HSV-1 replication-deficient recombinant virus vector and application thereof

Abstract

The invention discloses an HSV-1 replication-deficient recombinant virus vector and an application of the HSV-1 replication-deficient recombinant virus vector. Specifically, the method comprises the following steps: performing gene editing on a specific genome segment in an HSV-1 genome to obtain an HSV-1 replication-defective recombinant virus vector; wherein compared with the existing HSV-1 replication-deficient recombinant virus vector, the HSV-1 replication-deficient recombinant virus vector can express an exogenous gene more efficiently, and the HSV-1 replication-deficient recombinant virus vector, as an excellent delivery vector, can play a role in supplementing normal keratin.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an HSV-1 replication-deficient recombinant virus vector and an application thereof. Background Art

[0002] Epidermolysis bullosa (EB), also known as hemidesmosomal epidermolysis bullosa and hereditary epidermolysis bullosa, comprises a group of rare, clinically and genetically heterogeneous inherited skin disorders with an estimated 500,000 cases worldwide. It is characterized by moderate to extreme fragility of the epithelial tissue, with skin blisters or erosions occurring after minor trauma or friction (mechanical bullous dermatoses). The pathogenic mechanism is a genetic defect in epidermal keratins or interepidermal anchoring proteins that results in altered skin architecture. Epidermolysis bullosa simplex (EBS), the most common subtype of EB, is characterized by fragility of the skin (and in some cases mucosal epithelial cells) resulting in non-scarring blisters and erosions in response to minor mechanical trauma. EBS is distinguished from other types of EB or non-EB skin fragility syndromes by the location of the blisters relative to the dermal-epidermal junction. In EBS, the blisters occur within basal keratinocytes. The severity of the blisters ranges from being confined to the hands and feet to widespread involvement. Other features may include hyperkeratosis of the palms and soles (keratoderma), nail dystrophy, milia, and hyper- and / or hypopigmentation. Rare subtypes of EBS are associated with other clinical features, including pyloric atresia, muscular dystrophy, cardiomyopathy, and / or renal disease.

[0003] EBS pathogenic genes include KRT5, KRT14, PLEC, EXPH5, ​​TGM5, JUP, PKP1, DST, CD151, KLHL24, and DSP. Most EBS is inherited in an autosomal dominant manner, and a few are inherited in an autosomal recessive manner. Autosomal dominant EBS is associated with heterozygous dominant negative variants in KRT5, KRT14, or PLEC or heterozygous pathogenic variants in KLHL24. Autosomal recessive EBS is associated with biallelic loss-of-function variants in KRT5, KRT14, or PLEC or biallelic pathogenic variants in CD151, DST, or EXPH5. More than 75% of EBS is caused by mutations in the KRT5 and KRT14 genes, most of which are heterozygous dominant negative variants, and a few are biallelic recessive variants. In rare cases, EBS is caused by heterozygous pathogenic variants in KRT5 and KRT14 and is inherited in a digenic manner. The KRT5 and KRT14 genes encode basal epidermal keratins 5 and 14, respectively. Both keratin 5 and keratin 14 have a central rod-shaped alpha-helical structure and non-helical structures on both sides (head and tail). At the beginning and end of the central rod-shaped region, there are two highly conserved amino acid sequences, called the helix start peptide (HIP) and the helix end peptide (HTP). Mutations in the KRT5 and KRT14 genes affect HIP and HTP, inhibiting the tail-to-tail polymerization of keratin fibers and causing severe damage to the cytoskeleton, leading to epidermal fragility to friction stress and the occurrence of clinical phenotypes. Mutations in the PLEC1 gene, which encodes the plectin protein, can cause muscular dystrophy and pyloric atresia EBS. In most cases, the location of the mutation determines the severity of the clinical phenotype. For example, mutations in HIP and HTP that affect keratin filament assembly cause the most severe Dowling-Meara type of EBS (EBS-DM); mutations usually cause localized EBS in the non-helical linker region; while mutations in the Koebner type of EBS (EBS-K) are more widely distributed on the keratin 5 and keratin 14 polypeptides. To date, more than 150 different pathogenic mutations associated with these genes have been documented, most of which are associated with more severe EBS-DM.

[0004] In dominant negative mutations, a mutation in one of a pair of alleles will cause the functional activity of the other normal allele to be lost. Therefore, for gene therapy of dominant negative mutant genes, simply supplementing normal genes cannot achieve therapeutic effects. Gene editing methods such as CRISPR homologous recombination, single base editing, prime editing, and RNA editing can edit mutation sites into normal gene sites, which are feasible methods for dominant negative mutation gene therapy. However, a gene editing product can only target one mutation. For mutant genes without mutation hotspots, it is not feasible for gene editing to cover all mutations. In addition, the efficiency of gene editing and the safety risks caused by off-target have not been completely resolved, and the risk of drugability is high.

[0005] Herpes simplex virus (HSV) belongs to the herpesviridae family and is an enveloped double-stranded DNA virus, including two subtypes: type I (HSV-1) and type II (HSV-2). Currently, HSV-1 viral vectors have been used in gene therapy for major diseases such as tumors, neurodegenerative diseases, genetic diseases, and immune system diseases. Compared with other gene therapy viral vectors, HSV-1 viral vectors have many advantages. The genome of HSV-1 is relatively large ( Figure 1 ), which can carry larger or multiple exogenous genes. The HSV-1 genome is up to 152 kb, while the AAV genome, a commonly used gene therapy viral vector, is only about 4.7 kb. Of the more than 80 known genes in the HSV-1 genome, about half are non-essential genes in in vitro culture and can be replaced by multiple exogenous therapeutic genes. Its maximum exogenous gene insertion amount can reach 30-40 kb. This is particularly important for the treatment of many diseases, especially those related to multiple genes. HSV-1 does not integrate with cell DNA, its replication is controllable, and it is highly safe. HSV-1 rarely causes life-threatening diseases in immunocompetent adults [Shen Y, Nemunaitis J. Herpessimplex virus 1 (HSV-1) for cancer treatment [J]. Cancer Gene Therapy, 2006, 13 (11): 975-992]. Herpes simplex virus type 1 (HSV-1) is considered to be a very promising viral vector in gene therapy due to its wide range of host cells and high safety. Affected by viral regulatory elements, the insertion position of exogenous genes greatly affects the expression level of exogenous genes. How to obtain HSV-1 viral vectors with high efficiency in expressing exogenous genes is also one of the problems that urgently need to be solved. Summary of the invention

[0006] The present invention provides an HSV-1 replication-deficient recombinant viral vector and its application. Specifically, the present application is directed to a specific region of the HSV-1 genome (e.g. Figure 2 The HSV-1 replication-deficient viral vector can be obtained by transformation. The viral vector obtained in the present application can be used to deliver exogenous genes to effectively treat dominant negative mutation gene diseases such as epidermolysis bullosa.

[0007] Specifically, this application involves the following technical solutions:

[0008] Item 1. A short hairpin RNA (shRNA) for knocking down the KRT5 gene and / or the KRT14 gene, comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0009] Item 2. The short hairpin RNA according to Item 1, comprising a nucleotide sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0010] Item 3. A nucleic acid construct comprising the short hairpin RNA described in Item 1 or 2.

