Taq DNA polymerase mutant with improved thermal stability and inhibition resistance as well as preparation method and application of Taq DNA polymerase mutant

Abstract

The invention discloses a Taq DNA polymerase mutant with improved thermal stability and inhibition resistance as well as a preparation method and application of the Taq DNA polymerase mutant, and relates to the technical field of biology. According to the Taq DNA polymerase mutant, amino acid mutation is carried out on an amino acid sequence of wild type Taq DNA polymerase, and amino acid mutation sites comprise F73S and P93A; the amino acid sequence of the wild type Taq DNA polymerase is as shown in SEQ ID NO: 1. Compared with wild type Taq DNA polymerase, the Taq DNA polymerase has the advantages that the resistance to inhibitors such as heme, ethanol and EDTA (Ethylene Diamine Tetraacetic Acid) is improved, and meanwhile, the Taq DNA polymerase has higher specific enzyme activity and heat stability.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a Taq DNA polymerase mutant with improved thermal stability and anti-inhibition ability, and a preparation method and application thereof. Background Art

[0002] The heat-resistant DNA polymerase (Taq) from the aquatic bacterium Thermus aquaticus is the first and most widely used enzyme for polymerase chain reaction (PCR). Taq DNA polymerase belongs to the DNA polymerase I family and has thermal stability, high specificity and high activity. With the application and promotion of PCR technology, the research on Taq DNA polymerase has become increasingly important and extensive. However, traditional Taq DNA polymerase has low activity, short half-life, low tolerance, and is easily restricted by inhibitors contained in the template (such as heme in the blood, anticoagulants, etc.), making it difficult to be widely used. Therefore, novel and improved performance Taq DNA polymerase derivatives need to be studied to meet the requirements of scientific research, medical diagnosis and industrial production. Summary of the invention

[0003] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention proposes a Taq DNA polymerase mutant, which has higher thermal stability than the wild-type Taq DNA polymerase and has improved resistance to inhibitors such as heme, ethanol and EDTA.

[0004] The invention also provides a recombinant protein.

[0005] The present invention also provides biological materials related to the Taq DNA polymerase mutant or recombinant protein.

[0006] The invention also provides an enzyme preparation.

[0007] The present invention also provides a method for preparing the Taq DNA polymerase mutant or recombinant protein.

[0008] The invention also provides a method for amplifying DNA molecules.

[0009] The present invention also provides applications related to the Taq DNA polymerase mutant, recombinant protein, biological material or enzyme preparation.

[0010] According to a Taq DNA polymerase mutant of the first aspect of the present invention, amino acid mutations are performed on the amino acid sequence of the wild-type Taq DNA polymerase, and the amino acid mutations include F73S and P93A; the amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO:1.

[0011] The Taq DNA polymerase mutant according to the embodiment of the present invention has at least the following beneficial effects:

[0012] Compared with wild-type Taq DNA polymerase, the Taq DNA polymerase mutant has a higher specific enzyme activity, which is 1.6 to 2.5 times that of the wild-type Taq DNA polymerase; and has higher thermal stability, and can still retain at least 70% of the enzyme activity after heat treatment at 95°C for 1 hour. Its thermal stability is 30% to 40% higher than that of the wild-type Taq DNA polymerase; at the same time, it has higher resistance to certain PCR inhibitors and can tolerate at least 35μM heme, 5mM EDTA and 7% ethanol.

[0013] According to some embodiments of the present invention, the Taq DNA polymerase mutant further comprises at least one amino acid mutation of E734G, V155I, and L245M.

[0014] According to some embodiments of the present invention, the Taq DNA polymerase mutant comprises any one of the groups of mutation sites A1) to A4):

[0015] A1), F73S, P93A, E734G (the amino acid sequence is shown in SEQ ID NO: 3, positions 10 to 841);

[0016] A2), F73S, P93A (the amino acid sequence is shown in SEQ ID NO: 4, positions 10 to 841);

[0017] A3), F73S, P93A, V155I (the amino acid sequence is shown in SEQ ID NO: 5, positions 10 to 841);

[0018] A4), F73S, P93A, L245M (the amino acid sequence is shown in SEQ ID NO: 6, positions 10 to 841).

[0019] A recombinant protein according to the second aspect of the present invention comprises a tag and the above-mentioned Taq DNA polymerase mutant.

