A mutant of N-acetylneuraminic acid aldolase and its application in catalytic preparation of N-acetylneuraminic acid

Abstract

The present invention belongs to the field of genetic engineering, and in particular to a kind of N-acetylneuraminic acid aldolase mutant and its application in catalytic preparation of N-acetylneuraminic acid. The present invention is based on the amino acid of the wild-type N-acetylneuraminic acid aldolase in propionic acid Corynebacterium (Corynebacterium propinquum) source and is modified, by mutating the 149th valine of wild-type N-acetylneuraminic acid aldolase to lysine, the 233rd arginine to glutamine, the 235th lysine to aspartic acid, the 241st valine to arginine, and obtaining a kind of N-acetylneuraminic acid aldolase mutant with higher activity. Utilizing the highly active N-acetylneuraminic acid aldolase mutant to catalyze and produce N-acetylneuraminic acid, conversion efficiency is effectively improved, with important industrial application prospects.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to an N-acetylneuraminic acid aldolase mutant and its application in catalytic preparation of N-acetylneuraminic acid. Background Art

[0002] N-acetylneuraminic acid, also known as sialic acid, is a naturally occurring amino sugar found primarily in animal tissues and cells, particularly in high concentrations in neural tissue. It plays a vital role in numerous biological processes, participating in the synthesis of glycoproteins and glycolipids, in the construction and stabilization of cell membranes, influencing cell recognition and signaling, regulating immune responses, and exhibiting numerous biological activities, including anti-cancer, anti-inflammatory, antiviral, and antioxidant activities. Furthermore, N-acetylneuraminic acid is widely used in infant formula, where it promotes brain and nervous system development.

[0003] Currently, N-acetylneuraminic acid can be produced through extraction from natural raw materials, chemical synthesis, microbial fermentation, and enzymatic methods. Because N-acetylneuraminic acid is present in relatively low concentrations in natural raw materials and is susceptible to seasonal and environmental factors, and the separation and purification process is complex, natural raw material extraction is difficult to implement in industrial production. Chemical synthesis methods have harsh reaction conditions and require expensive and toxic metal catalysts, resulting in high costs and significant environmental pollution, thus limiting their large-scale production. Microbial fermentation methods primarily utilize inexpensive carbon sources such as glycerol or glucose to synthesize N-acetylneuraminic acid from scratch. While this method offers low raw material production costs, it also suffers from long fermentation cycles, low product concentrations, low conversion rates, and poor strain stability. Enzymatic synthesis of N-acetylneuraminic acid offers the advantages of mild reaction conditions, a pollution-free environment, and high conversion rates and purity, making it a promising method for industrial production. Currently, the production strategy of synthesizing N-acetylneuraminic acid by using a dual-enzyme catalytic system comprising N-acetylglucosamine isomerase and N-acetylneuraminic acid aldolase (NAL) is considered to be the most economical and classic method of enzyme catalysis. Based on this, the activity of N-acetylneuraminic acid aldolase directly affects the yield and conversion rate of N-acetylneuraminic acid synthesis. Therefore, improving the activity of N-acetylneuraminic acid aldolase has important application value for the synthesis of N-acetylneuraminic acid. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide an N-acetylneuraminic acid aldolase mutant with higher activity in view of the deficiencies in the prior art.

[0005] The technical problem that the present invention also aims to solve is to provide the use of the above-mentioned N-acetylneuraminic acid aldolase mutant in catalyzing the preparation of N-acetylneuraminic acid.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:

[0007] An N-acetylneuraminic acid aldolase mutant, characterized in that the N-acetylneuraminic acid aldolase mutant is obtained by mutating the valine at position 149 to lysine, the arginine at position 233 to glutamine, the lysine at position 235 to aspartic acid, and the valine at position 241 to arginine in the wild-type N-acetylneuraminic acid aldolase;

[0008] The wild-type N-acetylneuraminic acid aldolase is derived from Corynebacterium propinquum, and its amino acid sequence is shown in SEQ ID NO.1. The corresponding nucleotide sequence encoding the wild-type N-acetylneuraminic acid lyase gene is shown in SEQ ID NO.2.