[0011] Item 4. The nucleic acid construct according to Item 3, which is a nucleic acid construct composed of the short hairpin RNA according to Item 1 or 2 and a miRNA backbone, wherein the short hairpin RNA replaces the targeting region in the miRNA backbone.

[0012] Item 5. The nucleic acid construct according to Item 4, wherein the miRNA is selected from one or more of miR30, miR155 and miR17-92.

[0013] Item 6. The nucleic acid construct described in Item 4 or 5 comprises the nucleotide sequence shown in SEQ ID NO: 45 or 46 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0014] Item 7. A vector comprising the short hairpin RNA described in Item 1 or 2 or the nucleic acid construct described in any one of Items 3 to 6.

[0015] Item 8. The vector of Item 7, which includes a plasmid, a lipid nanoparticle (LNP), a transposon, a cosmid, a bacterial artificial chromosome, a virus-like particle (VLP) and a viral vector, optionally, the viral vector includes a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector or a herpes simplex viral vector.

[0016] Item 9. A cell comprising the vector of Item 8, optionally, the cell is a prokaryotic cell or a eukaryotic cell.

[0017] Item 10. A vector system for treating epidermolysis bullosa (EB), comprising one or more vectors, wherein the one or more vectors include:

[0018] 1) a nucleotide sequence targeting a mutant gene causing EB, for knocking out or knocking down the mutant gene causing EB; and

[0019] 2) the nucleotide sequence encoding the normal gene corresponding to the mutant gene causing EB,

[0020] The components 1) and 2) are located on the same or different carriers of the system.

[0021] Item 11. The vector system according to Item 10, wherein the EB-causing mutant gene comprises one or more genes selected from the group consisting of KRT5, KRT14, PLEC, KLHL24, CD151, DST, EXPH5, ​​TGM5, JUP, PKP1, and DSP.

[0022] Item 12. The vector system according to Item 10 or 11, wherein the vector comprises a plasmid, a lipid nanoparticle (LNP), a transposon, a cosmid, a bacterial artificial chromosome, a virus-like particle (VLP) and a viral vector, optionally, the viral vector comprises a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector or a herpes simplex viral vector.

[0023] Item 13. A vector system according to any one of Items 10-12, wherein the EB-causing mutant gene is knocked out or knocked down by one or more methods selected from the following: CRISPR homologous recombination, single base editing, PrimeEditing, RNA interference and RNA editing.

[0024] Item 14. The vector system according to any one of Items 10 to 13, wherein the nucleotide sequence targeting the EB-causing mutant gene comprises siRNA, shRNA, microRNA (miRNA), a nucleic acid construct consisting of shRNA and microRNA, or sgRNA for knocking out or knocking down the EB-causing mutant gene.

[0025] Item 15. The vector system according to any one of Items 10 to 14, wherein the EB-causing mutant gene comprises the KRT5 gene and / or the KRT14 gene.

[0026] Item 16. The vector system according to any one of Items 10 to 15, wherein the vector is a herpes simplex virus vector, optionally a type I herpes simplex virus vector, and preferably, the herpes simplex virus vector genome is selected from the group consisting of ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, U L 41 genes, U L 55 genes, U L 56 genes and IR L / IR S One or more of the regions are disrupted or knocked out.

[0027] Item 17. A vector system according to Item 16, wherein the components 1) and 2) are located on the same or different herpes simplex virus vectors, and optionally, the components 1) and 2) are located on the same or different sites on the same herpes simplex virus vector, and the site is selected from one or more of the following disrupted or knocked-out gene sites: ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, U L 41 genes, U L 55 genes, U L 56 genes and IR L / IR S area.

[0028] Item 18. A vector system according to any one of Items 15-17, wherein the nucleotide sequence targeting the mutated gene causing EB includes a nucleotide sequence targeting the KRT5 gene and / or the KRT14 gene, and the nucleotide sequence is a shRNA for knocking down the KRT5 gene and / or the KRT14 gene, optionally, the shRNA comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0029] Item 19. The vector system according to any one of Items 10 to 17, wherein the nucleotide sequence targeting the mutant gene causing EB is a nucleic acid construct comprising a shRNA targeting the mutant gene causing EB and a miRNA backbone.

[0030] Item 20. The vector system according to Item 19, wherein the shRNA targeting the mutant gene causing EB is a shRNA targeting the KRT5 gene and / or the KRT14 gene.

[0031] Item 21. The vector system according to Item 20, wherein the shRNA targeting the KRT5 gene and / or the KRT14 gene comprises the short hairpin RNA described in Item 1 or 2.

[0032] Item 22. The vector system according to Item 19, wherein the miRNA is selected from one or more of miR30, miR155 and miR17-92.

[0033] Item 23. The vector system described in Item 21 or 22 comprises the nucleotide sequence shown in SEQ ID NO: 45 or 46 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0034] Item 24. The vector system of any one of Items 10-23, wherein the nucleotide sequence encoding keratin comprises the nucleotide sequence shown in SEQ ID NO:43 or 44 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0035] Item 25. A vector system according to any one of Items 16-24, further comprising an ICP34.5 gene and / or an IR L / IR S Regions are disrupted or knocked out.

[0036] Item 26. A composition comprising the carrier system according to any one of Items 10-25.

[0037] Item 27. The composition according to Item 26, which is a pharmaceutical composition, further comprising a pharmaceutically acceptable excipient.

[0038] Item 28. Use of the short hairpin RNA (shRNA) described in any one of Items 1-2, the nucleic acid construct described in any one of Items 3-6, the vector described in any one of Items 7-8, the vector system described in any one of Items 10-25, or the composition described in any one of Items 26-27 in the preparation of a drug for treating epidermolysis bullosa.

[0039] Item 29. The use according to Item 28, wherein the epidermolysis bullosa is epidermolysis bullosa simplex.

[0040] Item 30. A method for treating epidermolysis bullosa, comprising administering to a subject in need thereof an effective amount of the composition described in any one of Items 26-27.

[0041] Item 31. The method according to Item 30, wherein the epidermolysis bullosa is epidermolysis bullosa simplex.

[0042] It should be understood that within the scope of this application, the above-mentioned technical features of the present invention and the technical features described in detail below can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described in detail.

[0043] Since most EBS is caused by dominant negative mutant genes, the mutant gene expression products will cause the functional activity of normal gene expression products to be lost, so simply supplementing normal genes cannot achieve a therapeutic effect. The present invention provides a method for treating EBS, specifically, by simultaneously inserting 1) a sequence for knocking out the mutant keratin gene and 2) an exogenous normal keratin gene sequence into an HSV-1 replication-deficient viral vector, after delivery into skin cells, on the one hand, the mutant gene is knocked out to prevent its expression product from inhibiting the normal protein function, and on the other hand, the normal gene expression functional protein is supplemented, thereby restoring skin function. Among them, the supplemented exogenous normal gene has been sequence optimized, which is different from the wild-type gene sequence, so as to avoid the knockout gene sequence from shearing the supplemented exogenous normal gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Schematic diagram of the HSV-1 genome.