[0020] According to some embodiments of the present invention, the tag is connected to the middle and / or N-terminus and / or C-terminus of the Taq DNA polymerase mutant.

[0021] According to some embodiments of the present invention, the label includes at least one of the labels that facilitate the dissolution, purification and detection of Taq DNA polymerase mutants. It is understandable that the Taq DNA polymerase mutant of the present invention may include one or more labels; multiple labels may include a combination of multiple identical labels, or a combination of multiple different labels. For example: labels that facilitate the dissolution of Taq DNA polymerase mutants include but are not limited to nus labels or maltose binding protein labels; labels that facilitate the purification of Taq DNA polymerase mutants include but are not limited to strep labels, His labels, GST labels, pelB signal labels or ompA signal labels; labels that facilitate the detection of Taq DNA polymerase mutants include but are not limited to horseradish peroxidase (HRP) labels, β-galactosidase labels, luciferase labels, green fluorescent protein (GFP) labels, HcRed labels, DsRed labels or cyan fluorescent protein (CFP) labels. The label may specifically be a His label.

[0022] According to some embodiments of the present invention, the amino acid sequence of the Taq DNA polymerase mutant is shown in any one of SEQ ID NO:2 to SEQ ID NO:5.

[0023] According to the third aspect of the present invention, the biological material related to the Taq DNA polymerase mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention is any one of B1) to B4):

[0024] B1), a nucleic acid molecule encoding the Taq DNA polymerase mutant described in the embodiment of the first aspect of the present invention or the recombinant protein described in the embodiment of the second aspect of the present invention;

[0025] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0026] B3), a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2);

[0027] B4) A recombinant biological cell containing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3).

[0028] According to some embodiments of the present invention, the nucleic acid molecule has any one of B11) to B19):

[0029] B11), a DNA molecule having a nucleotide sequence as shown in positions 28 to 2526 of SEQ ID No: 7;

[0030] B12), a DNA molecule having a nucleotide sequence as shown in positions 28 to 2526 of SEQ ID No: 8;

[0031] B13), a DNA molecule having a nucleotide sequence as shown in positions 28 to 2526 of SEQ ID No:9;

[0032] B14), a DNA molecule having a nucleotide sequence as shown in positions 28 to 2526 of SEQ ID No: 10;

[0033] B15), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence shown in any one of B11) to B14), and encoding the Taq DNA polymerase mutant;

[0034] B16), a DNA molecule that hybridizes with the nucleotide sequence defined in any one of B11) to B15) under stringent conditions and encodes the TaqDNA polymerase mutant.

[0035] According to some embodiments of the present invention, the stringent conditions can be hybridization in a 2×SSC, 0.1% SDS solution at 68°C and washing the membrane twice, each time for 5 min; or hybridization in a 0.5×SSC, 0.1% SDS solution at 68°C and washing the membrane twice, each time for 15 min.

[0036] According to some embodiments of the present invention, the expression cassette refers to a DNA molecule capable of expressing the Taq DNA polymerase mutant in a host cell. The DNA molecule may include not only a promoter for initiating transcription of the Taq DNA polymerase mutant encoding gene, but also a terminator for terminating transcription of the Taq DNA polymerase mutant encoding gene. Further, the expression cassette may also include an enhancer sequence.

[0037] According to some embodiments of the present invention, the vector may be a plasmid, a cosmid, a phage or a viral vector. For example, it may be a PET-28a vector.

[0038] According to some embodiments of the present invention, the recombinant vector may be a recombinant vector obtained by inserting a DNA molecule encoding the Taq DNA polymerase mutant into the multiple cloning site of the vector.

[0039] According to some embodiments of the present invention, biological cells include prokaryotic cells and eukaryotic cells. The prokaryotic cells include bacteria or algae. The eukaryotic cells include fungi, mammalian cells or insect cells. Among them, the bacteria can be Escherichia coli, such as E. coli DH5α or E. coli JM109. The recombinant organism does not contain reproductive material.

[0040] According to some embodiments of the present invention, the recombinant biological cell is a recombinant biological cell obtained by introducing the nucleic acid molecule B1), the expression cassette B2) or the recombinant vector B3) into a biological cell. Specifically, it can be a recombinant Escherichia coli obtained by introducing the recombinant vector into E. coli DH5α or E. coli JM109.

