Respiratory distress syndrome animal model and application thereof in screening RDS biomarker C16-carnitine

Abstract

The invention discloses a respiratory distress syndrome animal model and an application of the respiratory distress syndrome animal model in screening of an RDS biomarker C16-carnitine. The invention provides an application of a substance for inhibiting expression of Cact protein or coding gene, or a substance for knocking out all or part of Cact coding gene in preparation of an animal model of respiratory distress syndrome. The invention also provides a preparation method of the animal model of the respiratory distress syndrome, which comprises the following steps: knocking out 2nd to 5th exons of the Cact genes on two chromosomes of a mouse to obtain a Cact gene knockout mouse; the model is an animal model of the respiratory distress syndrome. According to the method for establishing the more reliable and effective respiratory distress syndrome mouse model, a powerful experimental basis is provided for development of pathophysiological research and treatment strategies of the respiratory distress syndrome, contributions are made to improvement of health and life quality of premature infants, and the method is of great importance to neonatal respiratory distress and early diagnosis and treatment of the neonatal respiratory distress.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to an animal model of respiratory distress syndrome and application thereof in screening an RDS biomarker C16-carnitine. Background Art

[0002] Neonatal respiratory distress syndrome (RDS) is a common clinical critical illness in neonates, with a particularly high incidence in premature infants, which seriously threatens the life and health of premature infants and is one of the main causes of death and disability in neonates. The etiology and pathogenesis of neonatal respiratory distress syndrome are complex. It is mainly caused by secondary pulmonary surfactant (PS) deficiency, which leads to alveolar collapse, making it impossible for neonates to exchange gases normally, resulting in dyspnea and hypoxia. It also has inflammatory characteristics and is one of the critical and emergency diseases caused by airway obstruction, lung disease, cardiovascular problems or central nervous system disorders.

[0003] At present, although great progress has been made in the clinical treatment of respiratory distress syndrome (RDS) using respiratory support, pulmonary surfactant replacement therapy, extracorporeal membrane oxygenation therapy, and nutritional support, there are still many unclear points about the mechanism and treatment of the disease. In addition, premature infants are light in weight and difficult to administer, making the treatment process relatively difficult. Therefore, establishing a reliable and effective mouse model of respiratory distress syndrome has become an urgent need for researchers and the medical community. The establishment of a mouse model can simulate the pathogenesis and mechanism of respiratory distress syndrome (RDS), and provide a strong experimental basis for the pathophysiological study of respiratory distress syndrome (RDS) and the development of treatment strategies. In addition, compared with large animal models, mouse models have the advantages of being economical, rapid, and easy to operate, so they have become the preferred model for the study of respiratory distress syndrome (RDS). Some researchers have tried to establish mouse models by simulating the deficiency of pulmonary surfactant through gene knockout, RNA interference and other technologies. Other researchers have induced symptoms of dyspnea in mice by artificially intervening in oxygen concentration and respiratory environment. However, there is currently a lack of a widely accepted and reliable mouse model of respiratory distress syndrome. Some methods have problems such as complex operation, low success rate, and poor reproducibility, which limit the further application and promotion of the model. Therefore, it is necessary to further explore more reasonable and effective modeling methods to provide a more reliable animal model for the research and treatment of respiratory distress syndrome (RDS).

[0004] In conclusion, the establishment of the mouse model of respiratory distress syndrome is of great significance for studying the mechanism and treatment of respiratory distress syndrome (RDS).

[0005] Markers can be used as biological indicators to indicate and quantify the extent of respiratory diseases or injuries. These indicators are valuable for studying, diagnosing, treating and monitoring the development and treatment effects of respiratory diseases. Specifically: (1) Early diagnosis: Markers can be used to diagnose early respiratory diseases or their deterioration. By detecting changes in markers, patients' respiratory problems can be discovered earlier, which helps to take early intervention measures. (2) Disease classification: Different types of respiratory diseases have specific markers. By identifying and analyzing these markers, the type and severity of the disease can be determined. (3) Prognosis assessment: Markers can assess the patient's prognosis, that is, predict whether the patient will have further complications or disease deterioration. This helps to develop personalized treatment plans and medical management decisions. (4) Evaluation of treatment effects: During treatment, markers can be used to monitor the treatment effect. By regularly detecting changes in markers, it is determined whether the treatment is effective and whether the treatment plan needs to be adjusted. (5) Drug development and clinical trials: Markers can be used as indicators for efficacy evaluation during drug development to help determine the effectiveness of candidate drugs. In clinical trials, they can be used to monitor patient response and safety.

[0006] Therefore, screening for markers of respiratory distress in mouse models is essential to assess respiratory health and disease states. Summary of the invention

[0007] The present invention provides a constructed disease animal model of respiratory distress syndrome, and the constructed animal model can be used to study respiratory distress syndrome, especially neonatal respiratory distress syndrome, screen candidate drugs for treating respiratory distress syndrome in animals and humans, especially neonatal respiratory distress syndrome, and explore drug targets for respiratory distress syndrome in animals and humans.

[0008] In a first aspect, the present invention provides the use of a substance that inhibits the expression of Cact protein or encoding gene, or a substance that knocks out all or part of the Cact encoding gene in preparing an animal model of respiratory distress syndrome.

[0009] In the above application, the animal model is a mammal model;

[0010] Furthermore, it is specifically a mouse model.

[0011] In a second aspect, the present invention provides a method for preparing a mouse model of respiratory distress syndrome, comprising the following steps: knocking out exons 2-5 of the Cact gene on two chromosomes of the mouse to obtain a Cact gene knockout mouse; that is, a mouse model of respiratory distress syndrome.

[0012] In an embodiment of the present invention, the above-mentioned knockout of exons 2-5 of the Cact gene on two chromosomes of the mouse is achieved by the following scheme:

[0013] Cacti kept in SPF animal room fl / + Mouse and Cact fl / + After the mice were mated, the offspring F1 mice were identified by PCR (amplification using Slc25a20-5wt primers and Slc25a20-3wt primers), and Cact fl / fl mouse (Slc25a20-5wt primers have a 468 bp band, and Slc25a20-3wt has a 318 bp band).

[0014] Then Cact fl / fl Mouse and Zp3 Cre Mice were mated, and the offspring F2 mice were identified by PCR (using Slc25a20-5wt primer, Slc25a20-3wt primer and Zp3 Cre Primer amplification), select Cact fl / + ; Zp3 Cre Mouse (Slc25a20-5wt has two bands of 468bp and 366bp; Slc25a20-3wt has two bands of 318bp and 215bp; Zp3Cre primer has a 350bp band).