[0045] Figure 2 Schematic diagram of the ICP4 gene and ICP27 gene of HSV-1.

[0046] Figure 3 Schematic diagram of the recombinant viral vector A1.

[0047] Figure 4 Schematic diagram of the recombinant viral vector B1.

[0048] Figure 5 Schematic diagram of the recombinant viral vector A2.

[0049] Figure 6 Schematic diagram of the recombinant viral vector B2.

[0050] Figure 7 These are fluorescence microscopic images of green fluorescent protein expressed in Vero and CCC-ESF-1 cells infected with different recombinant viral vectors.

[0051] Figure 8 Schematic diagram of recombinant viral vector C.

[0052] Fig. 9 Schematic diagram of recombinant viral vector D.

[0053] Fig.10 Schematic diagram of recombinant viral vector E.

[0054] Fig.11 Schematic diagram of recombinant viral vector F.

[0055] Fig.12 Schematic diagram of the recombinant viral vector G.

[0056] Fig.13 These are the results of expression verification of genes carried by HSV-1 replication-deficient recombinant viral vectors.

[0057] Fig.14 This is the effect of shRNA knocking down the expression of KRT5 gene.

[0058] Fig.15 This is the effect of knocking down the expression of KRT14 gene by shRNA.

[0059] Fig.16 Schematic diagram of recombinant viral vectors H and I.

[0060] Fig.17 Schematic diagram of recombinant viral vectors J and K. DETAILED DESCRIPTION

[0061] The specific embodiments of the present invention are described in detail below, but it should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. The experimental methods in the following examples without specifying specific experimental conditions are usually operated under conventional conditions or under conditions recommended by the manufacturer.

[0062] Unless explicitly stated otherwise, throughout the specification and claims, the term "comprise" or variations such as "include" or "comprising" etc. will be understood to include the stated elements or components but not to exclude other elements or components.

[0063] As used in this article, the term "epidermolysis bullosa (EB)" refers to a group of serious hereditary skin diseases characterized by the formation of blisters, blood blisters or bullae on the skin and mucous membranes after minor friction or trauma. It is divided into hereditary (congenital) and acquired (epidermolysis bullosa acquisita, EBA). The cause of the disease is still unclear and may be related to genetic factors, autoimmune abnormalities, environmental factors, skin damage, endocrine disorders, etc.

[0064] Hereditary EB can be divided into three categories according to the different sites of onset: ① simplex EB (EBS), blisters in the epidermis; ② junctional EB (JEB), blisters occur in the clear layer; ③ dystrophic EB (DEB), blisters occur in the dense layer. EBS is mainly related to mutations in genes encoding keratin 5 (KRT5) and keratin 14 (KRT14); JEB is related to mutations in genes encoding laminin 5, type XVII collagen (BPAG2) and other substances; DEB is related to mutations in the gene encoding type VII collagen (COL7A1). Due to mutations in genes encoding structural protein components of the epidermis and basement membrane zone, these proteins are synthesized or structurally abnormal, leading to the formation of blisters in different anatomical parts.

[0065] As used herein, the term "construct" refers to a recombinant molecule, such as a recombinant nucleic acid or polypeptide, comprising one or more isolated nucleic acid sequences or amino acid sequences from a heterologous source. For example, a polypeptide construct can be a chimeric polypeptide molecule in which two or more amino acid sequences of different origins are operably linked to each other in a single polypeptide construct. Similarly, a "nucleic acid construct" can be a chimeric nucleic acid molecule in which two or more nucleic acid sequences of different origins are assembled into a single nucleic acid molecule. Thus, representative nucleic acid constructs include any construct containing: (1) a nucleic acid sequence including regulatory and coding sequences that are not found adjacent to each other in nature (e.g., at least one of the nucleotide sequences is heterologous relative to at least one of its other nucleotide sequences); or (2) a sequence encoding a portion of a functional RNA molecule or protein that is not naturally adjacent; or (3) a portion of a promoter that is not naturally adjacent. Representative nucleic acid construct can comprise any recombinant nucleic acid molecule (single-stranded or double-stranded DNA or RNA nucleic acid molecule) that is derived from any source (such as plasmid, clay, virus, self-replicating polynucleotide molecule, bacteriophage) that can carry out genome integration or self-replication, comprises the nucleic acid molecule that one or more nucleotide sequences are operably connected.The nucleic acid construct of the present disclosure can comprise the necessary element of the expression of the target nucleic acid sequence that guiding is also included in the construct.This type of element can comprise control element (such as the promotor that is operably connected to the target nucleic acid sequence (so as to guide its transcription)), and randomly comprises polyadenylation sequence.

[0066] In some embodiments of the present disclosure, one or more nucleic acid constructs may be incorporated (e.g., inserted) into a single nucleic acid molecule (e.g., a single vector), or may be incorporated (e.g., inserted) into two or more separate nucleic acid molecules (e.g., two or more separate vectors).

[0067] The term "vector" is used herein to refer to a nucleic acid molecule or sequence that can transfer or transport another nucleic acid molecule. Therefore, the term "vector" covers both DNA-based vectors and RNA-based vectors. The term "vector" includes cloning vectors and expression vectors as well as viral vectors and integration vectors. "Expression vectors" are vectors that contain regulatory regions so that DNA sequences and fragments can be expressed in vitro, ex vivo and / or in vivo. In some embodiments, the vector may be included in a sequence that guides autonomous replication in a cell, such as a plasmid (DNA-based vector) or a self-replicating RNA vector. In some embodiments, the vector may include a sequence sufficient to allow integration into the host cell DNA. Useful vectors include, for example, plasmids (e.g., DNA plasmids or RNA plasmids), transposons, cosmids, bacterial artificial chromosomes, and viral vectors. In some embodiments, the vector of the present disclosure may be a single-stranded vector (e.g., ssDNA or ssRNA). In some embodiments, the vector of the present disclosure may be a double-stranded vector (e.g., dsDNA or dsRNA). In some embodiments, the vector is a gene delivery vector. In some embodiments, the vector is used as a gene delivery vehicle to transfer genes into cells. In some embodiments, the vectors of the present disclosure are self-replicating RNA (srRNA) vectors.

[0068] An "expression vector" generally comprises at least a control sequence operably linked to a nucleotide sequence of interest. In this manner, for example, a promoter operably linked to a nucleotide sequence to be expressed is provided in an expression vector for expression in a cell. For the practice of the present disclosure, compositions and methods for preparing and using vectors (e.g., expression vectors) and cells are known to those skilled in the art.