[0009] The amino acid sequence of the N-acetylneuraminic acid aldolase mutant is shown in SEQ ID NO.3.

[0010] The nucleotide sequence of the gene encoding the N-acetylneuraminic acid aldolase is shown in SEQ ID NO.4.

[0011] The wild-type N-acetylneuraminic acid aldolase gene sequence was commissioned to General Biotech (Anhui) Co., Ltd. for full gene synthesis. To facilitate subsequent cloning, six bases, CATATG, were added to the 5′ end of the gene fragment to form an NdeI restriction site, and six bases, CTCGAG, were added to the 3′ end to form an XhoI restriction site.

[0012] A recombinant expression vector containing the nucleotide sequence of the N-acetylneuraminic acid aldolase is also within the scope of protection of the present invention.

[0013] A recombinant strain is obtained by introducing the encoding gene into a host strain, or by introducing the encoding gene into a host strain via the recombinant expression vector.

[0014] Wherein, the host strain is Escherichia coli Rosetta (DE3).

[0015] Among them, after the recombinant strain was induced to express, it was found through a 10mL enzyme activity assay system that the activity of the N-acetylneuraminic acid aldolase mutant was significantly improved, and its enzyme activity was about 3.9 times that of the wild-type N-acetylneuraminic acid aldolase.

[0016] Specifically, the enzyme activity is defined as the amount of enzyme required to produce 1 μmol N-acetylneuraminic acid per minute, and the enzyme activity unit is calculated per gram of wet bacteria.

[0017] The application of the N-acetylneuraminic acid aldolase in catalyzing the preparation of N-acetylneuraminic acid is also within the scope of protection of the present invention.

[0018] The catalysis uses N-acetylglucosamine and sodium pyruvate as substrates and utilizes N-acetylglucosamine isomerase and N-acetylneuraminic acid aldolase as dual enzyme coupling catalysis to synthesize N-acetylneuraminic acid.

[0019] The catalytic reaction system is: 400-1000 mM N-acetylglucosamine, 600-1500 mM sodium pyruvate, 10-100 g / L N-acetylglucosamine isomerase, 10-100 g / L N-acetylneuraminic acid aldolase, and 0.1-0.5% Triton X-100.

[0020] The catalytic reaction conditions are as follows: 35-40° C., pH 6.0-8.0, and reaction time of 20-30 hours.

[0021] In some embodiments of the present invention, the catalytic reaction system and conditions are as follows: 800 mM N-acetylglucosamine and 1200 mM sodium pyruvate are added to a 3 L reaction system, respectively, and after adjusting the pH to 7.5, a final concentration of 50 g / L N-acetylglucosamine isomerase, 50 g / L N-acetylneuraminic acid aldolase, and 0.2% Triton X-100 are added at 37°C, and the reaction is carried out for 24 hours to generate N-acetylneuraminic acid.

[0022] Beneficial Effects: The present invention obtains an N-acetylneuraminic acid aldolase with significantly improved activity by subjecting wild-type N-acetylneuraminic acid aldolase from Corynebacterium propinquum to site-directed modification. The enzyme activity is 3.9 times that of the wild-type N-acetylneuraminic acid aldolase. In the present invention, the highly active N-acetylneuraminic acid aldolase is used to catalyze the production of N-acetylneuraminic acid, significantly increasing the concentration of N-acetylneuraminic acid and greatly improving the conversion efficiency. Therefore, the N-acetylneuraminic acid aldolase obtained by site-directed modification has extremely high catalytic application potential and broad application prospects in industrial applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The present invention will be further described below in detail with reference to the accompanying drawings, and the above and / or other advantages of the present invention will become more apparent.

[0024] Figure 1 It is a recombinant expression vector containing the wild-type N-acetylneuraminic acid aldolase encoding gene. DETAILED DESCRIPTION

[0025] The present invention will be further described below in conjunction with specific embodiments, and the above and / or other advantages of the present invention will become more apparent.

[0026] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials are commercially available unless otherwise specified.