[0041] An enzyme preparation according to an embodiment of the fourth aspect of the present invention comprises the Taq DNA polymerase mutant described in the embodiment of the first aspect of the present invention or the recombinant protein described in the embodiment of the second aspect of the present invention.

[0042] According to some embodiments of the present invention, the enzyme preparation further includes a reaction premix.

[0043] According to some embodiments of the present invention, the PCR premix includes Tris-HCl, K + Mg 2+ , BSA, and at least one of dNTPs.

[0044] According to some embodiments of the present invention, the K + The source includes at least one of potassium chloride, potassium acetate and potassium sulfate.

[0045] According to some embodiments of the present invention, the Mg 2+ The source includes at least one of magnesium chloride, magnesium acetate and magnesium sulfate.

[0046] According to some embodiments of the present invention, the qPCR premix includes 20-50 mmol / L Tris-HCl, 50-100 mmol / L K + 、5~10mmol / L Mg 2+ , 50-100 μg / mL BSA, 250-500 μmol / L dNTPs. For example, the qPCR premix may include 25 mmol / L Tris-HCl, 100 mmol / L K + 、5mmol / L Mg 2+ , 50μg / mL BSA, 300μmol / LdNTPs.

[0047] According to some embodiments of the present invention, the pH of the qPCR premix is ​​8.5-9.2.

[0048] It is understandable that the reaction premix solution should preferably not affect the activity of the Taq DNA polymerase mutant or recombinant protein.

[0049] According to the fifth aspect of the present invention, the method for preparing the Taq DNA polymerase mutant described in the first aspect of the present invention comprises:

[0050] The Taq DNA polymerase mutant described in the first aspect of the present invention or the coding gene of the recombinant protein described in the second aspect of the present invention is introduced into biological cells to express the coding gene to obtain the Taq DNA polymerase mutant.

[0051] According to some embodiments of the present invention, the biological cells include prokaryotic cells and eukaryotic cells.

[0052] According to some embodiments of the present invention, the prokaryotic cell comprises bacteria or algae, wherein the bacteria may be Escherichia coli (eg, E. coli JM109).

[0053] According to some embodiments of the present invention, the eukaryotic cells include fungi (such as yeast), mammalian cells (such as HEK293 cells) or insect cells.

[0054] According to the sixth aspect of the present invention, a method for amplifying a DNA molecule comprises the step of amplifying the DNA molecule using the Taq DNA polymerase mutant described in the first aspect of the present invention or the recombinant protein described in the second aspect of the present invention as a DNA polymerase.

[0055] According to some embodiments of the present invention, the following steps may be specifically included:

[0056] The Taq DNA polymerase mutant, DNA molecules, primers and reaction premix are mixed and reacted.

[0057] Application of the seventh embodiment according to the present invention.

[0058] According to some embodiments of the present invention, the application is the application of any one of C1) to C4) in preparing a nucleic acid amplification or sequencing product;

[0059] C1), the Taq DNA polymerase mutant described in the embodiment of the first aspect of the present invention;

[0060] C2), the recombinant protein described in the embodiment of the second aspect of the present invention;

[0061] C3), the biomaterial described in the embodiment of the third aspect of the present invention;

[0062] C4), the enzyme preparation described in the embodiment of the fourth aspect of the present invention.

[0063] According to some embodiments of the present invention, the nucleic acid amplification may specifically be a polymerase chain reaction.

[0064] According to some embodiments of the present invention, the application is the application of the Taq DNA polymerase mutant described in the embodiment of the first aspect of the present invention, the recombinant protein described in the embodiment of the second aspect of the present invention, or the enzyme preparation described in the embodiment of the third aspect of the present invention in nucleic acid amplification or sequencing.

[0065] Other features and advantages of the present invention will be set forth in the description which follows, and in part will be apparent from the description, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 The electrophoresis diagram of the enzyme protein finally obtained after wild-type Taq DNA polymerase, Taq-w1, Taq-w2, Taq-w3, and Taq-w4 were expressed and purified; M is a protein marker, and lanes 1 to 5 are enzyme protein samples Taq-WT, Taq-w1, Taq-w2, Taq-w3, and Taq-w4, respectively;

[0067] Figure 2 The fluorescence quantitative PCR amplification curves of Taq-WT's resistance to different inhibitors (heme, EDTA, ethanol) are shown in Figure 2.

