β-carotene production, six different combinations of CrtZ-Bv (SEQ ID NO: 12) of Brevundimonas vesicularis, CrtZ-Pa (SEQ ID NO: 4) of Pantoea ananatis, CrtZ-Pg (SEQ ID NO: 13) of Pantoea agglomerans, CrtW (SEQ ID NO: 5) of Brevundimonas aurantiaca, and BKT (SEQ ID NO: 14) of Haematococcus lacustris were optimized to obtain a yeast chassis strain with high astaxanthin production.

[0065] Step 3: Shake flask fermentation of engineered strains

[0066] a. The engineered strain was streaked on a YPD plate for 3 days;

[0067] b. Pick a single colony and culture it in 3 mL YPD liquid medium at 30°C and 220 rpm overnight;

[0068] c. Inoculate into 50 mL YPD liquid medium with an initial OD600 of 0.1;

[0069] d. Ferment the mixture in a shake flask at 30°C and 220 rpm for 3 days to obtain the fermentation solution.

[0070] Step 4: Carotenoid content detection

[0071] 1. Bacteria collection: a. Take 1 mL of bacterial solution and centrifuge at 1000g for 10 min at 4°C, and discard the supernatant; b. Quickly immerse the bacteria in liquid nitrogen for 30 seconds and thaw on ice; c. Take 1 mL of 4°C pre-cooled 1x PBS buffer to wash the bacteria; d. Centrifuge at 1000g for 10 min and discard the supernatant; e. Centrifuge at 12000rpm for 1 min, aspirate the excess liquid, and obtain the bacterial sample to be tested;

[0072] 2. Sample pre-treatment: a. Add 200 μg 0.5 mm glass beads and 1 mL acetone to the bacteria to resuspend the bacteria; b. Vortex for 30 min in a dark place until the cells are colorless; c. Centrifuge at 13000 rpm for 10 min and take 100 μL supernatant; d. Blow dry with nitrogen gas, add 100 μL acetone to dissolve and then test on the machine.

[0073] 3. Carotenoid detection method and parameters: The present invention adopts high performance liquid chromatography to quantitatively detect the sample, wherein the liquid phase adopts YMC Carotenoid S-3um (150*4.6mm) liquid chromatography column, the injection volume is 5μL, the column temperature is 40°C, the detection wavelength is 450nm, in addition, the mobile phase A is MeOH, the mobile phase B is MeOH:MTBE:H2O=20:75:5, the flow rate is 1.0mL / min, and the elution gradient is 0 min A:B (100:0 V / V), 15min A:B (39:61V / V), 25min A:B (0:100V / V), 25.1min A:B (100:0V / V), 30min A:B (100:0 V / V).

[0074] Strains, plasmids, and primers used in the technical solution of the present invention

[0075] (1) Information on strains, plasmids and primers

[0076] Table 1 Information on strains used in this study

[0077]

[0078] Table 2 Information of plasmids used in this study

[0079]

[0080] Table 3 Primer sequence information used in this study

[0081]

[0082] Table 3

[0083]

[0084] Table 3

[0085]

[0086] Table 3

[0087]

[0088] Table 3

[0089]

[0090] Step 5 Construction of the gene expression cassette of the present invention

[0091] 1. Construction of heterologous gene expression cassette (see Table 2)

[0092] The primer sequences used to construct the heterologous gene expression cassette are shown in Table 3.

[0093] Construction of CrtE-Sa gene expression vector: BY4741 yeast strain genome was used as a template to amplify X-4L, P TDH3 、T PGK1 , X-4R target fragments, and assembled them into large fragments X-4L-P using Overlap PCR technology. TDH -T PGK1 -X-4R, where P TDH3 Promoter and T PGK1 The restriction sites KpnI and SacI were inserted between the terminators, and the large fragment X-4L-P was then cloned using the Gibson technique. TDH -T PGK1 -X-4R was assembled into the PRS426 linear vector digested with KpnI and SacI to construct plasmid TG-1, and then the target fragment of CrtE-Sa synthesized after codon optimization was assembled into the TG-1 linear vector digested with KpnI and SacI to construct the CrtE gene expression cassette TG-1-CrtE-Sa.

[0094] Construction of CarRP-Bt gene expression vector: BY4741 yeast strain genome was used as a template to amplify Int3L, P PGK1 、T PGK1 , Int3R target fragments, and assembled them into a large fragment Int3L-P using Overlap PCR technology. PGK1 -T PGK1 -Int3R, where P PGK1 Promoter and T PGK1 The restriction sites KpnI and SacI were inserted between the terminators, and the large fragment Int3L-P PGK1 -T PGK1 -Int3R was assembled into the PRS426 linear vector digested with KpnI and SacI to construct plasmid TG-2. The CarRP-Bt target fragment synthesized after codon optimization was assembled into the TG-2 linear vector digested with KpnI and SacI to construct the CarRP-Bt gene expression cassette TG-2-CarRP-Bt.