[0015] Then Cact fl / + ; Zp3 Cre Female mice and Cact fl / + Mice were mated, and the offspring F3 mice were identified by PCR (using Slc25a20-5wt primer, Slc25a20-3wt primer, Zp3 Cre Primer and cact null primer amplification), select Cact + / - Mouse (Slc25a20-5wt has two bands of 468bp and 366bp; Slc25a20-3wt has two bands of 318bp and 215bp; Zp3Cre primer has a 350bp band; cact null primer has a 362bp band).

[0016] Then Cact + / - Mouse and Cact + / - The mice were mated to obtain F4 mice, and wild-type mice (Cact + / +) (Slc25a20-5wt and Slc25a20-3wt have bands (one or two), but no cact null band) and double positive homozygous mice (Cact - / - ).

[0017] Cact + / + Mice were denoted as wild-type mice (Control mice) and Cact - / - The mice were recorded as whole-body Cact knockout mice, which is a mouse model of respiratory distress.

[0018] In a second aspect, the present invention provides use of the mouse model prepared by the method of the first aspect in any of the following:

[0019] 1) Screening or developing candidate therapeutic drugs for respiratory distress syndrome in humans or mammals;

[0020] 2) Screening drug targets for respiratory distress syndrome in humans or mammals.

[0021] In a third aspect, the present invention provides the use of C16-carnitine as a drug treatment target in developing candidate therapeutic drugs for respiratory distress syndrome in humans or animals.

[0022] In a fourth aspect, the present invention provides the use of a target protein of C16-carnitine in the preparation of a candidate therapeutic drug for respiratory distress syndrome in humans or animals;

[0023] Alternatively, the present invention provides a target protein of C16-carnitine for treating Pdgfrα caused by Cact deficiency. + Application of products that induce disease by increasing levels of stromal cell proliferation;

[0024] In the application described above, the target protein of the C16-carnitine is Samhd1.

[0025] Pdgfrα caused by Cact deficiency + The disease induced by the increased level of interstitial cell proliferation is specifically a human or animal lung dysfunction disease, and in an embodiment of the present invention, further is a human or animal respiratory distress syndrome.

[0026] In a fifth aspect, the present invention provides a product for treating respiratory distress syndrome in humans or animals, wherein the active ingredient is a target protein of C16-carnitine.

[0027] In the product described above, the target protein of the C16-carnitine is the Samhd1 protein.

[0028] In the above, the respiratory distress syndrome is neonatal respiratory distress syndrome.

[0029] The technical solution adopted by the present invention to solve the technical problem is as follows:

[0030] (1) We constructed and bred Cact knockout mice. Cact knockout mice were significantly smaller in size and lighter in weight, with significantly increased lung weight. They died within 24 hours after birth, accompanied by asthma and systemic cyanosis, showing typical symptoms of respiratory distress. We established a mouse model of respiratory distress syndrome.

[0031] (2) Liquid chromatography-mass spectrometry (LC-MS / MS) was used to detect the lipid composition of wild-type and Cact knockout mice during lung development. Compared with wild-type littermates, C16-carnitine was significantly accumulated in the whole lung tissue of Cact knockout mice.

[0032] In summary, during the development of mouse lungs, Cact is a key transporter of acylcarnitine in the process of fatty acid β-oxidation. Its absence can lead to asthma, systemic cyanosis, and respiratory distress syndrome in newborn mice. In addition, C16-carnitine accumulates significantly in mice with respiratory distress, and the accumulation of C16-carnitine reduces Pdgfrα + The level of Samhd1 protein in mesenchymal progenitor cells triggers an increase in the proliferation of this cell type, resulting in rich lung mesenchyme, thick septal walls, and increased tissue density in mice, accompanied by impaired structural maintenance of type I alveolar epithelial cells, leading to defects in lung development. Among them, Samhd1, the target protein of C16-carnitine, can be used to rescue Pdgfrα caused by Cact deficiency. + Proliferation of interstitial cells may thus serve as a fundamental therapeutic target for neonatal respiratory distress.

[0033] Compared with the prior art, the present invention has the following beneficial effects: The method of establishing a more reliable and effective mouse model of respiratory distress syndrome provides a strong experimental basis for the pathophysiological research and treatment strategy development of respiratory distress syndrome, and contributes to the improvement of the health and quality of life of premature infants. Early diagnosis and treatment are crucial for neonatal respiratory distress. Based on this model, it was found that C16-carnitine can be used as a biomarker for neonatal respiratory distress, and the target protein Samhd1 of C16-carnitine was further found (Uniprot ID: Q60710, Gene ID: 56045, NM_001139520.2, update 08-AUG-2023). Overexpression of this protein can be used to rescue Pdgfrα caused by Cact deficiency. + The proliferation of interstitial cells can thus serve as a basic therapeutic drug for neonatal respiratory distress. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The change pattern of acylcarnitine content over time.

[0035] Figure 2 (A) is the expression pattern of Cpt1, Cpt2 and Cact in lung development; (AC) is the expression of Cpt1, Cpt2 and Cact in lung tissues at different developmental stages detected by protein immunoblotting; (DF) is the transcription level of Cpt1, Cpt2 and Cact in lung tissues at different developmental stages detected by qRT-PCR, and the results were compared with the transcription level at E12.5 days after being standardized with β-actin; the data were analyzed by one-way ANOVA and Tukey's multiple-comparison test for significance of the differences, there were 9 mice in each group, and the values ​​in the figure are mean ± standard error, * represents significant difference, ** represents very significant difference, *** represents extremely significant difference, and ns represents insignificant difference.

[0036] Figure 3 For Cact - / - Mice died after birth; (A) Control and Cact mice in the same litter - / - Photos of newborn mice, scale equals 0.2 cm; (B) P0 day, Control and Cact - / - Mouse weight statistics; (C) Control and Cact mice - / - Mouse survival curve; (D) P0 day, Control and Cact - / - Statistics of the ratio of lung weight to body weight of mice; (BD) The values ​​in the figure are mean ± standard error, the number of mice in each group is 11, ** represents a very significant difference, ns represents an insignificant difference, and the statistical method is Student's t-test.