[0068] Figure 3 The fluorescence quantitative PCR amplification curves of Taq-w1's resistance to different inhibitors (heme, EDTA, ethanol) are shown in Figure 2.

[0069] Figure 4 The fluorescence quantitative PCR amplification curves of Taq-w2's resistance to different inhibitors (heme, EDTA, ethanol) are shown in Figure 2.

[0070] Figure 5 The fluorescence quantitative PCR amplification curves of Taq-w3's resistance to different inhibitors (heme, EDTA, ethanol) are shown in Figure 2.

[0071] Figure 6 The fluorescence quantitative PCR amplification curves of Taq-w4's resistance to different inhibitors (heme, EDTA, ethanol) are shown in Figure 2.

[0072] Figure 7The figures are electrophoresis diagrams of fluorescence quantitative PCR results of different enzymes without and with different inhibitors (heme, EDTA, ethanol); wherein, Figure A is wild-type Taq DNA polymerase, Figure B is Taq-w1, Figure C is Taq-w2, Figure D is Taq-w3, and Figure E is Taq-w4; M in each figure is GL DNAMarker 2000, lanes 1 to 4 are groups without adding inhibitors, lanes 5 to 8 are groups with adding 35 μM heme, lanes 9 to 12 are groups with adding 5 mM EDTA, and lanes 13 to 16 are groups with adding 7% ethanol. DETAILED DESCRIPTION

[0073] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0074] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0075] In the description of the present invention, the terms "comprises" and "having" and any variations thereof are intended to cover non-exclusive inclusions. For example, a process, method or product comprising a series of steps or units is not necessarily limited to those steps or units explicitly listed, but may include other steps or units not explicitly listed or inherent to these processes, methods or products.

[0076] Unless otherwise defined, all scientific or technical terms in this patent are consistent with the common understanding of most ordinary persons in the field.

[0077] The following amino acid sequences are all in order from N-terminus to C-terminus; the nucleotide sequences are all in order from 5' to 3' end.

[0078] The term "amplification" refers to the process in which the number of target nucleic acid fragments increases under the action of nucleic acid polymerase.

[0079] In order to obtain a Taq DNA polymerase with good thermal stability and amplification performance, the wild-type Taq DNA polymerase (Taq-WT, NCBI Sequence ID: P19821.1, the amino acid sequence is shown in SEQ ID NO: 1, amino acids 10 to 841) was mutated and a large number of screenings were performed to obtain Taq DNA polymerase mutants (Taq-w1 to Taq-w4).

[0080] Taq DNA polymerase mutants (Taq-w1 to Taq-w4) are all mutated based on the amino acid sequence of Taq-WT. The specific amino acid mutations of Taq-w1 are F73S, P93A, and E734G, and the amino acid sequence is shown in SEQ ID NO:3, positions 10 to 841. The specific amino acid mutations of Taq-w2 are F73S, P93A, and the amino acid sequence is shown in SEQ ID NO:4, positions 10 to 841. The specific amino acid mutations of Taq-w3 are F73S, P93A, and V155I, and the amino acid sequence is shown in SEQ ID NO:5, positions 10 to 841. The specific amino acid mutations of Taq-w4 are F73S, P93A, and L245M, and the amino acid sequence is shown in SEQID NO:6, positions 10 to 841. A 6× histidine tag is connected to the N-terminus of wild-type Taq DNA polymerase and Taq DNA polymerase mutants (Taq-w1 to Taq-w4) by connecting peptide GS. The corresponding nucleotide sequences are shown in SEQ ID NOs: 7 to 10.

[0081] Example 1

[0082] 1. Construction of expression vector:

[0083] Hunan Aikerui Bioengineering Co., Ltd. was commissioned to design a nucleotide sequence encoding a histidine tag (HHHHHH) and a connecting peptide (GS) at the 3' end based on the coding nucleotide sequence information of Taq-WT, Taq-w1 to Taq-w4, namely ATGCATCACCACCATCACCATGGTAGC (SEQ ID NO: 11), and synthesize the corresponding DNA molecules. The DNA molecules were then connected to the PET-28a vector by overlapping PCR to obtain recombinant expression vectors PET-28a / Taq-WT, PET-28a / Taq-w1, PET-28a / Taq-w2, PET-28a / Taq-w3 and PET-28a / Taq-w4.