[0095] Construction of CarB gene expression vector: BY4741 yeast strain genome was used as a template to amplify Int10L, P CYC1 、T CYC1 , Int10R target fragments, and assembled them into a large fragment Int10L-P using Overlap PCR technology. CYC1 -T CYC1 -Int10R, where P CYC1 Promoter and T CYC1The restriction sites BamHI and EcoRI were inserted between the terminators, and the large fragment Int10L-P was cloned using the Gibson technique. CYC1 -T CYC1 -Int10R was assembled into the pRS426 linear vector digested with KpnI and SacI to construct plasmid TG-3. The CarB-Bt, CarB-Mc, and CarB-Xd target fragments synthesized after codon optimization were assembled into the TG-3 linear vector digested with BamHI and EcoRI to construct the CarB gene expression cassettes TG-3-CarB-Bt, TG-3-CarB-Mc, and TG-3-CarB-Xd.

[0096] Construction of CrtB gene expression vector: BY4741 yeast strain genome was used as a template to amplify VIII-newL, P ENO2 、T CYC1 , VIII-new R target fragment, and assembled it into a large fragment VIII-new LP using Overlap PCR technology ENO2 -T CYC1 -VIII-new R, where P ENO2 Promoter and T CYC1 The restriction sites BamHI and EcoRI were inserted between the terminators, and the large fragment VIII-new LP was cloned using the Gibson technique. ENO2 -T CYC1 -VIII-new R was assembled into the PRS426 linear vector digested with KpnI and SacI to construct plasmid TG-11. The CrtB-Pa and CrtB-Pg target fragments synthesized after codon optimization were assembled into the TG-11 linear vector digested with BamHI and EcoRI to construct the CrtB gene expression cassettes TG-11-CrtB-Pa and TG-11-CrtB-Pg.

[0097] Construction of CrtY gene expression vector: BY4741 yeast strain genome was used as a template to amplify VII-newL, P ENO2 、T TEF1 , VII-new R target fragments, and assembled them into large fragments VII-new LP using Overlap PCR technology ENO2 -T TEF1 -VII-new R, where P ENO2 Promoter and T TEF1 The restriction sites BamHI and EcoRI were inserted between the terminators, and the large fragment VII-new LP was cloned using the Gibson technique. ENO2 -T TEF1-VII-new R was assembled into the PRS426 linear vector digested with KpnI and SacI to construct plasmid TG-12. The CrtY-Pa and CrtY-Pg target fragments synthesized after codon optimization were assembled into the TG-12 linear vector digested with BamHI and EcoRI to construct the CrtY gene expression cassettes TG-12-CrtY-Pa and TG-12-CrtY-Pg.

[0098] Construction of CrtZ gene expression vector: BY4741 yeast strain genome was used as a template to amplify XIII-newL, P TDH3 、T PGK1 , XIII-new R target fragment, and assembled it into a large fragment XIII-new LP using Overlap PCR technology TDH3 -T PGK1 -XIII-new R, where P TDH3 Promoter and T PGK1 The restriction sites BamHI and EcoRI were inserted between the terminators, and the large fragment XIII-new LP was cloned using the Gibson technique. TDH3 -T PGK1 -XIII-new R was assembled into the pRS426 linear vector digested with KpnI and SacI to construct plasmid TG-7. The CrtZ-Pa, CrtZ-Pg and CrtZ-Bv target fragments synthesized after codon optimization were assembled into the TG-7 linear vector digested with BamHI and EcoRI to construct the CrtZ gene expression cassettes TG-7-CrtZ-Pa, TG-7-CrtZ-Pg and TG-7-CrtZ-Bv.

[0099] Construction of CrtW / BKT gene expression vector: BY4741 yeast strain genome was used as a template to amplify XII-1L, P TDH3 、T TEF1 , XII-1 R target fragments, and assembled them into a large fragment XII-1 LP using Overlap PCR technology TDH3 -T TEF1 -XII-1 R, where P TDH3 Promoter and T TEF1 The restriction sites BamHI and EcoRI were inserted between the terminators, and the large fragment XII-1 LP was then cloned using the Gibson technique. TDH3 -T TEF1-XII-1 R was assembled into the pRS426 linear vector digested with KpnI and SacI to construct plasmid TG-9. The CrtW and BKT target fragments synthesized after codon optimization were assembled into the TG-9 linear vector digested with BamHI and EcoRI to construct the gene expression cassettes TG-9-CrtW and TG-9-BKT.