[0037] Figure 4 Knockout of Cact leads to lung development disorder; (A) P0 day whole lung anatomy, the dotted box is the enlarged image, the scale is equal to 25mm; (B) Control and Cact - / - (C) HE staining of the left lung at E16.5 and E18.5, the dotted box is the enlarged image, the scale bar is 500μm; (D) Control mice and Cacti - / - The proportion of alveolar space in mice. There were 11 mice in each group. The values ​​in the figure are mean ± standard error. ** indicates a very significant difference. The statistical method was Student's t-test.

[0038] Figure 5The lack of Cact leads to impaired morphology of type I alveolar epithelial cells; (A) Representative immunofluorescence staining of Rage and Sftpc on P0 day, arrows indicate AT1 cells, and the scale bar is 50 μm; (B) Representative immunofluorescence staining of Aqp5 and Abca3 on P0 day, arrows indicate AT1 cells, and the scale bar is 50 μm.

[0039] Figure 6 Cact deficiency leads to Pdgfrα + Increased cell proliferation; (A) Immunofluorescence staining of lung tissue sections co-stained with Pdgfrα and Ki67, arrows point to Pdgfrα and Ki67 double-positive cells, scale equals 50μm; (B) Statistics of the ratio of Ki67 and Pdgfrα double-positive cells to Pdgfrα positive cells; There were 6 mice in each group, and the values ​​in the figure are mean ± standard error, *** represents extremely significant difference, ns represents insignificant difference, and the statistical method is Student's t-test.

[0040] Figure 7 Figure 2 is a heat map of quantitative changes in acylcarnitine subclasses; (A) Quantitative changes in acylcarnitine subclasses during lung development, with corresponding scores plotted based on the MFP values ​​of each lipid type. There were 4 mice in each group. MFP: molar fraction of total polar lipids; (B) The box plot shows the changes in acylcarnitines during lung development (E18.5 and P0). The top is the P value, n=4, and the statistical method is ANOVA test.

[0041] Figure 8 C18-carnitine and C16-carnitine promote explant Pdgfrα + Cell proliferation; (A) Immunofluorescence staining of Pdgfrα and Ki67 in lung tissue sections after 24h of explant culture treated with 5μM, 50μM and 500μM C16-carnitine. Arrows point to Ki67 and Pdgfrα double-positive cells, and the scale bar is 200μm; (B) Statistics of the ratio of Ki67 and Pdgfrα double-positive cells to Pdgfrα positive cells after treatment in A; (C) 5μM Lung tissue sections after C16-carnitine treatment for 24 h of explant culture, immunofluorescence staining of Pdgfrα and Ki67, arrows point to Ki67 and Pdgfrα double-positive cells, scale equals 200 μm; (D) is the statistics of the ratio of Ki67 and Pdgfrα double-positive cells to Pdgfrα positive cells after C treatment, the number of mice in each group was 9, the values ​​in the figure are mean ± standard error, *** represents extremely significant difference, ns represents insignificant difference, the statistical method is Student's t-test.

[0042] Fig. 9C16-carnitine promotes Pdgfrα + Primary cell proliferation; (A) Immunofluorescence staining of Pdgfrα and pH3 after primary interstitial cells were treated with different concentrations of C16-carnitine for 24 hours. Arrows point to Pdgfrα and pH3 double-positive cells, and the scale is 20 μm; (B) Growth curve of primary interstitial cells treated with different concentrations of C16-carnitine. The number of mice in each group was 9. The values ​​in the figure are mean ± standard error. ** represents very significant difference, *** represents extremely significant difference, ns represents insignificant difference, and the statistical method is ANOVA test.

[0043] Fig.10 The DARTS results identified Samhd1 as a C16-carnitine binding protein; DARTS identified C16-carnitine small molecule binding proteins without preference in the colloidal Coomassie Brilliant Blue staining image, and the red arrow indicates the protected band.

[0044] Fig.11 The DARTS results confirmed the specific binding of C16-carnitine to Samhd1; (AE) Western blot detected the protein levels of Hsc70, Iqgap1, Kdm1, Narg1 and Samhd1.

[0045] Fig.12 For Cact - / - The expression level of Samhd1 in mouse lung tissue was reduced; (A) Western blotting was used to detect the expression level of Samhd1 in lung tissue; (B) Immunofluorescence staining of Pdgfrα and Samhd1 in lung tissue sections, arrows point to Pdgfrα and Samhd1 double-positive cells, scale bar equals 50μm; (C-D) Western blotting was used to detect the expression level of Samhd1; (E) Immunofluorescence staining of Pdgfrα and Samhd1, arrows point to Pdgfrα and Samhd1 double-positive cells, scale bar equals 50μm.

[0046] Fig.13 Overexpression of Samhd1 can rescue Cact - / - Defective proliferation of mesenchymal progenitor cells in mice; (A) wild type and Cact - / -Ki67 and Pdgfrα staining images of mouse primary stromal cells after addition of lentivirus (pEF1-mCherry empty vector and pEF1-mCherry-Samhd1), arrows point to Pdgfrα, Ki67 and mCherrys triple-positive cells, scale equals 100μm; (B) Statistical graph of the ratio of Ki67 and Pdgfrα double-positive cells to Pdgfrα positive cells in Figure A, the number of mice in each group was 12, the values ​​in the figure are mean ± standard error, ** represents a very significant difference, ns represents an insignificant difference, and the statistical method is ANOVA test. DETAILED DESCRIPTION

[0047] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0048] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0049] E14.5 and E17.5 indicate embryonic developmental days 14.5 and 17.5, respectively.

[0050] P0, P1, P7 and P21 are day 0, 1, 7 and 21 after the birth of mice, respectively.

[0051] Fetal lungs are embryonic lungs.

[0052] Example 1. Discovery of the gene Cact associated with neonatal respiratory distress syndrome (RDS) and preparation of RDS animal model

[0053] 1. Discovery of Cact, a gene associated with neonatal respiratory distress syndrome (RDS)

[0054] 1. Change pattern of acylcarnitine content over time

[0055] Using high-coverage, quantitative lipidomics methods, lipidomic maps of whole lung tissues of C57BL / 6J mice (Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd., Strain ID: T018830) at different developmental stages (E14.5, E17.5, P0, P1, P7 and P21) were constructed.

[0056] It was found that the content of acylcarnitine showed time-specific changes during lung development: its content was very high at E14.5 and decreased significantly at E17.5, suggesting that acylcarnitine may play a key role in the embryonic development of the lung ( Figure 1 ).