[0069] As used herein, the term "replication-deficient" refers to a viral vector that cannot replicate completely and effectively. A replication-deficient virus is a mutant or defective type with respect to one or more functions essential to viral genome replication or viral particle synthesis and assembly. A replication-deficient virus can be propagated in a complementary cell line expressing the missing gene product. However, in normal target cells, a replication-deficient virus can express viral gene products, but will not replicate to form infectious progeny viral particles. In some embodiments, a replication-deficient virus or viral vector is a mutant or defective type of a virus or vector with respect to one or more functions essential to viral genome replication. In some embodiments, a replication-deficient virus or viral vector is a mutant or defective type of a virus or vector with respect to one or more functions essential to viral particle synthesis and assembly. In some embodiments of the present invention, the replication-deficient viral vector is an HSV-1 viral vector.

[0070] The term "siRNA (small interfering RNA)" is a double-stranded RNA molecule with a length of about 21-25 nucleotides. siRNA inhibits the expression of specific genes by binding to the mRNA of the target gene, causing the mRNA to degrade. siRNA is usually produced by the Dicer enzyme cleaving long double-stranded RNA (dsRNA), and then binds to RISC (RNA-induced silencing complex) to form an activated RISC complex, which then recognizes and degrades the target mRNA.

[0071] The term "sgRNA (single guide RNA)" is a single-stranded RNA molecule with a length of about 100-200 nucleotides. sgRNA is a key component in the CRISPR-Cas9 gene editing system, which can guide the Cas9 protein to recognize and cut specific DNA sequences. sgRNA binds to the Cas9 protein to form a Cas9-sgRNA complex, and then recognizes and binds to the target DNA sequence, causing a double-strand break in the DNA, thereby achieving gene editing.

[0072] The term "shRNA (short hairpin RNA)" is short hairpin RNA, which is a special structure of RNA molecules with a ring structure and two complementary arms. shRNA is designed to form a hairpin structure. After entering the cell, shRNA is cut into siRNA by Dicer enzyme, and then binds to RISC to further recognize and degrade the target mRNA, thereby inhibiting the expression of specific genes.

[0073] As used herein, the term miRNA (microRNA) is a class of non-coding small RNA molecules with a length of about 20-24 nucleotides. They play an important role in the regulation of gene expression, mainly by binding to target mRNA, inhibiting its translation or promoting its degradation, thereby regulating gene expression. miRNA plays an important role in a variety of biological processes, including cell differentiation, proliferation, apoptosis, development and tumorigenesis. miRNA does not encode proteins, but they play an important regulatory role in cells, especially at the post-transcriptional level of cells (i.e., the stability and translation of mRNA). They usually inhibit gene expression by binding to the 3' untranslated region (3'UTR) of the target gene mRNA. The synthesis process of miRNA The synthesis process of miRNA includes the following main steps: 1. Gene transcription: The precursor gene of miRNA (pri-miRNA) is synthesized by RNA polymerase II during transcription. pri-miRNA is a long primary transcript containing a hairpin structure, which is the mature precursor structure of miRNA. 2. Post-transcriptional processing: pri-miRNA is processed into short precursor miRNA (pre-miRNA) in the nucleus by Drosha enzyme and its auxiliary factor DGCR8. Pre-miRNA is about 70 nucleotides and forms a hairpin structure. 3. Transport to the cytoplasm: pre-miRNA is transported from the nucleus to the cytoplasm with the help of Exportin-5 and RanGTP. 4. Further processing: In the cytoplasm, Dicer enzyme further processes pre-miRNA into double-stranded mature miRNA. This double-stranded structure contains two chains: one is the functional chain (called miRNA), and the other chain (called **miRNA* (star) chain) is usually degraded. 5. RNA-induced silencing complex (RISC) loading: The generated single-stranded miRNA will bind to the RISC complex to form a mature miRNA-RISC complex. miRNA inhibits the translation of the target gene or accelerates its degradation by pairing with the 3'UTR part of its target mRNA. The functional chain of miRNA is the region that targets and binds to the target mRNA, which is referred to as the "targeting region" in this application. In some embodiments of the present application, the short hairpin RNA of the present application replaces the "targeting region" in the precursor miRNA (pre-miRNA), that is, the region that later becomes the functional chain of the mature miRNA, to form a nucleic acid construct comprising the short hairpin RNA of the present application and the "miRNA backbone" (i.e., the portion without the "targeting region" in the pre-miRNA). The "miRNA backbone" of the present application covers the backbones of various miRNAs. Various miRNA backbones known in the art can be used to hybridize with the short hairpin RNA of the present application to form a hybrid nucleic acid construct. Those skilled in the art can refer to the miRBase database ( , TargetScan and miRTarBase and other databases to obtain the nucleotide sequences of various miRNA backbones.

[0074] It is well known in the art that "genomic segment" refers to a specific nucleotide position in the genome. The nucleotide position of the specific genomic segment of the HSV-1 genome in this application is determined with reference to the HSV-1 laboratory strain 17 genome (NC_001806.2). Those skilled in the art will understand that the specific nucleotide positions may vary in the genomes of different HSV-1 strains, but those skilled in the art can determine the nucleotide position corresponding to the specific genomic segment disclosed in this application based on conventional techniques. Therefore, this application covers the specific genomic segment determined with reference to the HSV-1 laboratory strain 17 genome (NC_001806.2), and also covers the genomic segments corresponding to the genomic segment in different HSV-1 strains.

[0075] In some embodiments, the genome is selected from the group consisting of ICP34.5 gene, ICP6 gene, ICP0 gene, ICP47 gene, ICP22 gene, ICP27 gene, U S 3 genes, U L 56 genes, functional VP16 gene, VHS gene, UNG gene, IR L / IR S One or more of the glycoprotein H gene, thymidine kinase gene, or region is disrupted or knocked out.

[0076] In some embodiments, ICPO and / or ICP22 are disrupted or knocked out in the genome.

[0077] In some embodiments, the genome segment of the nucleotide sequence from 1-100 nucleotides upstream and downstream of the 126785th nucleotide to 1-100 nucleotides upstream and downstream of the 131176th nucleotide in the genome of the replication-deficient recombinant herpes simplex virus type I (HSV-1) vector is destroyed or knocked out. In the present application, the numerical range of 1-100 covers any positive integer in the numerical range. In the present application, the term "a genomic segment of a nucleotide sequence from 1-100 nucleotides upstream and downstream of the 126785th nucleotide to 1-100 nucleotides upstream and downstream of the 131176th nucleotide" covers a genomic segment of a nucleotide sequence from any positive integer nucleotide in the range of 1-100 nucleotides upstream and downstream of the 126785th nucleotide to any positive integer nucleotide in the range of 1-100 nucleotides upstream and downstream of the 131176th nucleotide. For example, a genomic segment of the nucleotide sequence 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100 upstream and downstream of nucleotide 126785 to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100 upstream and downstream of nucleotide 131176 is disrupted or knocked out (the specific nucleotide positions upstream and downstream of nucleotide 126785 and the specific nucleotide positions upstream and downstream of nucleotide 131176 described herein can be any combination).