[0027] Example 1: Construction and expression of wild-type N-acetylneuraminic acid aldolase

[0028] The amino acid sequence of the wild-type N-acetylneuraminic acid aldolase (denoted as WT) from Corynebacterium propinquum is shown in SEQ ID NO.1, and the corresponding nucleotide sequence of the gene encoding the wild-type N-acetylneuraminic acid aldolase is shown in SEQ ID NO.2.

[0029] The wild-type N-acetylneuraminic acid aldolase gene (SEQ ID NO. 2) was commissioned to General Biotechnology (Anhui) Co., Ltd. for full gene synthesis. To facilitate subsequent cloning, six bases of CATATG were added to the 5' end of the gene fragment to form an NdeI restriction site, and six bases of CTCGAG were added to the 3' end to form an XhoI restriction site.

[0030] The synthesized N-acetylneuraminic acid aldolase gene and pET28a vector were double-digested with NdeI and XhoI (purchased from TaKaRa), respectively, and the fragments were recovered using a DNA gel kit (purchased from TaKaRa). The N-acetylneuraminic acid aldolase gene fragment was ligated with the linearized pET28a vector using the following ligation system: 4 μL of purified DNA fragment, 1 μL of linearized pET28a vector, and 5 μL of Solution I. The reaction was carried out at 16°C for 2 hours to obtain the recombinant expression vector. The recombinant expression vector was then transformed into Escherichia coli Rosetta (DE3) competent cells and cultured on LB plates (containing a final concentration of 50 mg / L kanamycin and 34 mg / L chloramphenicol) at 37°C for 12 hours to obtain clones. Three clones were selected and cultured in LB medium (containing a final concentration of 50 mg / L kanamycin and 34 mg / L chloramphenicol) at 37°C, 200 rpm for 12 hours before being sent for sequencing.

[0031] Among them, the plasmid construction diagram of the recombinant expression vector (pET28a-NAL) of wild-type N-acetylneuraminic acid aldolase is as shown in FIG. Figure 1 shown.

[0032] A single colony of the recombinant Escherichia coli expressing the correctly sequenced wild-type N-acetylneuraminic acid aldolase was inoculated into 20 mL of LB medium (containing kanamycin at a final concentration of 50 mg / L and chloramphenicol at 34 mg / L) and cultured at 37°C and 200 rpm for 12 hours. The colony was then transferred to 1 L of TB medium (containing kanamycin at a final concentration of 50 mg / L and chloramphenicol at a final concentration of 34 mg / L) at a 1% v / v inoculum and cultured at 37°C and 200 rpm until the OD 600 When the pH value was 0.6-0.8, IPTG was added at a final concentration of 0.2 mM, and the induction culture was continued at 28°C and 200 rpm for 12-16 h. The culture solution was centrifuged at 8000 rpm for 10 min, and the wild-type N-acetylneuraminic acid aldolase bacteria were collected and stored in a -80°C refrigerator.

[0033] Example 2: Construction and expression of N-acetylneuraminic acid aldolase mutant (single point mutation)

[0034] N-acetylneuraminic acid aldolase mutants were constructed using a full-plasmid PCR method. The designed mutant primers are shown in Table 1. PCR amplification was performed using the plasmid pET28a-NAL constructed in Example 1 as a template and the corresponding primers. The PCR reaction system included: 5 μL 10× PCR Buffer, 5 μL 2 mM dNTPs, 1.5 μL each of 10 pmol / μL primer F and primer R, 1 μL plasmid template, 1 μL KOD-Plus-Neo polymerase (purchased from Toyobo Co., Ltd.), and finally, the volume was adjusted to 50 μL with sterile distilled water. The PCR reaction parameters were: 94°C melting for 2 minutes, 98°C denaturation for 10 seconds, 60°C annealing for 30 seconds, 68°C extension for 3 minutes and 30 seconds, 30 cycles, 68°C fill for 5 minutes, and then storage at 4°C.