[0084] Furthermore, PCR amplification was performed using the above-mentioned recombinant expression vector as a template, and then the PCR product was purified and recovered using the SteadyPure PCR reaction liquid purification kit (Hunan Aikerui Biotechnology Co., Ltd., Catalog No. AG21003). The recovered product was transformed into DH5α competent cells, and positive monoclonal clones were screened for sequencing verification. After verification, the results were consistent with expectations.

[0085] 2. Expression:

[0086] The recombinant expression vectors capable of expressing wild-type Taq DNA polymerase or Taq DNA polymerase mutants were transformed into host cells E. coli JM109, and single colonies were picked and inoculated into 100 mL LB medium containing 50 μg / mL ampicillin, respectively. After shaking and culturing in a 37°C shaker overnight, they were inoculated into 2 L LB medium containing 50 μg / mL ampicillin at a volume ratio of 1:100, and shaken and cultured in a 30°C shaker until 0 D 600 is 0.6-0.8; add IPTG to a final concentration of 0.4mmol / L, and continue to induce at 30℃ for 10h-12h; collect the induced bacteria by centrifugation and weigh them, record the wet weight of the bacteria, and store them at -80℃.

[0087] 3. Purification:

[0088] Take the cells frozen at -80℃ after induction of expression, add 3mL lysis buffer (100mMTris-HCl, 0.2mM EDTA, pH 7.5) per gram of cells by wet weight to resuspend the cells to obtain a cell suspension. Use a high-pressure crusher to lyse the cells, the high-pressure crushing condition is 800bar, and the lysed cells are centrifuged at 4℃ and 12000rpm for 30min, take the supernatant A to a 200mL sterile beaker, and discard the precipitate A. Incubate the supernatant A in a 75℃ constant temperature water bath for 20min, centrifuge at 4℃ and 12000rpm for 30min, take the supernatant B to a 200mL sterile beaker, and discard the precipitate B. Pass the supernatant B through a 0.22μm microporous filter membrane to obtain a filtrate.

[0089] After balancing the chromatography column Ni-NTAPurose 6Fast Flow (purchased from Jiaxing Qianchun Biotechnology Co., Ltd.) with buffer A (50mM Tris-HCl, 0.1mM EDTA, 100mM KCl, 0.2% (v / v) Tween-20, pH7.5), the filtrate was loaded into the chromatography column. After loading, the column was first rinsed with buffer A, and then 0% to 100% gradient elution was performed with buffer B (50mM Tris-HCl, 0.1mM EDTA, 100mM KCl, 700mM imidazole, 0.2% (v / v) Tween-20, pH7.5), and the eluted fractions were subjected to SDS-PAGE protein electrophoresis detection. According to the detection results, the eluate A containing the target protein was collected, and the eluate A was dialyzed into buffer A, and the dialyzate A was collected.

[0090] After balancing the chromatography column Q Purose 6 Fast Flow 6mL (purchased from Jiaxing Qianchun Biotechnology Co., Ltd.) with buffer A, the dialysate A was loaded into the chromatography column. After loading, the column was first rinsed with buffer A, and then eluted with buffer C (50mMTris-HCl, 0.1mM EDTA, 700mM KCl, 0.2% (v / v) Tween-20, pH7.5) for 0% to 100% gradient elution, and the eluted fraction was subjected to SDS-PAGE protein electrophoresis detection. According to the detection results, the eluate B containing the target protein was collected, and the eluate B was dialyzed into an enzyme preservation solution (20mM Tris-HCl, 0.1mM EDTA, 100mM KCl, 0.5% (v / v) Tween-20, 1mM DTT, 50% (v / v) glycerol, pH7.5), and the dialysate B was collected. This dialysate B is the enzyme protein finally obtained.

[0091] Take 30 μL of each of the Taq-WT and Taq-w1 to Taq-w4 enzyme proteins obtained after the above purification steps, and analyze the purification results by SDS-PAGE electrophoresis. Figure 1 shown.

[0092] Test Example 1

[0093] This test example detects the DNA polymerase activity of Taq-WT, Taq-w1 to Taq-w4.

