Preparation method of triangular multivalent aptamer initiation chain with magnetic nanoparticles

Abstract

The invention discloses a preparation method of a triangular multivalent aptamer initiation chain with magnetic nanoparticles, and particularly relates to the field of salmonella detection.The method comprises the steps that all DNA sequences are dissolved with a 1 * TMS buffer solution, and the final concentration is 50 mu M; the method comprises the following steps: adding Apt1, Apt2, Tri, Linker and an initiation chain into a 1 * TMS buffer solution to obtain a mixed solution; heating the mixed solution to 95 DEG C to react for 4 minutes, then quickly cooling to 4 DEG C, and keeping the solution at 4 DEG C for 1 minute to prepare a multivalent aptamer initiation chain crude product in a triangular structure state; carrying out ultrafiltration on the multivalent aptamer initiation chain crude product to remove free chains, so as to obtain a multivalent aptamer initiation chain marked as Tri-MAI; and washing the streptavidin-coupled nano magnetic beads with PBS (Phosphate Buffer Solution), then carrying out resuspension in a Tri-MAI solution, and incubating at room temperature for 0.5 h to obtain a triangular multivalent aptamer initiation chain with magnetic nanoparticles, which is recorded as MTAI. When the triangular multivalent aptamer initiation chain is used for detecting salmonella in a sample, the triangular multivalent aptamer initiation chain has the advantages of sensitivity, rapidness and simplicity.

Description

Technical Field

[0001] The present application relates to the field of Salmonella detection, and in particular to a method for preparing a triangular multivalent aptamer initiator chain with magnetic nanoparticles. Background Art

[0002] Salmonella is a common foodborne pathogen. After infection, it can cause a series of symptoms such as discomfort, diarrhea, vomiting, fever, etc., which may even be life-threatening in severe cases. Therefore, detecting Salmonella in food and establishing an effective foodborne pathogen detection system are the key to ensuring food safety and preventing disease transmission. At present, the standard traditional method for identifying Salmonella must go through enrichment culture, selective separation, morphological characteristics observation, physiological and biochemical reactions and final serological identification. These experimental processes are very complicated, time-consuming and labor-intensive. Common immunoassay methods on the market require the use of expensive antibodies. If molecular biological methods such as common PCR and LAMP are used, DNA extraction and amplification are required, but aerosol contamination, false positive or negative results are easily generated during the experiment. Therefore, a sensitive, rapid and simple Salmonella detection method is currently needed in field production testing. Summary of the invention

[0003] The present application provides a method for preparing a triangular multivalent aptamer initiator chain with magnetic nanoparticles. The triangular multivalent aptamer initiator chain prepared by the method has the advantages of being sensitive, rapid and simple when used to detect Salmonella in a sample.

[0004] The objective of the present invention is achieved through the following technical solutions: A method for preparing a triangular multivalent aptamer initiator chain with magnetic nanoparticles, the preparation method comprising the following steps: S01, all DNA sequences were dissolved in 1× TMS buffer to a final concentration of 50 μM; S02, adding Apt1, Apt2, Tri, Linker and initiator chain into 1×TMS buffer to obtain a mixed solution; S03, heating the mixed solution to 95°C for 4 min, then rapidly cooling it to 4°C, and keeping the solution at 4°C for 1 min, to prepare a crude product of a triangular-shaped multivalent aptamer initiator chain; S04, after the crude product of multivalent aptamer initiator chain is subjected to ultrafiltration to remove free chains, a multivalent aptamer initiator chain is obtained, which is denoted as Tri-MAI; S05. Wash the streptavidin-coupled nanomagnetic beads with PBS, then resuspend them in Tri-MAI solution and incubate them at room temperature for 0.5 h to obtain a triangular multivalent aptamer initiator chain with magnetic nanoparticles, which is denoted as MTAI.

[0005] Among them, the initiator chain will compete with Salmonella for the binding site of the aptamer. Since the affinity of Salmonella when binding to the aptamer is higher than that of the initiator chain, the initiator chain will dissociate from the aptamer and be free in the solution system. Magnetic separation is performed with the help of a magnetic field, and a supernatant containing free initiator chains is obtained after magnetic separation. The free initiator chain in the supernatant is used to trigger the catalytic hairpin self-assembly (CHA) cycle. Two hairpin DNA structures (H1 and complementary chain H2 with FAM fluorophore label and BHQ1 fluorescence quencher) are added to the system to participate in the CHA cycle. The initiator chain can hybridize with the DNA chain of H1, open the H1 hairpin structure, and then trigger H2 to complement the H1 DNA to form a hybrid double strand. After the double strand is formed, the FAM fluorophore on H1 is restored, releasing the initiator chain, triggering the next CHA cycle, and the system can produce a large amount of H1-H2 DNA double strands. Due to the cyclic amplification of CHA, a large number of H1-H2 double chains that restore the FAM fluorophore are generated in the system, so that the entire system has a strong fluorescence signal, thereby realizing the rapid detection of Salmonella through fluorescence values.