[0035] Table 1 Primer sequences corresponding to each mutation site

[0036]

[0037]

[0038] The PCR product was digested with DpnI (purchased from TaKaRa) using the following system: 8.5 μL of PCR product, 1 μL of 10× QuickCut Buffer, and 1 μL of DpnI at 37°C for 0.5 h. The cells were then transformed into E. coli Rosetta (DE3) competent cells and cultured on LB plates (containing a final concentration of 50 mg / L kanamycin and 34 mg / L chloramphenicol) at 37°C for 12 hours to obtain clones. Three clones were selected and cultured in LB medium (containing a final concentration of 50 mg / L kanamycin and 34 mg / L chloramphenicol) at 37°C, 200 rpm for 12 hours before being sequenced. After correct sequencing, single-point mutants were induced to express in the same manner as described for the wild-type N-acetylneuraminic acid aldolase WT in Example 1.

[0039] Example 3: Enzyme activity detection of wild-type and mutant (single-point mutation) N-acetylneuraminic acid aldolase

[0040] The enzyme activity assay system in 10 mL of culture medium consists of 20 mM N-acetylmannosamine and 20 mM sodium pyruvate. After adjusting the pH to 7.5, 10 g / L of N-acetylneuraminic acid aldolase cells and 0.2% Triton X-100 were added. The reaction was shaken at 200 rpm at 37°C. Samples were taken every 30 minutes and quenched by boiling in a water bath. The N-acetylneuraminic acid aldolase activity was defined as the amount of enzyme required to produce 1 μmol of N-acetylneuraminic acid per minute. Activity units were calculated per gram of wet culture medium.

[0041] Table 2 Comparison of enzyme activities of wild-type N-acetylneuraminic acid aldolase and mutants (single point mutations)

[0042]

[0043]

[0044] The experimental results are shown in Table 2. The results show that the wild-type enzyme activity is 3.2 U / g. After single-point mutation, the enzyme activity of the mutants increased and decreased. Mutations at K235D, V149K, R233Q, and V241R significantly increased the enzyme activity, with the corresponding relative activity exceeding 120%. Combinations of any two or more of these sites were subsequently selected for combined mutagenesis.

[0045] Example 4: Construction, expression and enzyme activity detection of N-acetylneuraminic acid aldolase mutants (combined mutations)

[0046] Combination mutations are constructed by using plasmids containing single-, double-, or triple-point mutants as templates and then performing full-plasmid PCR. The specific process is as follows:

[0047] (1) Construction and expression of mutant V149K-K235D

[0048] The plasmid of the single point mutant V149K was used as a template and PCR amplification was performed using primers 235-F and 235-R. The PCR amplification process, enzyme digestion and transformation of the PCR product, and induced expression of the mutant V149K-K235D were the same as in Example 2.

[0049] (2) Construction and expression of the mutant V149K-R233Q-K235D

[0050] Using the plasmid of the single-point mutant V149K as a template, PCR amplification was performed using primers 233-235-F and 233-235-R (233-235-F: acatgagacctgccaagcggacaactgggac, 233-235-R: gtcccagttgtccgcttggcaggtctcatgt). The PCR amplification process, PCR product digestion and transformation, and induced expression of the mutant V149K-R233Q-K235D were the same as in Example 2.

[0051] (3) Construction and expression of the mutant V149K-R233Q-K235D-V241R

[0052] The plasmid of the triple-point mutant V149K-R233Q-K235D was used as a template and PCR amplification was performed using primers 241-F and 241-R. The PCR amplification process, enzyme digestion and transformation of the PCR product, and induced expression of the mutant V149K-R233Q-K235D-V241R were the same as in Example 2.

[0053] The enzyme activity of the combined mutants was tested in the same manner as in Example 3.

[0054] Table 3 Comparison of enzyme activities of wild-type N-acetylneuraminic acid aldolase and mutants (combined mutations)

[0055]

[0056]

[0057] The results (Table 3) showed that after combined mutations, the mutant V149K-R233Q-K235D-V241R exhibited the highest enzyme activity, at 12.6 U / g, representing a relative activity 3.9 times that of the wild-type. The amino acid sequence of this N-acetylneuraminic acid aldolase mutant is shown in SEQ ID NO. 3, and the corresponding nucleotide sequence is shown in SEQ ID NO. 4.