[0100] 2. Construction of CRISPR-Cas9 expression cassette (see Table 2)

[0101] The CRISPR-Cas9 gene expression cassette designed in this study mainly inserts a 20bp recognition site, a gRNA scaffold skeleton, and screens for resistance URA protein based on pCas. The gene insertion recognition site gRNA is designed using the CHOPCHOP online design tool (https: / / chopchop.cbu.uib.no / ).

[0102] Construction of CRISPR-Cas9 expression cassette of CrtE-Sa gene: CrtE-Sa was designed to be inserted between LSB6 and GSH1 genes on chromosome X of 2369R strain, i.e., site X-4, with recognition sequence CGCCATTCAAGAGCAGCAAC (SEQ ID NO: 127). The sequence X-4gRNA-Ura was synthesized by PCR, and then Golden-gate cloned and assembled the pCas9 vector and X-4gRNA-Ura fragment with BsaI restriction endonuclease to construct the pCAS-X-4 expression cassette.

[0103] Construction of CRISPR-Cas9 expression cassette of CarRP-Bt gene: CarRP-Bt gene was designed to be inserted between RPO21 and SCM3 genes on chromosome IV of 2369R strain, i.e., site Int3, with recognition sequence of AACATTAATTGCTCTCACAG (SEQ ID NO: 128). The sequence Int3gRNA-Ura was synthesized by PCR, and then Golden-gate cloned and assembled the pCas9 vector and Int3gRNA-Ura fragment with BsaI restriction endonuclease to construct the pCAS-Int3 expression cassette.

[0104] Construction of CRISPR-Cas9 expression cassette of CarB gene: CarB gene was designed to be inserted between IPI3 and PBR1 genes on chromosome XIV of 2369R strain, i.e., site Int10, with recognition sequence CATGAGCAGCCACTGTATCG (SEQ ID NO: 129). The sequence Int10gRNA-Ura was synthesized by PCR, and then Golden-gate cloned and assembled the pCas9 vector and Int10gRNA-Ura fragment with BsaI restriction endonuclease to construct the pCAS-Int10 expression cassette.

[0105] Construction of CRISPR-Cas9 expression cassette of CrtB gene: CrtB gene was designed to be inserted between HXT1 and HXT5 genes of chromosome VIII of 2369R strain, i.e., site VIII-new, with recognition sequence of TGTGGCCACTCGTTTAGGAA (SEQ ID NO: 130). Sequence VIII-new gRNA-Ura was synthesized by PCR, and then Golden-gate cloned and assembled the pCas9 vector and VIII-new gRNA-Ura fragment with BsaI restriction endonuclease to construct pCAS-VIII-new expression cassette.

[0106] Construction of CRISPR-Cas9 expression cassette of CrtY gene: CrtY gene was designed to be inserted between RPL24A and RPL30 genes of chromosome VII of 2369R strain, i.e., site VII-new, with recognition sequence of GTACTGCATGATATATTCAA (SEQ ID NO: 131). The sequence VII-new gRNA-Ura was synthesized by PCR, and then Golden-gate cloned and assembled the pCas9 vector and VII-new gRNA-Ura fragment with BsaI restriction endonuclease to construct the pCAS-VII-new expression cassette.

[0107] Construction of CRISPR-Cas9 expression cassette of CrtZ gene: CrtZ gene was designed to be inserted between SOK2 and SPO20 genes on chromosome XIII of 2369R strain, i.e., site XIII-new, with recognition sequence of GTCACAATTCGCAGACATAT (SEQ ID NO: 132). The sequence XIII-new gRNA-Ura was synthesized by PCR, and then Golden-gate cloned and assembled the pCas9 vector and XIII-new gRNA-Ura fragment with BsaI restriction endonuclease to construct the pCAS-XIII-new expression cassette.

[0108] Construction of CRISPR-Cas9 expression cassette of CrtW / BKT gene: The gene was designed to be inserted between RPS25B and NUP2 genes on chromosome XII of 2369R strain, i.e., site XII-1, and the recognition sequence was GGTATGTGCAGTTGATTCAC (SEQ ID NO: 133). The sequence XII-1 gRNA-Ura was synthesized by PCR, and then the pCas9 vector and XII-1gRNA-Ura fragment were assembled by Golden-gate cloning with BsaI restriction endonuclease to construct the pCAS-XII-1 expression cassette.

[0109] 3. Yeast gene editing

[0110] Using the plasmid for constructing the expression gene as a template, the donor DNA fragment of the corresponding gene was PCR-generated, and then using the Saccharomyces cerevisiae strain 2369R as the chassis cell, the LiAc-mediated chemical transformation method was used to introduce the target gene and the gRNA of the genomic insertion site into the yeast strain, thereby enabling the yeast to acquire the ability to express the corresponding target heterologous gene.