[0094] In a certain period of time, a control curve is established based on the amount of product obtained under different enzyme addition amounts of commercial DNA polymerase, and a curve of the DNA polymerase to be tested is established at the same time. The ratio of the slopes of the two is calculated, which can be used to determine the enzyme activity of the DNA polymerase to be tested. A hairpin oligonucleotide sequence is designed. Under the catalysis of DNA polymerase, dNTPs gradually infiltrate, and the hairpin oligonucleotide sequence will eventually form a double-stranded DNA product. SYBR Green I is a highly sensitive fluorescent dye that binds to double-stranded DNA. It can bind to double-stranded DNA to produce a fluorescent signal, and its fluorescent signal intensity is positively correlated with the concentration of double-stranded DNA. By measuring the fluorescent signal value within a certain period of time, the enzyme activity value of the DNA polymerase to be tested can be calculated.

[0095] (1) Dilute Taq-WT, Taq-w1 to Taq-w4 appropriately with enzyme storage solution and use Micro BCA TM Protein Assay Kit (purchased from Thermo Fisher Scientific, catalog number 23235) was used to determine the protein concentration. For specific concentration determination methods, refer to the instruction manual of the kit.

[0096] (2) Enzyme activity assay: A hairpin oligonucleotide sequence was designed (Test 1: 5'-TAGCGAAGGATGTGAACCTAATCCCTGCTCCCGCGGCCGATCTGCCGGCCGCGGGAGCA-3'). According to the brightness of the protein liquid band finally obtained in the SDS-PAGE electrophoresis diagram, the enzyme activity of the purified Taq-WT, Taq-w1 to Taq-w4 mutants was calculated in advance at a certain ratio to obtain an estimated enzyme activity value, and the enzyme preservation solution was used to dilute the enzyme activity value to an estimated value of about 5U / μL. The enzyme preservation solution was further used to dilute the commercial Taq DNA polymerase (purchased from Thermo Fisher Scientific, catalog number 18038018, as the control group), Taq-WT, Taq-w1 to Taq-w4 at different multiples to obtain the diluted enzyme solution. Add 5 μL of diluted enzyme solution to 20 μL reaction system (25mmol / L Tris-HCl, 50mmol / L KCl, 5mmol / L (NH4)2SO4, 2.5mmol / L MgC12, 0.1% TritonX-100, 0.25mmol / L dNTPs, 0.5μmol / L Test 1, pH 8.5), react at 74℃ for 5min, immediately cool on ice, and add EDTA to a final concentration of 10mM to terminate the reaction; add 1×SYBR dye solution at a volume ratio of 1:30, and use a microplate reader for detection. Note that 2 parallels are prepared for each dilution multiple to reduce experimental errors, and 2 blank controls are prepared for each reaction to deduct the fluorescence background. Export the original fluorescence signal value data, deduct the fluorescence background signal value, and calculate the slope value of the fluorescence signal value and the enzyme amount.

[0097] The results are shown in Table 1.

[0098] Table 1

[0099] Group Protein concentration (μg / μL) Initial enzyme activity (U / μL) Specific enzyme activity (U / μg) Taq-WT 2.035 102.5 50.4 Taq-w1 1.750 216.8 123.9 Taq-w2 3.180 263.4 82.8 Taq-w3 1.691 170.4 100.8 Taq-w4 1.818 185.2 101.9

[0100] Compared with Taq-WT, Taq-w1 to Taq-w4 have higher specific enzyme activities, about 1.6-2.5 times higher.

[0101] Test Example 2

[0102] This test example tests the thermal stability of Taq-WT, Taq-w1 to Taq-w4. According to the enzyme activity results of Test Example 1, Taq-WT, Taq-w1 to Taq-w4 were diluted with enzyme preservation solution to the same appropriate enzyme activity concentration, and then heat-treated at 95°C for 1 hour. Then, the fluorescence value was determined according to the "enzyme activity determination" method of Test Example 1, and the enzyme activity and residual enzyme activity after heat treatment were calculated. Taq-WT or Taq DNA polymerase mutants that were not heat-treated were used as the untreated group.

[0103] The results are shown in Table 2.