[0078] In some embodiments, the genome segment of the nucleotide sequence from 1-823 nucleotides upstream and downstream of nucleotide 147025 to 1-93 nucleotides upstream and downstream of nucleotide 151439 in the genome of the replication-deficient recombinant herpes simplex virus type I (HSV-1) vector is destroyed or knocked out. In the present application, the numerical range of 1-823 and the numerical range of 1-93 cover any positive integers within the above numerical ranges. In the present application, the term "a genomic segment of a nucleotide sequence from 1-823 nucleotides upstream and downstream of nucleotide 147025 to 1-93 nucleotides upstream and downstream of nucleotide 151439" covers a genomic segment of a nucleotide sequence from any positive integer nucleotides within the range of 1-823 nucleotides upstream and downstream of nucleotide 147025 to any positive integer nucleotides within the range of 1-93 nucleotides upstream and downstream of nucleotide 151439. 800, 805, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 805, 810, 811, 812, 813, 814, 815, 816, 817, 818, The genomic segment of the nucleotide sequence 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93 upstream and downstream of nucleotide 151439 is destroyed or knocked out (the specific nucleotide positions upstream and downstream of nucleotide 147025 and the specific nucleotide positions upstream and downstream of nucleotide 151439 described here can be any combination).

[0079] In some embodiments, the genome segment of the nucleotide sequence from 1-257 nucleotides upstream and downstream of nucleotide 113494 to 1-223 nucleotides upstream and downstream of nucleotide 115314 in the genome of the replication-deficient recombinant herpes simplex virus type I (HSV-1) vector is destroyed or knocked out. In the present application, the numerical range of 1-257 and the numerical range of 1-223 cover any positive integers within the above numerical ranges. In the present application, the term "a genomic segment of a nucleotide sequence from 1-257 nucleotides upstream and downstream of nucleotide 113494 to 1-223 nucleotides upstream and downstream of nucleotide 115314" covers a genomic segment of a nucleotide sequence from any positive integer nucleotides within the range of 1-257 nucleotides upstream and downstream of nucleotide 113494 to any positive integer nucleotides within the range of 1-223 nucleotides upstream and downstream of nucleotide 115314. For example, from nucleotide 113494 upstream and downstream 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 251, 252, 253, 254, 255, 256, 257 to nucleotide 115314 upstream and downstream 1, 2, 3, 4, 5, 6, 7, 8, 9, 1 The genomic segment of the nucleotide sequence at positions 0, 11, 12, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 205, 210, 215, 220, 221, 222, and 223 is disrupted or knocked out (the specific nucleotide positions upstream and downstream of nucleotide position 113494 and the specific nucleotide positions upstream and downstream of nucleotide position 115314 described herein can be any combination).

[0080] Example

[0081] Preparation Example 1 Preparation of HSV-1 replication-deficient recombinant virus vector

[0082] The HSV-1 viral genome consists of long terminal repeats (TRs) L ), long unique segment (U L ), long internal repeat (IR L ), short internal repeat (IR S ), short unique segment (U S) and short terminal repeats (TR S )composition( Figure 1 ). Specific regions of the HSV-1 genome (e.g. Figure 2 By modifying the vector (as shown in the figure), an HSV-1 replication-defective viral vector can be obtained.

[0083] According to the method in the literature (Stuart CR, Seymour LD, James FN. Mutant simplexviruses and uses thereof. WO9938955A3), IR was knocked out in the HSV-1 viral genome by genetic engineering method. S and TR S The 126785-131735 bp and 146471-151439 bp positions of the region, which involve the ICP4 region of the HSV-1 virus, were deleted, and the ICP4 promoter and ICP4 gene were deleted, and the green fluorescent protein (GFP) marker gene was inserted at this position to obtain the recombinant viral vector A1 ( Figure 3 ).

[0084] According to the method of the literature (Howard, M., Kershaw, T., Gibb, B. et al. High efficiency gene transfer to the central nervous system of rodents and primates using herpes virus vectors lacking functional ICP27 and ICP34.5. Gene Ther 5, 1137–1147 (1998)), the U was knocked out from the HSV-1 viral genome. L The 113280-116878 bp region of the region deleted ICP27, U L 55 and U L 56 gene, and inserted the GFP gene at this position to obtain the recombinant viral vector B1 ( Figure 4 ).

[0085] Preparation Example 2 Optimization of HSV-1 replication-deficient viral vector

[0086] Reference to the method described in the patent application with application publication number CN113046331A to knock out HSV-1 genome IR S and TR SThe 126785-131176 bp and 147025-151439 bp regions of the region involve the ICP4 gene region of the HSV-1 virus, and the GFP gene is inserted at this position to obtain the viral vector A2 ( Figure 5 ).

[0087] Reference is made to the method described in the patent application of application publication number CN113046331A for knocking out U on the HSV-1 viral genome. L The 113494-115314 bp region of the region involves the ICP27 gene region of the HSV-1 virus, and the GFP gene is inserted at this position to obtain the viral vector B2 ( Figure 6 ).

[0088] Viral vectors with deletion of ICP4 and ICP27, essential genes for HSV-1 replication, need to be prepared and grown on a compensatory cell line that can compensate for ICP4 and ICP27 genes. ICP4 gene (Gene ID: 2703392) and ICP27 gene (Gene ID: 24271474) were simultaneously cloned into a plasmid (Takara, 3244) carrying a puromycin selection gene. According to the instructions of Lipofectamine™ 3000 (Thermo, L3000015), the plasmids were stably transfected into Vero cells by lipofectamine method to obtain the ZH02 compensatory cell line that supports the replication of replication-deficient viral vectors. ICP0 gene (Gene ID: 2703390) is a non-essential gene for HSV-1 replication, but its knockout will affect the expression of exogenous genes. The ICP4, ICP27 and ICP0 genes were simultaneously cloned into a plasmid carrying a puromycin selection gene, and the plasmids were stably transfected into Vero cells by a liposome method to obtain a ZH06 compensatory cell line that supports the replication of replication-defective viral vectors.

[0089] Example 1 Optimized HSV-1 replication-deficient recombinant viral vector expresses higher levels of foreign genes

[0090] African green monkey kidney cells Vero (ATCC) and human embryonic skin fibroblasts CCC-ESF-1 (Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences) were cultured in DMEM medium containing 10% serum at 37°C and 5% CO2. The two types of cells were inoculated into six-well plates, and two experimental groups were set up for each cell type, with 2 wells in each group, and blank cell control wells were set up at the same time. After 24 hours, each experimental group was inoculated with recombinant viral vector A1, recombinant viral vector B1, recombinant viral vector A2 and recombinant viral vector B2 at an MOI of 1. After 72 hours, the green fluorescence was observed under a fluorescence microscope and photographed. The results showed that the green fluorescence brightness expressed by the recombinant viral vectors A2 and B2 after infecting the two cells was higher than that expressed by A1 and B1; the green fluorescence brightness expressed by the recombinant viral vector A2 after infecting the two cells was higher than that expressed by the recombinant viral vector B2 ( Figure 7 ).

[0091] The experimental results show that in the ICP4 and ICP27 regions, the recombinant viral vectors obtained by inserting exogenous genes into specific positions in the above-mentioned regions of the HSV-1 genome according to the present invention express higher amounts of exogenous genes than the recombinant viral vectors obtained according to the literature methods, especially the recombinant viral vectors obtained by inserting exogenous genes into specific positions in the ICP4 region express the highest amount of exogenous genes.