[0111] Step 6 Yeast transformation method involved in the technical solution of the present invention

[0112] The present invention utilizes LiAc-mediated chemical transformation method to perform yeast gene editing, and the relevant experimental process is as follows:

[0113] 1. Take the frozen bacterial solution, streak it on a YPD plate, and invert and culture for 3 days;

[0114] 2. Take a single colony and add it to 3 mL YPD liquid medium, shake at 30°C, 220 rpm overnight;

[0115] 3. Inoculate the bacteria into 50 mL of YPD medium at an initial OD600 of 0.2;

[0116] 4. Cultivate at 30°C, 220rpm for about 4.5h until OD = 0.8~1.

[0117] 5. Centrifuge the bacterial solution at 4500rpm for 5min and remove the supernatant;

[0118] 6. Add 20 mL 1xTE solution to resuspend, and centrifuge at 4500 rpm for 5 min;

[0119] 7. Add 2 mL of solution 1 (1.7 mL ddH2O, 200 μL 10× lithium acetate, 100 μL 1×TE) and incubate at 30°C for 10 min to obtain competent cells.

[0120] 8. Take 100 μL competent cells and 20 μL ssDNA and mix them evenly. Add about 3 μg of donor DNA fragment, about 500 ng of gRNA, and solution 2 (600 μL 50% PEG4000, 75 μL 1M lithium acetate, 75 μL 10×TE), and vortex to mix evenly.

[0121] 9. Place in a 30°C incubator for 30 min, add 88 μL DMSO and mix well;

[0122] 10. Heat shock at 42°C in a water bath for 20 min, centrifuge at 13000 rpm for 1 min, and discard the supernatant;

[0123] 11. Add 1 mL of YPD liquid medium, pipette to resuspend, centrifuge at 13000 rpm for 1 min, and discard the supernatant;

[0124] 12. Add 1 mL of YPD liquid medium, pipette to resuspend, and shake at 30°C, 220 rpm for 60 min.

[0125] 13. Centrifuge at 13000rpm for 1min and discard the supernatant;

[0126] 14. Add 1 mL 1xTE to resuspend, centrifuge at 13000 rpm for 1 min, and discard the supernatant;

[0127] 15. Add 100 μL 1xTE and plate the bacterial solution on SD-URA solid plates for screening and culture for 3-4 days.

[0128] Specific implementation method of the present invention:

[0129] Example 1. Obtaining a Yeast Strain Chassis with High β-Carotene Production

[0130] (1) Optimization of phytoene synthase and lycopene cyclase

[0131] The phytoene synthase CrtB-Pa, CrtB-Pg and lycopene cyclase CrtY-Pa, CrtY-Pg from Pantoea ananatis and Pantoea agglomerans CGMCC1.2244 were combined in different ways and co-expressed with genes CrtE-Sa and CarB-Bt to obtain an engineered strain 2-B that can express β-carotene. Pg Y Pg , 2-B Pg Y Pa , 2-B Pa Y Pg and 2-B Pa Y Pa(See Table 1 for details), the results are as follows Figure 2 As shown. Figure 2 It can be seen that the ability of lycopene cyclase CrtY-Pa to express β-carotene is significantly better than that of CrtY-Pg, among which the β-carotene expression content of the optimal combination CrtB-Pa and CrtY-Pa reaches 0.95 mg / L.

[0132] (2) Optimization of phytoene dehydrogenase

[0133] Phytoene dehydrogenases CarB-Bt, CarB-Mc, and CarB-Xd from Blakeslea trispora, Mucor circinelloides, and Xanthophyllomyces dendrorhous were co-expressed with CrtE-Sa and CarRP-Bt, respectively, to obtain the engineered strain 2-RP-B that can express β-carotene. Mc 、2-RP-B Xd 、2-RP-B Bt (See Table 1 for details), the results are as follows Figure 3 As shown. Figure 3 It can be seen that the effect of phytoene dehydrogenase CarB-Bt on synthesizing β-carotene is significantly better than that of CarB-Mc and CarB-Xd, while the effect of phytoene synthase / lycopene cyclase bifunctional enzyme CarRP-Bt is significantly better than that of single functional enzymes CrtB-Pa and CrtY-Pa. The optimal strain 2-RP-B Bt It can produce β-carotene content up to 5.37 mg / L.