[0057] 2. Expression patterns of Cpt1, Cpt2 and Cact in lung development

[0058] Acylcarnitine is an intermediate product of mitochondrial fatty acid β-oxidation. In this process, activated fatty acids enter the mitochondrial matrix in the form of acyl-CoA for β-oxidation, but medium-chain acyl-CoA and long-chain acyl-CoA cannot directly pass through the mitochondrial inner membrane and enter the mitochondrial matrix with the help of carnitine. Acyl-CoA and carnitine combine to form acylcarnitine through Cpt1 on the outside of the mitochondrial inner membrane. Then, it is transported into the inner side of the mitochondrial inner membrane by the mitochondrial inner membrane translocase Cact, and acylcarnitine is decomposed into acyl-CoA and carnitine through Cpt2 on the mitochondrial inner membrane, completing the carnitine shuttle. Acylcarnitine enters the mitochondrial matrix for fatty acid β-oxidation to form acetyl-CoA and propionyl-CoA. Acetyl-CoA, propionyl-CoA and carnitine combine to form acetylcarnitine and propionylcarnitine, which are then transported to the cytoplasm through Cact.

[0059] Preliminary experimental results found that during lung development, the expression pattern of Cact was very consistent with the change pattern of acylcarnitine content, suggesting that Cact can control the metabolic pathway of acylcarnitine.

[0060] The expression of Cpt1, Cpt2, and Cact in the lung tissues of wild-type C57BL / 6J mice at E12.5, E14.5, E16.5, and E18.5 was detected. The specific method is as follows:

[0061] 1) Western blotting

[0062] Proteins were extracted from lung tissues of wild-type C57BL / 6J mice at E12.5, E14.5, E16.5, and E18.5, and detected by western blotting.

[0063] 2) qRT-PCR detection

[0064] Genomic DNA was extracted from lung tissues of wild-type C57BL / 6J mice at E12.5, E14.5, E16.5, and E18.5, and qRT-PCR was performed using the following primers. The primer sequences are shown in Table 1.

[0065] Table 1 shows the primer sequences

[0066]

[0067] The results of protein immunoblotting experiments were as follows Figure 2 As shown in A-2C, the qRT-PCR test results are Figure 2 As shown in D-2F, it can be seen that the temporal expression pattern of Cact in mouse lung tissue is very consistent with the content change pattern of acylcarnitine during lung development, suggesting that Cact is likely to control the changes in acylcarnitine flux.

[0068] Therefore, reverse genetics can be used to manipulate Cact in tool mice to reveal the role of acylcarnitine in the development and function maintenance of lung organs.

[0069] 2. Construction of RDS mouse model

[0070] 1. Construction of Cact knockout mice

[0071] In order to further study the role of mitochondrial inner membrane translocase Cact in the morphogenesis, fate determination, cell differentiation and homeostasis maintenance of mouse lung tissue, and to more deeply explore the molecular mechanism of its function, we designed and bred mice with whole-body Cact knockout.

[0072] The details are as follows:

[0073] 1) Cact fl / fl Mouse and Zp3 Cre Acquisition of mice

[0074] Cact containing alleles inserted into the flox site was synthesized by Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. fl / + Mouse.

[0075] The constitutive Cre tool mouse strain Zp3 is widely expressed in the mouse zona pellucida 3 (Zp3) promoter Cre Mouse (described in the following literature, the name of the mouse in the literature is Zp3-cre, Lewandoski M, Wassarman KM, Martin GR (1997) Zp3-cre, a transgenic mouse line for the activation or inactivation of loxP-flanked target genes specifically in the female germline. Current biology: CB 7: 148-151).

[0076] The Zp3 promoter is involved in expression regulation in oocytes only before the completion of the first meiotic division.

[0077] 2) Cact - / - Acquisition of mice

[0078] Cacti kept in SPF animal room fl / + Mouse and Cact fl / + After the mice were mated, the offspring F1 mice were identified by PCR (amplification using Slc25a20-5wt primers and Slc25a20-3wt primers), and Cact fl / flmouse (Slc25a20-5wt primers have a 468 bp band, and Slc25a20-3wt has a 318 bp band).

[0079] Then Cact fl / fl Mouse and Zp3 Cre Mice were mated, and the offspring F2 mice were identified by PCR (using Slc25a20-5wt primer, Slc25a20-3wt primer and Zp3 Cre Primer amplification), select Cact fl / + ; Zp3 Cre Mouse (Slc25a20-5wt has two bands of 468bp and 366bp; Slc25a20-3wt has two bands of 318bp and 215bp; Zp3Cre primer has a 350bp band).

[0080] Then Cact fl / + ; Zp3 Cre Female mice and Cact fl / + Mice were mated, and the offspring F3 mice were identified by PCR (using Slc25a20-5wt primer, Slc25a20-3wt primer, Zp3 Cre Primer and cact null primer amplification), select Cact + / - Mouse (Slc25a20-5wt has two bands of 468bp and 366bp; Slc25a20-3wt has two bands of 318bp and 215bp; Zp3Cre primer has a 350bp band; cact null primer has a 362bp band).

[0081] Then Cact + / - Mouse and Cact + / - The mice were mated to obtain F4 mice, and wild-type mice (Cact + / + ) (Slc25a20-5wt and Slc25a20-3wt have bands (one or two), but no cact null band) and double positive homozygous mice (Cact - / - ).

[0082] Cact + / + Mice were denoted as wild-type mice (Control mice) and Cact - / - The mice were recorded as whole-body Cact knockout mice, which is a mouse model of respiratory distress.

[0083] The above PCR identification is as follows:

[0084] Slc25a20-5wt Primers:

[0085] Slc25a20-5wt-F1 GGCCTTACCTCATAACACTGTTACTG

[0086] Slc25a20-5wt-R1TTAGATTGGTCCTTACTGCCGG

[0087] Slc25a20-3wt Primers:

[0088] Slc25a20-3wt-F2 ATGCCGTCTTCTGGCTTGTATG

[0089] Slc25a20-3wt-R2 GAGCCTTCCAGTCTGAATGATG

[0090] cact null primer:

[0091] cact null FGGCCTTACCTCATAACACTGTTACTG

[0092] cact null R GAGCCTTCTCAGTCTGAATGATG

[0093] ZP3-cre Primer:

[0094] F:GCGGTCTGGCAGTAAAAACTATC

[0095] R: GTGAACAGCATGCTGTCactT.

[0096] Cact - / - The mice were obtained by knocking out exons 2-5 (NM_020520.5, 06-AUG-2023 position: 291-700) of the Cact gene (ID: 57279, updated on September 7, 2023) on both chromosomes of C57BL / 6 mice.