[0092] HSV-1 has a 152kb genome. After infection into cells, the viral genome will be epigenetically modified, and different genomic regions have different modifications, which causes different expression levels of exogenous genes at different sites. After knocking out different viral fragments and inserting exogenous genes at the same site (such as ICP4 or ICP27), the expression level of the exogenous gene will also be different, mainly because the knocked-out viral sequence may contain regulatory elements of gene expression (such as promoters, enhancers, cis or trans regulatory elements). The present invention optimizes the position of the virus knockout fragment in the exogenous gene insertion area, and the recombinant virus obtained by inserting the exogenous gene into the specific position of the above-mentioned region of the HSV-1 genome expresses a higher amount of exogenous genes than the recombinant virus obtained according to the literature method.

[0093] Preparation Example 3 Preparation of HSV-1 replication-deficient recombinant virus vector carrying foreign genes

[0094] According to the method described in the patent application with application publication number CN113046331A, the GFP gene was replaced at the knockout position of the recombinant viral vector A2, and the COL7A1 gene encoding type VII collagen (NM_000094.4) was inserted to obtain the recombinant viral vector C ( Figure 8 ). Based on the recombinant viral vector A2, the ICP34.5 gene was further knocked out, and the GFP gene was replaced by the COL7A1 gene to obtain the recombinant viral vector D ( Fig. 9 ). Based on the recombinant viral vector A2, ICP22 and ICP27 were knocked out, and the GFP gene was replaced by the COL7A1 gene to obtain the recombinant viral vector E ( Fig.10 ).

[0095] According to the method described in the patent application with application publication number CN113046331A, the GFP gene was replaced at the knockout position of the recombinant viral vector B2, and the COL7A1 gene was inserted to obtain the recombinant viral vector F ( Fig.11 According to the method in the literature (Miyagawa Y, Marino P, et al., Herpes simplex viral-vector design for efficient transduction of nonneuronal cells without cytotoxicity. Proc Natl Acad Sci USA. 2015, 112 (13): E1632-41), the ICP0, ICP22, ICP4 and JOINT regions were knocked out on the basis of the recombinant viral vector B2, and the GFP gene was replaced by the COL7A1 gene to obtain the recombinant viral vector G ( Fig.12 ).

[0096] Example 2 Verification of expression of genes carried by HSV-1 replication-deficient recombinant virus vector

[0097] ZH02 and ZH06 compensation cell lines were inoculated into six-well plates and cultured at 37°C and 5% CO2. After 2 days of cell culture, recombinant viral vectors C, D and E were added to ZH02 cells at MOI = 0.01, and recombinant viral vectors F and G were added to ZH06 cells. Cell negative control wells were set. After the transfected cells were cultured for 3 days at 37°C and 5% CO2, the culture supernatant was taken and the expression of type VII collagen was detected by ELISA kit (Abclonal, RK01162). The results showed that there was no significant difference in the expression of the target protein after the cells were transfected with recombinant viral vectors C, D and E, and there was no significant difference in the expression of the target protein after the cells were transfected with recombinant viral vectors F and G.

[0098] The results showed that the recombinant virus vector obtained by inserting the functional gene COL7A1 after specific modification of the ICP4 and ICP27 regions of the HSV-1 genome in this application did not significantly affect the expression level of the COL7A1 gene after further modification ( Fig.13 ).

[0099] Example 3 Design of shRNA for knocking down human KRT5 and KRT14 genes

[0100] Knockdown shRNAs were designed for human KRT5 gene (NM_000424.4) and KRT14 gene (NM_000526.5). shRNAs were designed and optimized using VectorBuilder shRNA Target design software (https: / / en.vectorbuilder.com / tool / shrna-target-design.html), and 18 shRNAs for knockdown of KRT5 gene (as shown in SEQ ID NO: 1-18 in the sequence list) and 23 shRNAs for knockdown of KRT14 gene (as shown in SEQ ID NO: 19-41 in the sequence list) were obtained.

[0101] Example 4 Screening of shRNA for knocking down human KRT5 gene

[0102] The shRNA sequence of knockdown human KRT5 gene of SEQ ID NO: 1-3 was synthesized and cloned into the multiple cloning site of pGMLV-Puro vector (Jiman Bio). After transformation of competent cells, single colonies were picked for small-scale shaking culture, and the recombinant plasmid was extracted using a plasmid extraction kit (DP120-01, TIANGEN). The target plasmid was transfected into HaCaT cells (Jiman Bio) using an electroporator (Celetrix) for verification. HaCaT cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO2. The HaCaT cell precipitate was collected by digestion and centrifugation, and 1×10 6 Each cell was mixed with 20 μl electroporation solution and 2 μg plasmid and then transferred to an electroporation tube for electroporation. Then, the cells were transferred to a six-well plate, and each well was added with 2 ml of culture medium. The plate was placed in a 37°C, 5% CO2 incubator for 3 days before sampling. The total RNA of the cells was extracted using a total RNA extraction kit (19221ES50, Yisheng) according to the instructions of the kit. The extracted RNA was reverse transcribed using a cDNA synthesis kit (EG15133S, Bristol-Myers Squibb) according to the instructions of the kit. The obtained cDNA was used for quantitative analysis of KRT5 gene expression by real-time quantitative PCR. The primer sequences for KRT5 gene detection in PCR analysis were KRT5-F: TGTCTCGCCAGTCAAGTGTG and KRT5-R: CCACCCACTCCACAAGCAC. GAPDH was used as an internal reference, and the primer sequences for detection were GAPDH-F: GTCTCCTCTGACTTCAACAGCG and GAPDH-R: ACCACCCTGTTGCTGTAGCCAA. The ΔΔCt method was used for data analysis to calculate the relative expression of the KRT5 gene in normal HaCaT cells with GAPDH as the internal reference.

[0103] ΔΔCt = (average Ct value of KRT5 gene in the test sample - average Ct value of the reference gene in the test sample) - (average Ct value of KRT5 gene in the control sample - average Ct value of the reference gene in the control sample)

[0104] The relative expression of the gene F = 2 -ΔΔCt .

[0105] The Ct value results of real-time quantitative PCR detection are shown in Table 1 below:

[0106] Table 1

[0107]

[0108] The effect of shRNA knocking down the expression of KRT5 gene is shown in Table 2 and Fig.14 As shown:

[0109] Table 2

[0110]

[0111] The above results showed that KRT5 shRNA1, shRNA2 and shRNA3 could significantly knock down the expression of KRT5 gene.