[0134] Example 2. Optimization of the combination of CrtZ and CrtW / BKT homologous enzymes to obtain a yeast strain with high astaxanthin production

[0135] The best strain for producing β-carotene, 2-RP-B Bt As chassis cells, six different combinations of CrtZ-Bv from Brevundimonas vesicularis, CrtZ-Pa from Pantoea ananatis, CrtZ-Pg from Pantoea agglomerans, CrtW from Brevundimonasaurantiaca, and BKT from Haematococcus lacustris were used to construct an engineered strain A that can produce astaxanthin. Bv -BKT, A Bv -CrtW、APg -BKT, A Pg -CrtW、A Pa -BKT and A Pa -CrtW (for details, see Table 1), the results are as follows Figure 4 As shown. Figure 4 It can be seen that the synthesis ability of β-carotene hydroxylase CrtZ-Pa is significantly better than that of CrtZ-Pg and CrtZ-Bv, and the β-carotene ketolase CrtW is also better than BKT. The optimal strain A constructed in this way Pa -CrtW can produce astaxanthin content up to 0.65mg / L.

[0136] The CrtE-Sa gene sequence is as follows (SEQ ID NO: 1):

[0137] ATGTCATATTTCGATAATTACTTCAACGAAATCGTTAACTCCGTCAACGATATCATCAAGTCTTACATCTCCGGCGATGTTCCAAAGTTGTACGAAGCTTCCTACCACTTGTTTACCTCTGGTG GTAAGAGATTACGTCCATTGATCTTAACTATCTCTTCCGATTTGTTCGGTGGTCAAAGAGAAAGAGCTTATTACGCCGGTGCTGCTATTGAAGTTTTACACACTTTCACCTTGGTCCATGATGA CATCATGGACCAAGATAACATCAGAAGAGGTTTGCCAACTGTTCACGTCAAGTACGGTTTGCCTTTGGCGATCTTGGCTGGTGACTTGTTGCACGCTAAGGCCTTCCAATTGTTGACTCAAGCTTTGCGTGGTTTGCCATCTGAAACCATTATAAAGGCTTTCGACATCTTCACCAGATCTATCATTATCATTTCTGAAGGTCAAGCTGTTGACATGGAGTTCGAAGACAGAATTGACATCAAAGAAC AAGAATACTTGGACATGATTTCCAGAAAGACCGCTGCCTTATTTTCTGCTTCTTCTTCTATTGGTGCCTTGATTGCTGGTGCTAACGACAATGATGTCAGATTGATGTCTGATTTCGGTACCAACTTGGGTATCGCTTTCCAAATCGTCGATGACATTTTAGGTCTAACTGCTGACGAAAAGGAATTAGGTAAGCCAGTTTTCAGCGACATTCGTGAAGGTAAGAAAACTATTTTGGTTATCAAGACT TTGGAATTGTGTAAGGAAGACGAAAAGAAGATTGTCTTGAAGGCTCTCGGTAACAAGTCTGCCTCCAAGGAAGAATTGATGTCCTCTGCTGATATTATTAAGAAGTACTCCTTGGACTACGCATACAACTTGGCCGAAAAATACTACAAGAACGCTATCGATTCTTTGAACCAAGTTTCCTCTAAAAGTGACATTCCAGGTAAGGCTTTGAAGTACCTAGCCGAATTTACCATCAGAAGAAGAAAGTAA

[0138] 2. The CarRP-Bt gene sequence is as follows (SEQ ID NO: 2):

[0139]

[0140] 3. The CarB-Bt gene sequence is as follows (SEQ ID NO: 3):

[0141]

[0142] 4. The CrtZ-Pa gene sequence is as follows (SEQ ID NO: 4):

[0143] ATGTTGTGGATCTGGAACGCTTTGATTGTTTTCGTTACCGTCATCGGTATGGAAGTCATTGCTGCTTTAGCTCACAAGTACATCATGCACGGTTGGGGTTGGGGTTGGCACTTATCTCATCACGAACCTAGAAAGGGTGCTTTCGAAGTTAACGACTTGTATGCTGTCGTCTTTGCTGCCTTGTCAATCTTGTTGATCTACTTGGGTTCCACTGGTATGTGGCCACTTCAATGGATTGGCGCCGGTATGACCGCTTACGGTTTGTTATACTTCATGGTTCACGACGGTCTAGTCCACCAAAGATGGCCATTCAGATACATTCCAAGAAAGGGTTACTTGAAGAGATTGTACATGGCTCACAGAATGCATCATGCCGTTCGTGGTAAGGAAGGTTGTGTTTCTTTCGGTTTCTTGTACGCTCCACCATTGTCCAAGTTGCAAGCTACTTTGAGAGAAAGACACGGTGCAAGAGCTGGTGCCGCCCGTGATGCTCAAGGTGGTGAAGATGAACCAGCTTCTGGTAAATAA