[0097] 2. Identification of a mouse model of neonatal respiratory distress

[0098] Detect the newly generated Cact - / - Mice, as follows:

[0099] 1) Appearance inspection

[0100] Detection of littermates Control and Cact - / - Neonatal mouse morphology, results as Figure 3 As shown in A, compared with Control, Cact- / - The mice were small in size, cyanotic, and had severe respiratory distress.

[0101] P0 Day Statistics Freshman Cact - / - The weight of mice and control mice was Figure 3 As shown in B, it can be seen that Cact - / - The body weight of mice decreased significantly.

[0102] Control and Cact - / - The survival rate of mice was statistically analyzed to draw a survival curve, and the results showed that Cact - / - Mice die within 24 hours after birth ( Figure 3 C), the body surface is purple ( Figure 3 A).

[0103] P0 day, Control and Cact - / - The ratio of lung weight to body weight of mice was statistically analyzed. Figure 3 As shown in D, it can be seen that compared with Control, Cact - / - The mice's lung weight-to-body weight ratio increased, suggesting problems with lung development.

[0104] 2) Lung tissue analysis

[0105] In order to explore the cause of respiratory distress in Cact knockout mice immediately after birth, control and Cact - / - Mouse lung tissues were analyzed as follows:

[0106] Lung tissue morphology analysis:

[0107] Control mice and Cacti on P0 - / - Mouse whole lung dissection, the results are as follows Figure 4 As shown in A, it can be seen that compared with Control, Cact - / - The mouse lungs were thicker and less translucent in the middle, with thinner small vacuoles at the edges, indicating a developmental disorder of the terminal branches.

[0108] Analysis of lung appearance:

[0109] P0 day Control and Cact - / - Mouse lung tissue was subjected to a sinking and floating experiment. The results were as follows Figure 4 As shown in B, it can be seen that when the lungs of P0 mice were placed in PBS, Cact - / - The mouse lungs will sink to the bottom of the bottle after about 6 hours. This is due to Cact - / - This is caused by the mouse lungs not being fully inflated.

[0110] The above results show that Cact - / - The mouse lungs could not fully expand at P0, suggesting that Cact - / - The mice were developmentally defective during the onset of alveolarization.

[0111] Analysis of embryonic development of the lung:

[0112] To further answer whether the loss of Cact would affect the embryonic development of the lung, we traced back to the key time points of lung embryonic development: the pseudoglandular duct stage and the sac stage.

[0113] Control and Cact - / - HE staining of the left lung of mice at E16.5 and E18.5. Figure 4 As shown in C, in the pseudo-duct stage, the control and Cact - / - There were no significant differences in the structure of the mouse lungs.

[0114] Control and Cact - / - The alveolar space in the mouse lung tissue was stained with hematoxylin-eosin staining for morphological analysis. The alveolar space ratio is the percentage of the alveolar area to the space in a specific area.

[0115] The results are as follows Figure 4 D shows that compared with the control, Cact - / - Mouse lungs exhibited an abnormally dense lung architecture: smaller cystic spaces, thickened alveolar septa, and abundant mesenchyme.

[0116] The above results indicate that Cact plays an important role in the development of embryonic lungs. The absence of Cact will lead to an increase in lung tissue density, causing atelectasis in mice, and thus causing respiratory distress in newborn mice. - / - The mouse is a mouse model of neonatal respiratory distress syndrome.

[0117] 3. Mechanism of Cact Missing

[0118] 1. Cact deficiency leads to impaired morphology of type Ⅰ alveolar epithelial cells

[0119] Alveolar epithelial cells, as respiratory functional epithelial cells of mice, are composed of type I alveolar epithelial cells (Alveolar type 1, AT1) and type II alveolar epithelial cells (Alveolar type 2, AT2). Type I alveolar epithelial cells are slender in shape and are located adjacent to capillaries, ensuring sufficient contact with blood vessels to improve the efficiency of gas-blood exchange. They are the executors of gas exchange; type II alveolar epithelial cells are cubic in shape and are generally located in the middle of the alveolar structure. They maintain the tension of the alveolar structure by secreting surfactant proteins and some lipids. The maintenance of the tension of the alveolar structure is a necessary condition for respiration.

[0120] Detecting Hopx + Type I alveolar epithelial cells and Sftpc + The differentiation state of type Ⅱ alveolar epithelial cells was investigated. It was found that Cact deficiency did not affect the differentiation of type Ⅰ and type Ⅱ alveolar epithelial cells.

[0121] Control and Cact on P0 day - / - Immunofluorescence staining of Rage, Sftpc, Aqp5, and Abca3 in mouse lung tissue. Rage and Aqp5 are early and mature marker proteins of type I alveolar epithelial cells, respectively; Sftpc and Abca3 are early and mature marker proteins of type II alveolar epithelial cells, respectively.

[0122] The results are as follows Figure 5 As shown in A and 5B, it was found that compared with the Control, the number of type I and type II pneumocytes was not affected; in the Control, type I pneumocytes covered the alveolar surface and showed a thin wall and flat morphology, but in Cact - / - Most of the type I alveolar epithelial cells in the lung tissue of mice were densely packed and failed to flatten. There was no significant change in type II alveolar epithelial cells between the two groups of mice.

[0123] 2. Ki67, a marker protein for cell proliferation

[0124] Control and Cact - / - Mouse lung tissue sections were subjected to immunofluorescence staining for co-staining of Pdgfrα and Ki67.

[0125] The results are as follows Figure 6 As shown in A and 6B, in Cact - / - Pdgfrα + Ki67 in mesenchymal progenitor cells + The number of signals increases significantly, namely Cact - / - Mouse lung tissue Pdgfrα + The proliferation level of mesenchymal progenitor cells was significantly increased.

[0126] The above results indicate that Cact deficiency increases Pdgfrα + The level of mesenchymal progenitor cell proliferation increases, causing the lung structure to compact, leading to respiratory distress.

[0127] Example 2: Screening of biomarker C16-carnitine and its target protein in a mouse model of respiratory distress syndrome

[0128] 1. Screening of biomarker C16-carnitine in mouse model of respiratory distress syndrome

[0129] 1. Cact deficiency significantly increases the level of C16-carnitine in the acylcarnitine isoform

[0130] According to existing research reports, Cact catalyzes the transport of medium- and long-chain acylcarnitines on the inner membrane of mitochondria and the reverse transport of free carnitine, and is a key transporter of acylcarnitines in the fatty acid β-oxidation metabolic pathway. Preliminary experimental results found that during lung development, the expression pattern of Cact was very consistent with the change pattern of acylcarnitine content, suggesting that Cact can control the metabolic pathway of acylcarnitine. The following hypothesis is proposed: If Cact can control the acylcarnitine content during mouse lung development, then is the lung development defect caused by Cact deficiency caused by abnormal acylcarnitine metabolism?