[0112] Example 5 Screening of shRNA for knocking down human KRT14 gene

[0113] The shRNA sequence of knocking down the human KRT14 gene of the synthetic sequence SEQ ID NO: 19-21 was cloned into the pGMLV-Puro vector according to the method of Example 4, and the recombinant plasmid was prepared by culture extraction, and the total cell RNA was extracted after electroporation of HaCaT cells, and the real-time quantitative PCR method was used to quantitatively analyze the expression of the KRT14 gene. In the PCR detection analysis, the primer sequences for KRT14 gene detection were KRT14-F: GAGCAGCAGAACCAGGAGTACA and KRT14-R: AGGAGGTCACATCTCTGGATGA, GAPDH was used as an internal reference, and the detection primer sequences were GAPDH-F: GTCTCCTCTGACTTCAACAGCG and GAPDH-R: ACCACCCTGTTGCTGTAGCCAA. The data analysis used the ΔΔCt method to calculate the relative expression of the KRT14 gene in normal HaCaT cells with GAPDH as an internal reference.

[0114] ΔΔCt = (average Ct value of KRT14 gene in the test sample - average Ct value of the reference gene in the test sample) - (average Ct value of KRT14 gene in the control sample - average Ct value of the reference gene in the control sample)

[0115] The relative expression of the gene F = 2 -ΔΔCt .

[0116] The Ct value results of real-time quantitative PCR detection are shown in Table 3 below:

[0117] Table 3

[0118]

[0119] The effect of shRNA knocking down the expression of KRT14 gene is shown in Table 4 and Fig.15 As shown:

[0120] Table 4

[0121]

[0122] The above results showed that KRT14 shRNA 19, shRNA 20 and shRNA 21 could significantly knock down the expression of KRT14 gene.

[0123] Preparation Example 4 Construction of HSV-1 vector for EBS gene therapy

[0124] Targeting the KRT5 gene, the ICP34.5 gene was further knocked out on the basis of the recombinant viral vector A2, and the GFP gene was replaced at the position of the ICP4 gene knockout. The EF1 promoter, the optimized KRT5 sequence (opKRT5) (SEQ ID NO: 43), the polyadenylation sequence, the U6 promoter, and the KRT5 shRNA 1 sequence (SEQ ID NO: 1) were inserted in sequence to obtain the recombinant viral vector H ( Fig.16 ).

[0125] The maturation of miRNA and shRNA has similar cellular mechanisms. The use of the secondary structure of the precursor miRNA can be used as the backbone for the production of interfering RNA. The processing and shearing of the interfering RNA produced by this method is more natural, which can minimize side effects. At the same time, the miRNA backbone sequence inserted into the shRNA sequence is longer, and can be driven by pol II type promoters including a variety of tissue-specific promoters, thereby achieving gene silencing in specific tissues. Among the miRNA backbones currently used for gene interference research (such as miR30, miR155, miR17-92, etc.), miR30 is the most commonly used structure.

[0126] This preparation example further uses KRT5 shRNA 1 to replace the targeting region in the miR30 backbone, thereby obtaining KRT5 mirshRNA based on the miRNA backbone (SEQ ID NO: 45). Next, the ICP34.5 gene is further knocked out on the basis of the recombinant viral vector A2, and the GFP gene is replaced at the position of the ICP4 gene knockout. The EF1 promoter, the optimized KRT5 sequence (opKRT5) (SEQ ID NO: 43), the KRT5 mirshRNA (SEQ ID NO: 45) and the polyadenylation sequence are sequentially inserted to obtain the recombinant viral vector I ( Fig.16 Since the opKRT5 sequence is different from the wild-type KRT5 sequence, avoid shRNA or miRNA sequence from cutting it.

[0127] The HSV-1 vector designed for the KRT14 gene was constructed in the same strategy as the HSV-1 vector designed for the KRT5 gene. Based on the recombinant viral vector A2, the ICP34.5 gene was further knocked out, and the GFP gene was replaced at the position of the ICP4 gene knockout. The EF1 promoter, the optimized KRT14 sequence (opKRT14) (SEQ ID NO: 44), the polyadenylation sequence, the U6 promoter, and the KRT14 shRNA 1 sequence (SEQ ID NO: 19) were inserted in sequence to obtain the recombinant viral vector J ( Fig.17 ).

[0128] KRT14 shRNA 1 was further used to replace the targeting region in the miR30 backbone to obtain KRT14 mirshRNA based on the miRNA backbone (SEQ ID NO: 46). Next, the ICP34.5 gene was further knocked out on the basis of the recombinant viral vector A2, and the GFP gene was replaced at the position of the ICP4 gene knockout. The EF1 promoter, the optimized KRT14 sequence (opKRT14) (SEQ ID NO: 44), the KRT14 mirshRNA (SEQ ID NO: 46) and the polyadenylation sequence were inserted in sequence to obtain the recombinant viral vector K ( Fig.17 ).

[0129] Example 6 Verification of the effect of HSV-1 vector designed for KRT5 gene

[0130] HaCaT cells were cultured at 2×10 6The cells were plated at a density of 100 / well in a six-well plate and cultured overnight at 37°C and 5% CO2. The recombinant viral vector H was transfected into HaCaT cells at an MOI of 1, and a blank cell control group (without viral vector) was set up. Two wells were set up for each group of cells and cultured statically for 2 days at 37°C and 5% CO2. The total RNA of each cell in each well was extracted according to the method in Example 4 and reversely transcribed into cDNA. The obtained cDNA was subjected to quantitative expression analysis of the wild-type KRT5 gene and the optimized KRT5 gene by real-time quantitative PCR. With GAPDH as the internal reference, the GAPDH detection primer sequence and the wild-type KRT5 detection primer sequence were the same as in Example 4, and the optimized KRT5 detection primer sequences were: opKRT5-F1: AGCAATCGCATTCTGCAAGTT and opKRT5-R1: GAAGCCGAGTCCTGGTACCA. The data analysis used the ΔΔCt method to calculate the relative expression of the KRT5 gene in normal HaCaT cells with GAPDH as the internal reference.

[0131] The Ct value results of real-time quantitative PCR detection are shown in Table 5 below:

[0132] Table 5

[0133]

[0134] The effect of knocking down the expression of KRT5 gene by shRNA is shown in Table 6 below:

[0135] Table 6

[0136]

[0137] Experimental data showed that compared with normal cells, the HSV-1 vector designed for the KRT5 gene can significantly knock down the expression of the wild-type KRT5 gene in cells, while highly expressing the optimized KRT5 gene. The experimental results show that this vector has a good application prospect in the treatment of EBS.

[0138] Example 7 Verification of the effect of HSV-1 vector designed for KRT14 gene

[0139] HaCaT cells were cultured at 2×10 6The cells were plated at a density of 100 / well in a six-well plate and cultured overnight at 37°C and 5% CO2. The recombinant viral vector J was transfected into HaCaT cells at an MOI of 1, and a blank cell control group (without viral vector) was set up. Two wells were set up for each group of cells and cultured at 37°C and 5% CO2 for 2 days. The total RNA of each cell in each well was extracted according to the method in Example 5 and reverse transcribed into cDNA. The expression of the wild-type KRT14 gene and the optimized KRT14 gene was quantitatively analyzed by real-time quantitative PCR on the obtained cDNA. GAPDH was used as the internal reference, and the GAPDH detection primer sequence and the wild-type KRT14 detection primer sequence were the same as in Example 5. The optimized KRT14 detection primer sequence was: opKRT14-F1: TTGAGCTCAGGTGGGCATCT and opKRT14-R1: AGTTAGCCCAAATCCAGGAAATG. The ΔΔCt method was used for data analysis to calculate the relative expression of the KRT14 gene in normal HaCaT cells with GAPDH as the internal reference.