[0144] 5. The CrtW gene sequence is as follows (SEQ ID NO: 5):

[0145] ATGACAGCCGCCGTCGCTGAACCAAGAATCGTTCCAAGACAAACTTGGATTGGTTTAACTTTGGCCGGTATGATTGTTGCTGGTTGGGGTTCTTTGCACGTTTATGGTGTCTACTTTCACAGATGGGGTACTTCTTCTTTGGTTATCGTCCCAGCTATCGTTGCTGTCCAAACCTGGTTATCAGTCGGTCTATTCATCGTTGCCCACGATGCTATGCACGGTTCCTTGGCTCCAGGTCGTCCACGTTTGAACGCTGCTGTAGGTAGATTAACCTTAGGTTTGTACGCTGGTTTCAGATTCGACAGATTGAAGACCGCTCACCACGCTCATCACGCCGCTCCAGGTACTGCTGACGACCCAGATTTCTACGCCCCAGCTCCAAGAGCTTTCTTGCCATGGTTCTTGAACTTCTTCAGAACTTACTTCGGTTGGAGAGAAATGGCTGTTTTGACCGCATTGGTCTTGATTGCTCTATTTGGCTTGGGTGCTAGACCAGCTAACTTGTTGACTTTCTGGGCTGCTCCTGCTTTATTGTCTGCTTTGCAATTGTTTACCTTCGGTACCTGGTTGCCTCACCGTCACACTGACCAACCATTCGCTGATGCCCATCATGCCAGATCCTCTGGTTACGGTCCAGTTTTGTCCTTGTTGACCTGTTTCCACTTCGGTAGACACCACGAACACCATTTGACTCCATGGCGTCCATGGTGGAGATTATGGAGAGGTGAATCCTAA

[0146] The CrtB-Pa gene sequence is as follows (SEQ ID NO: 6):

[0147] ATGAACAACCCATCTTTGCTCAACCACGCTGTCGAAACCATGGCTGTTGGTTCCAAGTCCTTTGCTACTGCTTCCAAACTATTCGACGCTAAGACTAGAAGATCTGTTTTGATGTTGTACGCTTGGTGTCGTCACTGTGATGATGTCATTGACGATCAAACTTTAGGTTTCCAAGCCCGTCAACCAGCCTTGCAAACTCCAGAACAAAGATTGATGCAATTAGAAATGAAGACCAGACAAGCTTACGCCGGTTCCCAAATGCACGAACCTGCCTTCGCTGCTTTCCAAGAAGTTGCCATGGCTCACGACATTGCTCCAGCTTACGCTTTCGATCATTTGGAAGGTTTCGCTATGGACGTCCGTGAGGCTCAGTACTCTCAATTGGACGACACTTTGAGATACTGTTACCACGTTGCTGGTGTTGTCGGTTTGATGATGGCCCAAATCATGGGTGTTAGAGACAATGCTACACTTGACAGAGCGTGCGATTTAGGTTTGGCTTTCCAATTGACCAACATTGCTAGAGATATTGTCGATGACGCCCACGCTGGTAGATGTTATTTGCCAGCTTCTTGGTTGGAACACGAAGGTTTGAACAAGGAAAACTACGCTGCCCCAGAAAACAGACAAGCTTTGTCTAGAATCGCCAGAAGATTGGTCCAAGAAGCTGAACCATACTACTTGTCCGCGACTGCTGGCTTGGCTGGTTTACCTTTGCGTTCAGCTTGGGCCATCGCTACCGCCAAGCAAGTTTACAGAAAGATCGGTGTGAAGGTTGAACAAGCCGGTCAACAAGCTTGGGACCAAAGACAATCTACCACTACCCCAGAAAAGTTGACCTTGCTATTGGCTGCTTCTGGTCAAGCTTTGACTTCTAGAATGAGAGCTCACCCACCAAGACCAGCTCATTTGTGGCAAAGACCATTATAG

[0148] The CrtB-Pg gene sequence is as follows (SEQ ID NO: 7):