[0131] Wild-type control mice (control group, denoted as WT in the figure) and Cact knockout mice (Cact) from the same littermate on E18.5 and P0 were selected. - / - (denoted as KO in the figure) Whole lung tissue was detected and analyzed at the lipidomics level.

[0132] Compared with the control group, the total acylcarnitine content in the lungs of Cact-deficient mice was significantly increased at E18.5 and P0 ( Figure 7 A).

[0133] Acylcarnitines are classified into C2 to C22-carnitine according to the length and saturation of the acyl carbon chain. Among them, long-chain acylcarnitines such as C14-carnitine, C16-carnitine and C18-carnitine also have saturated subtypes without unsaturated bonds, monounsaturated subtypes with one unsaturated bond in the hydrocarbon chain, and polyunsaturated subtypes with two or more unsaturated bonds in the hydrocarbon chain. The different structures between the various subtypes suggest that they perform different functions.

[0134] Further analysis revealed that Cact deficiency had no significant effect on the content of short-chain acylcarnitine and medium-chain acylcarnitine, but had a particularly strong effect on the content of long-chain acylcarnitine, especially C16-carnitine. Figure 7AB), the content of C18-carnitine also has an effect, and the following experiments were carried out to verify it.

[0135] Based on the above results, it was found that Cact deficiency would significantly increase the level of C16-carnitine in the acylcarnitine isoform.

[0136] 2. C16-carnitine promotes Pdgfrα in explants in simulated fetal lung in vitro + Cell proliferation

[0137] Fetal lung explants were obtained as follows:

[0138] (1) Take a pregnant mouse at a certain period after embolization and inject 4% chloral hydrate solution into the peritoneum at a dose of 100 μL per 10 g of body weight. After the pregnant mouse is anesthetized, place it on its back on a dissecting board. Use forceps to carefully cut the abdominal cavity to expose the uterus, cut the inferior vena cava of the pregnant mouse, and when the blood stops flowing out, cut off the uterus and place it in a pre-cooled PBS solution.

[0139] (2) Carefully tear open the amniotic membrane with forceps under a dissecting microscope, separate the embryo from the placenta, and transfer the embryo to a pre-cooled HBSS solution. After transferring to 4°C, store the embryo for 24 hours.

[0140] (3) Take a 35 mm culture dish, add pre-cooled HBSS solution, place the embryo on its side in the dish, and then place the dish under a dissecting microscope. Under the microscope, hold the embryo's head and tail with forceps in the left hand, and use forceps in the right hand to cut open the embryo's back, find the liver and remove it, and the heart and lungs will be visible. After clamping the embryo's mouth and neck, use forceps to clamp the heart and gently pull it outward to separate the heart and lungs. Remove the interstitium and esophagus around the heart and lung tissue to obtain a complete fetal lung.

[0141] (4) Use a clean rubber-tipped pipette to transfer the separated fetal lungs into pre-cooled PBS for later use.

[0142] When lung explants were treated with 5 μM C16-carnitine for 24 h, proliferating cells were marked with Ki67 by immunofluorescence staining.

[0143] The details are as follows:

[0144] Control group: wild-type C57 BL / 6J mouse E12.5 embryonic lung (hereinafter referred to as wild-type E12.5 fetal lung) was placed in a culture well of a multi-well culture plate with a carrier sheet of a size that matched the lung, and a culture space was constructed at the bottom of the culture well; the obtained wild-type E12.5 embryonic lung was placed on the carrier sheet, and DMEM / F-12 culture medium (containing 5% StripFBS and 1% PS by volume) was added to place the lung at the junction of the culture medium and air; the lung was cultured in a 37°C incubator for 24 hours;

[0145] C16-carnitine treatment group: Wild-type C57BL / 6J mouse E12.5 embryonic lungs (hereinafter referred to as wild-type E12.5 fetal lungs) were placed in the culture wells of a multi-well culture plate with a carrier sheet of a size that matched their size, and a culture space was constructed at the bottom of the culture wells; the obtained wild-type E12.5 embryonic lungs were placed on the carrier sheet, and DMEM / F-12 culture medium (containing 5% StripFBS, 1% PS and 5μM C16-carnitine) was added to place the lungs at the interface of the culture medium and air; and the culture was carried out in a 37°C incubator for 24 hours.

[0146] C18-carnitine treatment group: Wild-type C57BL / 6J mouse E12.5 embryonic lungs (hereinafter referred to as wild-type E12.5 fetal lungs) were placed in the culture wells of a multi-well culture plate with a carrier sheet of a size that matched their size, and a culture space was constructed at the bottom of the culture wells; the obtained wild-type E12.5 embryonic lungs were placed on the carrier sheet, and DMEM / F-12 culture medium (containing 5% Strip FBS and 1% PS and 5μM, 50μM, and 500μM C18-carnitine) with different C18-carnitine concentrations was added to place the lungs at the interface of the culture medium and air; the culture was carried out in a 37°C incubator for 24 hours.

[0147] Immunofluorescence staining of Pdgfrα and Ki67 was performed on lung tissue sections of the above groups. The results of C18-carnitine treatment are shown in Figure 8 As shown in A and 8B, compared with the control, the addition of different concentrations of C18-carnitine to fetal lung explants for 24 h did not increase the expression of Pdgfrα + The proliferation level of cells.

[0148] The results of C16-carnitine treatment are as follows Figure 8 As shown in C and 8D, the number of Ki67-positive cells in the interstitial cell region of the explant increased significantly; Ki67 and Pdgfrα were co-stained, and the proportion of Ki67 and Pdgfrα double-positive cells to Pdgfrα-positive cells was counted. It was found that compared with the Control, 5μM C16-carnitine treatment of fetal lung explants after 24h of culture could significantly increase Pdgfrα + Therefore, it is further proved that C16-carnitine can be used as a biomarker in the mouse model of respiratory distress syndrome.

[0149] In summary, under in vitro culture conditions, 5 μM C16-carnitine treatment of wild-type mouse fetal lung explants can significantly increase the expression of Pdgfrα in explants. + The level of cell proliferation indicates that it will cause an increase in tissue density.