[0140] The Ct value results of real-time quantitative PCR detection are shown in Table 7 below:

[0141] Table 7

[0142]

[0143] The effect of knocking down the expression of KRT14 gene by shRNA is shown in Table 8 below:

[0144] Table 8

[0145]

[0146] Experimental data showed that compared with normal cells, the HSV-1 vector designed for the KRT14 gene can significantly knock down the expression of the wild-type KRT14 gene in cells, while highly expressing the optimized KRT14 gene. The experimental results show that this vector has a good application prospect in the treatment of EBS.

[0147] Sequence Listing ; ; ; ; .

[0148] The above is only a preferred embodiment of the present application and does not limit the present application in any form. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment based on the technical essence of the present application without departing from the content of the technical solution of the present application still falls within the protection scope of the technical solution of the present application.

Claims

1. A short hairpin RNA (shRNA) for knocking down KRT5 gene and / or KRT14 gene, comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 1-41 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% sequence identity thereto.

2. The short hairpin RNA according to claim 1, comprising a nucleotide sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

3. A nucleic acid construct comprising the short hairpin RNA according to claim 1 or 2. 4 . The nucleic acid construct according to claim 3 , which is a nucleic acid construct composed of the short hairpin RNA according to claim 1 or 2 and a miRNA backbone, wherein the short hairpin RNA replaces the targeting region in the miRNA backbone.

5. The nucleic acid construct according to claim 4, wherein the miRNA is selected from one or more of miR30, miR155 and miR17-92.

6. The nucleic acid construct of claim 4 or 5, comprising the nucleotide sequence shown in SEQ ID NO: 45 or 46 or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

7. A vector comprising the short hairpin RNA according to claim 1 or 2 or the nucleic acid construct according to any one of claims 3 to 6.

8. The vector of claim 7, comprising a plasmid, a lipid nanoparticle (LNP), a transposon, a cosmid, a bacterial artificial chromosome, a virus-like particle (VLP) and a viral vector, optionally comprising a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector or a herpes simplex viral vector.

9. A cell comprising the vector of claim 8, optionally the cell is a prokaryotic cell or a eukaryotic cell.

10. A vector system for treating epidermolysis bullosa (EB), comprising one or more vectors, wherein the one or more vectors include: 1) A nucleotide sequence targeting a mutant gene causing EB, used to knock out or knock down the mutant gene causing EB; and 2) the nucleotide sequence encoding the normal gene corresponding to the mutant gene causing EB, The components 1) and 2) are located on the same or different carriers of the system.

11. The vector system according to claim 10, wherein the EB-causing mutant gene comprises one or more genes selected from the group consisting of KRT5, KRT14, PLEC, KLHL24, CD151, DST, EXPH5, ​​TGM5, JUP, PKP1, and DSP.

12. The vector system according to claim 10 or 11, wherein the vector comprises a plasmid, a lipid nanoparticle (LNP), a transposon, a cosmid, a bacterial artificial chromosome, a virus-like particle (VLP) and a viral vector, optionally, the viral vector comprises a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector or a herpes simplex viral vector.

13. The vector system according to any one of claims 10 to 12, wherein the mutant gene causing EB is knocked out or knocked down by one or more methods selected from the following: CRISPR homologous recombination, single base editing, PrimeEditing, RNA interference and RNA editing.

14. The vector system according to any one of claims 10 to 13, wherein the nucleotide sequence targeting the EB-causing mutant gene comprises siRNA, shRNA, microRNA (miRNA), a nucleic acid construct consisting of shRNA and microRNA, or sgRNA for knocking out or knocking down the EB-causing mutant gene.

15. The vector system according to any one of claims 10 to 14, wherein the EB-causing mutant gene comprises KRT5 gene and / or KRT14 gene.

16. The vector system according to any one of claims 10 to 15, wherein the vector is a herpes simplex virus vector, optionally, a type I herpes simplex virus vector, preferably, the herpes simplex virus vector genome is selected from the group consisting of ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, U L 41 genes, U L 55 genes, U L 56 genes and IR L / IR S One or more of the regions are disrupted or knocked out.

17. The vector system according to claim 16, wherein the components 1) and 2) are located on the same or different herpes simplex virus vectors, and optionally, the components 1) and 2) are located on the same or different sites on the same herpes simplex virus vector, and the sites are selected from one or more of the following disrupted or knocked-out gene sites: ICP0 gene, ICP4 gene, ICP27 gene, ICP34.5 gene, ICP47 gene, ICP22 gene, ICP6 gene, U L 41 genes, U L 55 genes, U L 56 genes and IR L / IR S area.

18. The vector system according to any one of claims 15 to 17, wherein the nucleotide sequence targeting the mutant gene causing EB comprises a nucleotide sequence targeting the KRT5 gene and / or the KRT14 gene, and the nucleotide sequence is a shRNA for knocking down the KRT5 gene and / or the KRT14 gene, and optionally, the shRNA comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1-41, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

19. The vector system according to any one of claims 10 to 17, wherein the nucleotide sequence targeting the mutant gene causing EB is a nucleic acid construct comprising a shRNA targeting the mutant gene causing EB and a miRNA backbone. 20 . The vector system according to claim 19 , wherein the shRNA targeting the mutated gene causing EB is shRNA targeting the KRT5 gene and / or the KRT14 gene. 21 . The vector system according to claim 20 , wherein the shRNA targeting the KRT5 gene and / or the KRT14 gene comprises the short hairpin RNA according to claim 1 or 2 .

22. The vector system according to claim 19, wherein the miRNA is selected from one or more of miR30, miR155 and miR17-92.

23. The vector system of claim 21 or 22, comprising the nucleotide sequence shown in SEQ ID NO: 45 or 46, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

24. The vector system of any one of claims 10-23, wherein the nucleotide sequence encoding the keratin protein comprises the nucleotide sequence shown in SEQ ID NO: 43 or 44, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

25. According to the vector system described in any one of claims 16-24, further, the ICP34.5 gene and\or IR L / IR S Regions are disrupted or knocked out.

26. A composition comprising the carrier system according to any one of claims 10-25.

27. The composition according to claim 26, which is a pharmaceutical composition, further comprising a pharmaceutically acceptable excipient.

28. Use of the short hairpin RNA (shRNA) of any one of claims 1-2, the nucleic acid construct of any one of claims 3-6, the vector of any one of claims 7-8, the vector system of any one of claims 10-25, or the composition of any one of claims 26-27 in the preparation of a drug for treating epidermolysis bullosa.

29. The use according to claim 28, wherein the epidermolysis bullosa is epidermolysis bullosa simplex.

30. A method for treating epidermolysis bullosa, comprising administering to a subject in need thereof an effective amount of the composition of any one of claims 26-27.

31. The method of claim 30, wherein the epidermolysis bullosa is epidermolysis bullosa simplex.

Images