[0149] ATGGAAGTTGGTTCCAAGTCTTTCGCTACTGCTTCCAAATTGTTTGACGCTAAGACAAGAAGATCTGTTTTGATGTTGTACGCTTGGTGCAGACACTGTGATGACGTCATTGACGACCAAGTTTTAGGTTTCTCTAATGACACTCCATCTTTGCAATCTGCTGAACAAAGATTGGCTCAATTGGAAATGAAGACCAGACAAGCCTACGCCGGTTCTCAAATGCACGAACCAGCCTTTGCCGCTTTCCAAGAAGTCGCCATGGCTCACGATATCTTGCCAGCTTACGCTTTCGATCATTTGGCTGGTTTCGCCATGGACGTTCACGAAACTCGTTACCAAACTTTAGATGATACTTTGAGATACTGTTACCACGTCGCTGGTGTTGTTGGCTTAATGATGGCCCAAATCATGGGTGTCAGAGACAACGCTACCTTGGACAGAGCTTGTGACTTGGGTTTAGCTTTCCAATTGACCAACATTGCTAGAGATATTGTCGAAGATGCCGAAGCTGGTAGATGTTATTTGCCAGCTGCTTGGTTGGCTGAAGAAGGTTTGACCAGAGAAAACTTGGCTGACCCACAAAACAGAAAGGCTTTGTCCCGTGTTGCCAGAAGACTAGTTGAAACCGCTGAACCATACTACAGATCCGCGTCCGCTGGTTTGCCAGGTCTACCTCTGCGTAGCGCTTGGGCTATCGCCACTGCACAACAAGTCTACAGAAAGATCGGTATGAAGGTTGTCCAAGCTGGTTCACAGGCTTGGGAACAAAGACAATCCACTTCTACCCCAGAAAAGTTGGCTTTGTTGGTTGCCGCTAGTGGTCAAGCTGTCACCTCTAGAGTCGCTCGTCATGCTCCAAGATCTGCTGATTTGTGGCAAAGACCAGTTTAG

[0150] The CrtY-Pa gene sequence is as follows (SEQ ID NO: 8):

[0151]

[0152] The CrtY-Pg gene sequence is as follows (SEQ ID NO: 9):

[0153]

[0154] The CarB-Mc gene sequence is as follows (SEQ ID NO: 10):

[0155]

[0156] The CarB-Xd gene sequence is as follows (SEQ ID NO: 11):

[0157]

[0158] The CrtZ-Bv gene sequence is as follows (SEQ ID NO: 12):

[0159] ATGTCTTGGCCTACCATGATTTTGTTGTTCTTGGCTACTTTCTTGGGTATGGAAGTTTTCGCTTGGGCTATGCATAGATACGTTATGCACGGTCTATTATGGACCTGGCACAGATCCCATCACGAACCACACGATGATGTCTTGGAAAGAAACGACTTGTTTGCCGTTGTCTTTGCCGCTCCAGCTATCATCTTGGTTGCCCTTGGCTTGCATTTGTGGCCATGGATGTTGCCAATTGGTTTGGGTGTTACTGCTTACGGTTTGGTCTACTTCTTCTTCCACGACGGTTTAGTTCACAGAAGATTCCCAACTGGTATTGCTGGTAGATCTGCTTTCTGGACTAGACGTATCCAAGCTCACCGTTTACACCACGCTGTCAGAACCAGAGAAGGTTGTGTCTCTTTCGGTTTCTTGTGGGTTCGTTCAGCCAGAGCATTGAAGGCTGAATTGTCTCAAAAGAGAGGTTCCTCTTCCAACGGTGCTTAG

[0160] The CrtZ-Pg gene sequence is as follows (SEQ ID NO: 13):

[0161] ATGTTGGTTAACTCTTTGATCGTCATCTTGTCCGTTATCGCTATGGAAGGTATTGCCGCTTTCACCCACAGATACATCATGCATGGCTGGGGTTGGAGATGGCACGAATCTCACCACACTCCAAGAAAGGGTGTCTTCGAATTGAACGATTTGTTTGCCGTTGTTTTCGCTGGTGTTGCCATTGCTTTGATTGCTGTCGGTACCGCCGGTGTCTGGCCATTGCAATGGATCGGTTGTGGTATGACTGTCTACGGTTTACTATATTTCTTGGTTCATGATGGTTTGGTCCACCAAAGATGGCCATTCCACTGGATTCCAAGAAGAGGTTACTTGAAAAGATTATACGTTGCTCACCGTCTTCATCACGCTGTTAGAGGTAGAGAAGGTTGTGTTTCATTCGGTTTCATCTACGCTAGAAAGCCAGCTGACTTGCAAGCTATTTTGAGAGAAAGACACGGTCGTCCTCCAAAGCGTGATGCTGCCAAGGACAGACCAGACGCTGCTTCTCCATCTTCTTCCTCCCCAGAATAG

[0162] The BKT gene sequence is as follows (SEQ ID NO: 14):