[0058] Example 5: Application of N-acetylneuraminic acid aldolase mutants in catalytic production of N-acetylneuraminic acid

[0059] To a 3 L reaction system, add 800 mM N-acetylglucosamine and 1200 mM sodium pyruvate, adjust the pH to 7.5, then add 50 g / L N-acetylglucosamine isomerase, 50 g / L N-acetylneuraminic acid aldolase, and 0.2% Triton X-100 to a final concentration of 50 g / L at 37°C. React for 24 h to prepare N-acetylneuraminic acid.

[0060] The determination method of N-acetylneuraminic acid is as follows: high performance liquid chromatography is used, using a differential refractive index detector and an AMINEX HPX-87H, a 300mm×7.8mm chromatographic column, a 5mM dilute sulfuric acid aqueous solution as the mobile phase, a flow rate of 0.4mL / min, a column temperature of 50°C, and a detection cell temperature of 35°C.

[0061] Comparing the catalytic performance of wild-type N-acetylneuraminic acid aldolase (WT) and mutant V149K-R233Q-K235D-V241R, the specific results are shown in Table 4. The mutant N-acetylneuraminic acid aldolase produced an N-acetylneuraminic acid concentration of 118.4 g / L with a conversion yield of 47.9%, while the wild-type N-acetylneuraminic acid aldolase produced an N-acetylneuraminic acid concentration of 66.5 g / L with a conversion yield of 26.9%. Compared to the wild-type, the mutant produced a significantly higher concentration of N-acetylneuraminic acid, and the conversion efficiency was also greatly improved.

[0062] Table 4 Comparison of catalytic effects of wild-type N-acetylneuraminic acid aldolase and mutants

[0063] strain 24h N-acetylneuraminic acid production (g / L) Conversion rate (%) WT 66.5 26.9 V149K-R233Q-K235D-V241R 118.4 47.9

[0064] The present invention provides a concept and method for an N-acetylneuraminic acid aldolase mutant and its use in the catalytic production of N-acetylneuraminic acid. There are many methods and approaches for implementing this technical solution. The above is merely a preferred embodiment of the present invention. It should be noted that those skilled in the art may make various improvements and modifications without departing from the principles of the present invention, and such improvements and modifications are also within the scope of protection of the present invention. Any components not specified in this embodiment may be implemented using existing technologies.

Claims

1. An N-acetylneuraminic acid aldolase mutant, characterized in that The N-acetylneuraminic acid aldolase mutant is obtained by mutating the 149th valine of the wild-type N-acetylneuraminic acid aldolase to lysine, the 233rd arginine to glutamine, the 235th lysine to aspartic acid, and the 241st valine to arginine; Wherein, the amino acid sequence of the wild-type N-acetylneuraminic acid aldolase is shown in SEQ ID NO. 1; The amino acid sequence of the N-acetylneuraminic acid aldolase mutant is shown in SEQ ID NO.

3.

2. The gene encoding the N-acetylneuraminic acid aldolase mutant according to claim 1, characterized in that: The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

4.

3. A recombinant expression vector, characterized in that: The recombinant expression vector contains the coding gene according to claim 2.

4. A recombinant strain, characterized in that The recombinant strain is obtained by introducing the encoding gene according to claim 2 into a host strain, or by introducing the encoding gene according to claim 2 into a host strain via the recombinant expression vector according to claim 3.

5. Use of the N-acetylneuraminic acid aldolase mutant according to claim 1 in catalytic production of N-acetylneuraminic acid.

6. The use according to claim 5, characterized in that The catalysis uses N-acetylglucosamine and sodium pyruvate as substrates and utilizes N-acetylglucosamine isomerase and N-acetylneuraminic acid aldolase mutant double enzyme coupling catalysis to synthesize N-acetylneuraminic acid.

7. The use according to claim 6, characterized in that The catalysis reaction system is as follows: 400-1000 mM N-acetylglucosamine, 600-1500 mM sodium pyruvate, 10-100 g / L N-acetylglucosamine isomerase, 10-100 g / L N-acetylneuraminic acid aldolase mutant, and 0.1-0.5% Triton X-100.

8. The use according to claim 6 or 7, characterized in that The catalytic reaction conditions are as follows: 35-40° C., pH=6.0-8.0, and reaction time of 20-30 h.

Images