[0150] 3. C16-carnitine promotes Pdgfrα + Primary cell proliferation

[0151] In order to study the effect of C16-carnitine on Pdgfrα + Increased cell proliferation is directly related to Pdgfrα + Whether it is a cell or an indirect effect through other cells, primary mesenchymal cells isolated and cultured in vitro from the lungs of wild-type mice C57WT on P0 day were used as the research objects.

[0152] Normal culture (Control): Primary mesenchymal cells isolated and cultured in vitro on day P0 were cultured in DMEM basic (10% FBS, 1% PS) for 24 hours.

[0153] C16-carnitine treatment: P0 primary mesenchymal cells isolated and cultured in vitro were cultured in DMEM basic (10% FBS, 1% PS) medium supplemented with different concentrations of 100 nM, 1 μM, 10 μM, and 100 μM C16-carnitine for 24 h.

[0154] The results are as follows Fig. 9 As shown in A and 9B, it can be seen that when 1 μM C16-carnitine is used to treat primary mesenchymal cells for 24 hours, it can significantly promote the expression of Pdgfrα + Increased proliferation of mesenchymal progenitor cells. At concentrations of 100nM, 1μM, and 10μM, this promotion was C16-carnitine concentration-dependent, but C16-carnitine above 100μM was toxic to primary cells. Previous studies have shown that high concentrations of C16-carnitine lead to intracellular acidity and cell death.

[0155] The primary mesenchymal cells cultured under the above 1 μM C16-carnitine treatment conditions were labeled with the nuclear dye Hochest for live cells. By counting the number of cells during the cell culture process, it was found that under this condition, the primary cultured wild-type Pdgfrα + The number of interstitial cells is increased ( Fig. 9 A-9B).

[0156] In summary, C16-carnitine can promote Pdgfrα in vitro + Increased proliferation of interstitial cells, and this effect is directly on Pdgfrα + of the interstitial cells themselves.

[0157] 2. Acquisition of C16-carnitine target protein Samhd1 and its role in rescuing Pdgfrα caused by Cact deficiency + Application in increasing the proliferation level of mesenchymal cells

[0158] 1. DARTS results identified Samhd1 as a C16-carnitine binding protein

[0159] The technology of drug screening and target search with the help of small molecules is called drug affinity target stability (Darts drug affinity responsive target stability) technology, referred to as DARTS. DARTS is a traditional drug target search technology that uses physical or chemical methods, such as affinity chromatography and isotope tracing. It is based on the principle that after the small molecule binds to the target protein, the sensitivity of the target protein to protease degradation decreases, that is, the target protein has resistance to protease hydrolysis. It does not require drug protective modification and does not have drug activity dependence. Then, with the help of mass spectrometry technology, possible binding proteins are found and subsequent experimental verification is carried out. This technology has been proven to be feasible in many previous studies. The primary interstitial cells in the lungs of wild-type mice C57WT, isolated and cultured in vitro on P0 day were used as the research object.

[0160] Normal culture (Control): Primary mesenchymal cells isolated and cultured in vitro on day P0 were cultured in DMEM basic (10% FBS, 1% PS) for 24 hours.

[0161] C16-carnitine treatment: P0 primary mesenchymal cells isolated and cultured in vitro were cultured in DMEM basic (10% FBS, 1% PS) medium supplemented with different concentrations of 10 μM and 100 μM C16-carnitine for 24 h.

[0162] Proteins were extracted from cells treated with 10μM and 100μM C16-carnitine for 24h:

[0163] (1) Before extracting cell proteins, wash the cell culture dish three times with pre-cooled 1× PBS.

[0164] (2) Pipette an appropriate amount of RIPA lysis buffer (100×PMSF must be added) and add it to the cell culture dish. Incubate on ice for 15 min. Use a cell scraper to gently scrape the cells from the culture dish and transfer them to a 1.5 mL EP tube. The entire process needs to be performed on ice.

[0165] (3) After ultrasonic disruption of cells, centrifuge at 12,000 rpm for 15 min at 4°C.

[0166] (4) Take the supernatant as the total protein.

[0167] (5) Protein concentration was determined by BCA method.

[0168] (6) Add 5× loading buffer and heat to 100℃ for 10 min until boiling.

[0169] After exploring the total amount of protein, cell lysis solution concentration, digestion temperature and time, when each sample used a total protein amount of 120μg, a protein lysis solution concentration of 3.0μg / μL, pronase and protein lysis solution were first combined overnight and then combined at 25℃ for 1h, with a pronase / protein ratio of 1:250 and pronase digestion at 25℃ for 45min.

[0170] The polyacrylamide gel was stained with Coomassie Brilliant Blue. Fig.10 As shown, after adding 10μM, 100μM C16-carnitine treated samples, compared with the Control group (lane 0 in the figure), an obvious protected band was found at the position of 70kDa-95kDa.

[0171] Through mass spectrometry identification analysis, compared with the control group, the proteins with higher scores detected in the cell lysate after adding C16-carnitine were selected as candidate proteins: heat shock protein (Heat shock 70kDa protein 8, Hsc70), sterile alpha motif domain and histidine / aspartate domain-containing protein 1 (Sterile alpha motif domain andhistidine-aspartate domain-containing protein 1, Samhd1), IQ motif containing GTPase activating protein 1 (IQ motif containing GTPase activating protein 1, Iqgap1), lysine K-specific histone demethylase 1A (Lysine K-specific demethylase 1, Kdm1), N-alpha-acetyltransferase (N-alpha-acetyltransferase15, Narg1).

[0172] The candidate proteins Hsc70, Samhd1, Iqgap1, Kdm1 and Narg1 were verified in turn to see if they were binding proteins of C16-carnitine. The binding proteins were resistant to pronase digestion due to the protection of C16-carnitine.

[0173] Western blotting showed that Hsc70, Iqgap1, Kdm1 and Narg1 could be completely digested by pronase ( Fig.11 AD), which was not protected by C16-carnitine. It was found that Samhd1 was less sensitive to pronase, leaving a protected band ( Fig.11 E).

[0174] In summary, the DARTS results indicate that Samhd1 is a target protein for C16-carnitine in interstitial cells.

[0175] 2. Cact - / - Samhd1 expression levels are reduced in mouse lung tissue

[0176] In order to explore whether it is due to Cact - / - Increased C16-carnitine in mice acts on Samhd1 to induce Pdgfrα + Increased cell proliferation levels, detected by Western blotting, in Cact - / - Whether Samhd1 protein levels are altered in mice.