[0104] Table 2

[0105] Group Initial enzyme activity (U / μL) Enzyme activity after heat treatment (U / μL) Remaining enzyme activity (%) Taq-WT 102.5 44.7 43.57 Taq-w1 216.8 173.4 80.00 Taq-w2 263.4 203.0 77.06 Taq-w3 170.4 130.1 76.32 Taq-w4 185.2 137.4 74.21

[0106] After heat treatment at 95°C for 1 h, the residual enzyme activities of Taq-w1 to Taq-w4 were all greater than 50%, much higher than Taq-WT, and had better thermal stability.

[0107] Test Example 3

[0108] This test example uses the fluorescent quantitative PCR method to detect the anti-inhibition ability of Taq-w1 to Taq-w4. Using 5ng of Human cDNA as a template, a 100bp fragment was amplified using wild-type Taq DNA polymerase and each Taq DNA polymerase mutant. The 25μL qPCR reaction system is: 25mmol / L Tris-HCl, 100mmol / L KC1, 5mmol / L MgCl2, 50μg / mL BSA, 300μmol / L dNTPs, 0.2μmol / L upstream primer qPCR-F-100bp, 0.2μmol / L downstream primer qPCR-R-100bp, 0.2μmol / L probe primer qPCR-Probe-100bp, 1U enzyme, 7% (V / V) ethanol or 5mM EDTA or 35μM heme, pH 8.5. The reaction procedure was: 95℃30s; 95℃5s, 60℃30s / cycles, for a total of 45 cycles. Four replicate wells were tested for each sample. After the reaction was completed, the amplification curve was analyzed, and the reaction products were detected by electrophoresis using 3% agarose gel. The nucleotide sequences of the primers and probes used are as follows:

[0109] qPCR-F-100bp: 5'-GCGTATAGTAAGGCTGCAACA-3';

[0110] qPCR-R-100bp: 5'-CTGCAAAGGTGATTTTCCCT-3';

[0111] qPCR-Probe-100bp: 5'FAM-ACTGGTAAACTGGTCCATGC-3'BHQ1.

[0112] The experimental results are as follows Figure 2-Figure 7 As shown in Table 3 and Table 4.

[0113] Table 3 shows the statistical results of the mean CT values ​​and ΔCT values ​​of each replicate well of Taq-WT and Taq-w1 to Taq-w4 by fluorescence quantitative PCR detection; Table 4 shows the mean fluorescence signal value and the ratio of fluorescence signal value of each replicate well of Taq-WT and Taq-w1 to Taq-w4 by fluorescence quantitative PCR detection.

[0114] Table 3

[0115] Group Taq-WT Taq-w1 Taq-w2 Taq-w3 Taq-w4 Mean CT value without inhibitor 24.7 23.48 23.81 23.56 23.77 7% ethanol CT value mean / 23.68 23.23 22.17 22.72 5mM EDTA CT value average / 24.42 23.86 24.01 24.40 Mean CT value of 35μM hemoglobin / 27.48 28.27 29.65 29.59 ΔCT value without inhibitor / 1.22 0.89 1.14 0.93 7% ethanol ΔCT value / -0.20 0.58 1.39 1.05 5mM EDTAΔCT value / -0.94 -0.05 -0.45 -0.63 ΔCT value of 35μM hemoglobin / -4.00 -4.46 -6.09 -5.82

[0116] Note: ΔCT value without inhibitor = Taq-WT CT mean without inhibitor - mutant CT mean without inhibitor; ΔCT value with each inhibitor added = mutant CT mean without inhibitor - mutant CT mean with inhibitor.

[0117] Table 4

[0118] Group Taq-WT Taq-w1 Taq-w2 Taq-w3 Taq-w4 Mean fluorescence signal value without inhibitor 752622.9 891694.21 1133910.88 922647.07 1021345.06 7% ethanol fluorescence signal value average / 333405.93 435439.93 429679.95 392112.30 Average fluorescence signal value of 5mM EDTA / 334526.44 476492.89 435447.55 434387.84 Average fluorescence signal value of 35μM hemoglobin / 278304.59 238502.68 223930.48 221203.14 Fluorescence signal ratio without inhibitor / 1.18 1.51 1.23 1.36 7% ethanol fluorescence signal value ratio / 0.37 0.38 0.47 0.38 5mM EDTA fluorescence signal ratio / 0.38 0.42 0.47 0.43 35μM hemoglobin fluorescence signal ratio / 0.31 0.21 0.24 0.22

[0119] Note: The ratio of fluorescence signal values ​​without inhibitors = the average fluorescence signal value of mutant without inhibitors / the average fluorescence signal value of Taq-WT without inhibitors. The ratio of fluorescence signal values ​​with each inhibitor added = the average fluorescence signal value of the corresponding inhibitor of the mutant itself / the average fluorescence signal value of the mutant without inhibitors.