[0006] Preferably, the sequences of Apt1, Apt2, Tri, Linker and priming chain are as follows: Apt1: CTATCATGGCAAGGTCCTACGCAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT Apt2: CTACGTCAGCGTTAGACTGAACAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT Tri: CTACGTCAGCGTTAGACTGAACAAAACTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTCTGATGTCGGTAGT Linker: CGAGTCATCTGTCTACTGAGCCAAAAAAAAA H1: GGTTACAGTTATGTGTACCACTGTAACCACGGTG H2: TATGTGTACCTGGTTACAGTGGTACACATAACTGTAACC trigger (CHA): CACCGTGGTTACAGT

[0007] Compared with the prior art, the advantages or beneficial effects of the technical solution of the present application include: Compared with the traditional Salmonella detection method, which is very complex and time-consuming, and the common immunoassay method with high cost, such as enrichment culture, selective separation, morphological characteristics observation, physiological and biochemical reactions and final serological identification, this method constructs a detection system based on a multivalent aptamer initiator chain (MTAI) with a triangular configuration combined with catalytic hairpin self-assembly (CHA) technology, and obtains a relatively low-cost, convenient and sensitive Salmonella detection method. This method uses the initiator chain to circulate in CHA, guides the two hairpin DNAs in the system to form a double-stranded DNA structure with fluorescent signals, amplifies the fluorescent signal of the system, improves the sensitivity of the detection system, and finally makes the detection limit of Salmonella reach 10 CFU / mL, which is much lower than most Salmonella sensors reported in the literature. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1 This is the fluorescence intensity detection chart of milk solution; Figure 2 This is a fluorescence intensity detection chart of egg white solution; Figure 3 This is a fluorescence intensity detection chart of chicken solution. DETAILED DESCRIPTION

[0009] The following will describe the implementation methods of the present application in detail with reference to the accompanying drawings and embodiments, so that the implementation process of how the present application applies technical means to solve technical problems and achieve corresponding technical effects can be fully understood and implemented accordingly. The embodiments of the present application and the various features in the embodiments can be combined with each other without conflict, and the technical solutions formed are all within the protection scope of the present application.

[0010] It should be clear that the embodiments described below are only part of the embodiments of the present application, rather than all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by technicians in the relevant field without making creative work are within the scope of protection of the present application. Example 1

[0011] First, all DNA sequences were dissolved in 1× TMS buffer to a final concentration of 50 μM. Apt1, Apt2, Tri, Linker at a concentration of 1 μM and the priming chain at a concentration of 4.5 μM were added to the 1× TMS buffer.

[0012] The solution (25 μL) was heated to 95°C for 4 min, rapidly cooled to 4°C, and the solution was kept at 4°C for 1 min to prepare a triangular multivalent aptamer initiator chain (Tri-MAI).

[0013] The free chains were removed by ultrafiltration to obtain pure Tri-MAI.

[0014] Next, 4 μL of 10 mg / mL streptavidin-coupled nanoparticles (SA-MNPs) were washed with 50 μL PBS and then resuspended in 25 μL Tri-MAI solution and incubated at room temperature for 0.5 h to obtain the triangular multivalent aptamer initiator chain (MTAI) with magnetic nanoparticles.

[0015] The supernatant of MTAI was then removed by magnetic separation and washed three times with 200 μL PBS. Then, 25 μL of the pretreated 10 6 CFU / mL Salmonella solution was added to MTAI and incubated at room temperature for 1 hour. Finally, the supernatant containing the initiator was removed by magnetic separation. 1 μM H1 and 1.5 μM H2 were added to the supernatant and incubated at room temperature for 1 hour for CHA reaction. Finally, the system was tested for fluorescence signals, and the fluorescence signals with wavelengths between 510nm and 550nm were recorded. Example 2

[0016] Locally sourced milk, eggs and chicken were used as food samples.

[0017] The milk was centrifuged at 6000 rpm for 10 min to remove some impurities and collect the supernatant.

[0018] The eggshells were washed with 70% (v / v) ethanol and broken with a sterilized fork. The egg white was centrifuged at 1000 rpm for 5 min.

[0019] 25 g of chicken was added to 225 mL of PBS and mixed evenly in a homogenizer for about 2 min. Then, the mixture was centrifuged at 2000 rpm for 10 min and the supernatant was collected as the chicken matrix.

[0020] How much MTAI should be added to the above substrates respectively to carry out CHA reaction and obtain the fluorescence intensity value of the solution.

[0021] At the same time, different concentrations (101-107 CFU / mL) of Salmonella were added to milk, eggs and chicken by dilution method. The samples with added Salmonella were tested. The test results are as follows: Figure 1-Figure 3 shown.

Claims

1. A method for preparing a triangular multivalent aptamer initiator chain with magnetic nanoparticles, characterized in that: The steps include: S01, all DNA sequences were dissolved in 1× TMS buffer to a final concentration of 50 μM; S02, adding Apt1, Apt2, Tri, Linker and initiator chain into 1×TMS buffer to obtain a mixed solution; S03, heating the mixed solution to 95°C for 4 min, then rapidly cooling it to 4°C, and keeping the solution at 4°C for 1 min, to prepare a crude product of a multivalent aptamer initiator chain with a triangular configuration; S04, after the crude product of multivalent aptamer initiator chain is subjected to ultrafiltration to remove free chains, a multivalent aptamer initiator chain is obtained, which is denoted as Tri-MAI; S05. Wash the streptavidin-coupled nanomagnetic beads with PBS, then resuspend them in Tri-MAI solution and incubate them at room temperature for 0.5 h to obtain a triangular multivalent aptamer initiator chain with magnetic nanoparticles, which is denoted as MTAI.

2. The method for preparing a triangular multivalent aptamer initiator chain with magnetic nanoparticles according to claim 1, characterized in that: The sequences of Apt1, Apt2, Tri, Linker and priming chain are shown in SEQ ID: 1-SEQ ID: 4.

Images