[0177] E18.5 day mice Control (Cact + / + ), Cact + / - 、P0 day Control(Cact + / + ) and P0 day Cact - / - Protein was extracted from mouse lung tissue, and the expression level of Samhd1 in lung tissue was detected by Western blotting. The results are as follows Fig.12 As shown in A, compared with the lung tissue of Control mice, Cact - / - The expression level of Samhd1 protein was reduced in the lung tissue of mice.

[0178] Immunofluorescence staining detection of Control and Cact - / - Co-localization of Pdgfrα protein and Samhd1 in mouse lung tissue.

[0179] The results are as follows Fig.12 As shown in B, it can be seen that compared with Control, Cact - / -Expression of Samhd1 protein in Pdgfrα in mouse lung tissue + Reduced expression and localization in cells.

[0180] In order to explore the expression level of Samhd1 protein in Cact - / - To determine whether the decrease in mouse lung tissue was due to C16-carnitine, primary interstitial cells from wild-type mice were isolated and cultured in vitro.

[0181] Normal culture (Control): Primary mesenchymal cells isolated and cultured in vitro on day P0 were cultured in DMEM basic (10% FBS, 1% PS).

[0182] C16-carnitine treatment: P0 primary mesenchymal cells isolated and cultured in vitro were cultured in DMEM basic (10% FBS, 1% PS) medium supplemented with different concentrations of 1 μM, 10 μM, 10 nM, and 100 nM C16-carnitine for 24 h.

[0183] The results of protein immunoblotting were as follows Fig.12 As shown in C, the expression level of Samhd1 was significantly reduced when primary mesenchymal cells were treated with 1 μM C16-carnitine ( Fig.12 C). Primary interstitial cells were treated with 1 μM C16-carnitine for 12 h, 24 h, and 36 h, and protein immunoblotting revealed that the expression level of Samhd1 was indeed reduced ( Fig.12 D).

[0184] The co-localization of Pdgfrα protein and Samhd1 was detected by immunofluorescence staining. The results showed that compared with the control, the co-localization of Samhd1 protein in primary mesenchymal cells treated with 1 μM C16-carnitine was significantly higher than that in the control group. + Decreased expression and localization in cells ( Fig.12 E).

[0185] In summary, C16-carnitine reduces Pdgfrα + Protein levels of Samhd1 in interstitial cells.

[0186] 3. Overexpression of Samhd1 can rescue Cact - / - Defective proliferation of mesenchymal progenitor cells in mice

[0187] To answer whether it is due to Samhd1 in Cact - / - Mouse Pdgfrα +The reduction of expression level in interstitial cells led to a significant increase in cell proliferation, in vitro isolated wild-type (denoted as Control) and Cact - / - Mouse lung primary mesenchymal cells were overexpressed with lentiviral pEF1-mCherry empty vector or pEF1-mCherry-Samhd1.

[0188] The specific steps are as follows:

[0189] Lentivirus pEF1-mCherry empty vector: transfect HEK293T cells with pEF1-mCherry plasmid (Clontech product catalog: 631972) to obtain lentivirus;

[0190] Lentivirus pEF1-mCherry-Samhd1: pEF1-mCherry-Samhd1 plasmid (a vector obtained by inserting the Samhd1 coding gene between the XbaⅠ and BamHⅠ restriction sites of the pEF1-mCherry vector) was transfected into HEK293T cells to obtain lentivirus.

[0191] Then, the lentiviral pEF1-mCherry empty vector and lentiviral pEF1-mCherry-Samhd1 were transfected into primary lung mesenchymal cells and Cacti isolated and cultured in vitro wild-type (Control) mice at an MOI of 10. - / - Mouse lung primary mesenchymal cells.

[0192] The cells were immunostained with Ki67 and Pdgfrα after 2 days of infection. Fig.13 As shown in A, compared with the control cells infected with lentivirus pEF1-mCherry (denoted as Ctrl(mCherry) in the figure), Cacti infected with lentivirus pEF1-mCherry - / - Cell (denoted as Cact - / - The phenotype of a significant increase in the number of Ki67 positive signals was consistent with the previous experimental results; Cacti infected with lentivirus pEF1-mCherry - / - Cell (denoted as Cact - / - Compared with Cacti infected with lentivirus pEF1-mCherry-Samhd1, - / - Cell (denoted as Cact - / - (mCherry-Samhd1)) showed a significant decrease in the number of Ki67 positive signals and could be restored to the proliferation level of Control cells ( Fig.13 AB).

[0193] Overexpression of Samhd1 can rescue Pdgfrα induced by Cact deficiency + The phenotype of interstitial cell proliferation indicates that it is indeed due to Cact - / - Mouse Pdgfrα + Reduced levels of Samhd1 protein in interstitial cells led to increased cell proliferation.

[0194] Therefore, we found the target protein Samhd1 of C16-carnitine, which can be used to rescue Pdgfrα caused by Cact deficiency. + Increased proliferation of interstitial cells may serve as a potential therapeutic target for neonatal respiratory distress.

Claims

1. Use of substances that inhibit the expression of Cact protein or coding gene, or substances that knock out all or part of the Cact coding gene in preparing animal models of respiratory distress syndrome.

2. The use according to claim 1, characterized in that: The animal model is a mammalian model; And / or, further, specifically a mouse model.

3. A method for preparing a mouse model of respiratory distress syndrome, comprising the following steps: knocking out exons 2-5 of the Cact gene on two chromosomes of the mouse to obtain a Cact gene knockout mouse; that is, a mouse model of respiratory distress syndrome.

4. Use of the mouse model prepared by the method of claim 3 in any of the following: 1) Screening or developing candidate therapeutic drugs for respiratory distress syndrome in humans or animals; 2) Screening drug targets for respiratory distress syndrome in humans or animals.

5. Application of C16-carnitine as a drug therapeutic target in the development of candidate therapeutic drugs for respiratory distress syndrome in humans or animals.

6. Application of C16-carnitine target protein in the preparation of candidate therapeutic drugs for respiratory distress syndrome in humans or animals; Alternatively, the target protein of C16-carnitine is used to prepare a therapeutic agent for Pdgfrα caused by Cact deficiency. + Application of products that increase the level of proliferation of interstitial cells triggers disease.

7. The use according to claim 6, characterized in that: The target protein of the C16-carnitine is Samhd1.

8. A product for treating respiratory distress syndrome in humans or animals, wherein the active ingredient is the target protein of C16-carnitine.

9. The product according to claim 8, characterized in that: The target protein of the C16-carnitine is the Samhd1 protein.

Images