[0163] ATGCCATCTGAATCTTCTGACGCTGCTAGACCAGTTTTGAAGCACGCTTACAAGCCTCCAGCCAGCGATGCCAAGGGTATTACCATGGCTTTGACCATTATTGGTACCTGGACCGCTGTCTTTTTGCATGCTATCTTCCAAATCAGATTGCCAACTTCCATGGACCAACTTCATTGGCTGCCTGTCTCCGAAGCTACTGCTCAATTG TTGGGTGGTTCCTCTTCTTTATTGCACATTGCTGCAGTTTTCATTGTCTTGGAATTCTTGTACACTGGTTTGTTCATCACAACTCACGATGCTATGCACGGTACCATTGCCTTGAGAAACAGACAATTGAACGACTTGTTAGGTAATATCTGTATCTCTTTGTACGCTTGGTTCGACTACTCCATGCACTGGGAACACCACAACCACA CCGGTGAAGTTGGTAAGGACCCAGACTTCCACAAGTAACCCAGGTTTGGTTCCATGGTTTGCTTCCTTCATGTCTTCATATATGTCCTTGTGGCAATTCGCCCGTTTGGCTTGGTGGGCTGTTGTTATGCAAACTTTGGGTGCTCCAATGGCTAACTTGTTAGTCTTCATGGCCGCTGCCCCAATCTTGTCCGCTTTCAGATTATT CTACTTCGGTACTTACTTGCCACACAAGCCAGAACCAGGTCCAGCCGCTGGTTCTCAAGTCATGAGTTGGTTCAGAGCTAAGACCTCTGAAGCTTCTGATGTTATGTCTTTCTTGACTTGTTACCACTTCGATTTGTTTTGCTCCATGGTGGCAACTACCACATTGTCGTAGATTGTCTGGCAGAGGTTTAGTCCCAGCTTTGGCCTAA

[0164] Although the specific embodiments of the present invention are described above, it should be understood by those skilled in the art that these are only examples, and various changes or modifications may be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the protection scope of the present invention is limited by the appended claims.

Claims

1. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria express the CrtE gene, the CarRP gene and the CarB gene in the starting strain, and the nucleotide sequences of the CrtE gene, the CarRP gene and the CarB gene are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

2. The genetically engineered bacterium according to claim 1, characterized in that The genetically engineered bacteria also express CrtZ gene and CrtW gene, and the nucleotide sequences of CrtZ and CrtW are shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

3. The genetically engineered bacterium according to claim 1 or 2, characterized in that: The starting strain is Saccharomyces cerevisiae.

4. The genetically engineered bacterium according to claim 3, characterized in that The cerevisiae yeast is MATα his3Δ1 leu2Δ0 ura3Δ0 synLYS2, MET15, HO::SUP61 synII, synIII, synVI, synIXR.

5. The genetically engineered bacterium according to claim 3, characterized in that The CrtE gene, CarRP gene, CarB gene, CrtZ gene and CrtW gene are inserted into the genome of the starting strain; wherein: The CrtE gene is inserted between the LSB6 and GSH1 genes of the Xth chromosome of the Saccharomyces cerevisiae; The CarRP gene is inserted between the RPO21 and SCM3 genes of chromosome IV of the Saccharomyces cerevisiae; The CarB gene is inserted between the IPI3 and PBR1 genes of chromosome XIV of the Saccharomyces cerevisiae; The CrtZ gene is inserted between the SOK2 and SPO20 genes of the XIII chromosome of the Saccharomyces cerevisiae; The CrtW gene is inserted between the RPS25B and NUP2 genes of chromosome XII of the Saccharomyces cerevisiae.

6. A method for synthesizing astaxanthin, characterized in that: The method comprises: using the genetically engineered bacteria as described in any one of claims 1 to 5 for fermentation.

7. The method according to claim 6, characterized in that The method comprises the following steps: inoculating the genetically engineered bacteria into a fermentation medium for fermentation culture.

8. The method according to claim 6 or 7, characterized in that The method also includes inoculating into a seed medium for overnight culture before inoculating into a fermentation medium; The overnight culture conditions include one or more of the following: Temperature is 28-37°C; The shaking speed is 0-400rpm.

9. A composition, characterized in that The composition comprises CrtE gene, CarRP gene and CarB gene or enzymes translated therefrom, wherein the nucleotide sequences of the CrtE gene, CarRP gene and CarB gene are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively; the amino acid sequence of the enzyme is translated from the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQID NO:

3.

10. The composition according to claim 9, characterized in that The composition further comprises a CrtZ gene and a CrtW gene or an enzyme translated therefrom, wherein the nucleotide sequences of the CrtZ gene and the CrtW gene are shown in SEQ ID NOs: 4 and 5, respectively; and the amino acid sequence of the enzyme is translated from the nucleotide sequences shown in SEQ ID NOs: 4 and 5.

11. Use of the genetically engineered bacteria according to any one of claims 1 to 5 or the composition according to claim 9 or 10 in producing astaxanthin.

Images