[0120] Under the same reaction system and reaction conditions, the CT values ​​and fluorescence signal values ​​of Taq DNA polymerase mutants Taq-w1 to Taq-w4 were advanced and improved to a certain extent compared with wild-type Taq DNA polymerase when no inhibitors were added; after adding each inhibitor, the amplification ability of wild-type Taq DNA polymerase was inhibited, and there was no amplification curve and corresponding amplification band, while Taq-w1 to Taq-w4 could obtain amplification curves and corresponding amplification bands, and when adding 7% ethanol and 5mM EDTA at a final concentration, their CT values ​​remained basically unchanged. The results showed that the anti-inhibition ability of Taq-w1 to Taq-w4 was significantly improved.

[0121] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge scope of ordinary technicians in the relevant technical field without departing from the purpose of the present invention.

Claims

1. A Taq DNA polymerase mutant, characterized in that: Amino acid mutations are performed on the amino acid sequence of the wild-type Taq DNA polymerase, and the amino acid mutations include F73S and P93A; the amino acid sequence of the wild-type Taq DNA polymerase is shown in SEQ ID NO:

1.

2. The Taq DNA polymerase mutant according to claim 1, characterized in that The Taq DNA polymerase mutant further comprises at least one amino acid mutation among E734G, V155I and L245M.

3. A recombinant protein, characterized in that It comprises a tag and the Taq DNA polymerase mutant according to claim 1 or 2.

4. A biological material related to the Taq DNA polymerase mutant according to claim 1 or 2 or the recombinant protein according to claim 3, characterized in that: The biological material is any one of B1) to B4): B1), a nucleic acid molecule encoding the Taq DNA polymerase mutant according to claim 1 or 2 or the recombinant protein according to claim 3; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B4) A recombinant biological cell containing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3).

5. The biomaterial according to claim 4, characterized in that The nucleic acid molecule has any one of B11) to B19): B11), a DNA molecule having a nucleotide sequence as shown in positions 28 to 2526 of SEQ ID No: 7; B12), a DNA molecule having a nucleotide sequence as shown in positions 28 to 2526 of SEQ ID No: 8; B13), a DNA molecule having a nucleotide sequence as shown in positions 28 to 2526 of SEQ ID No:9; B14), a DNA molecule having a nucleotide sequence as shown in positions 28 to 2526 of SEQ ID No: 10; B18), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence shown in any one of B11) to B17), and encoding the Taq DNA polymerase mutant; B19), a DNA molecule that hybridizes with the nucleotide sequence defined in any one of B11) to B18) under stringent conditions and encodes the Taq DNA polymerase mutant.

6. An enzyme preparation, characterized in that It comprises the Taq DNA polymerase mutant according to claim 1 or 2 or the recombinant protein according to claim 3.

7. A method for preparing the Taq DNA polymerase mutant according to claim 1 or 2 or the recombinant protein according to claim 3, characterized in that: include: The Taq DNA polymerase mutant according to claim 1 or 2 or the coding gene of the recombinant protein according to claim 3 is introduced into a biological cell to express the coding gene, thereby obtaining the Taq DNA polymerase mutant.

8. A method for amplifying a DNA molecule, characterized in that: The method comprises the step of amplifying the DNA molecule using the Taq DNA polymerase mutant according to claim 1 or 2, the recombinant protein according to claim 3 or the enzyme preparation according to claim 6 as a DNA polymerase.

9. Use of any one of C1) to C4) in the preparation of nucleic acid amplification or sequencing products; C1), the Taq DNA polymerase mutant according to claim 1 or 2; C2), the recombinant protein according to claim 3; C3), the biological material according to claim 4 or 5; C4) The enzyme preparation according to claim 6.

10. Use of the Taq DNA polymerase mutant according to claim 1 or 2, the recombinant protein according to claim 3 or the enzyme preparation according to claim 6 in nucleic acid amplification or sequencing.

Images